Name: Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR (Video) | JoVE Journal
Uploaded: 2016-06-26T14:00:00.000+00:00
Duration: 7 min 37 s
Description: Learn to quantify circulating microRNAs in plasma or serum using droplet digital PCR with DNA-binding dye chemistry. This sensitive method enables cancer biomarker detection without reference genes.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

Supported by funding from the Italian Association for Cancer Research (AIRC) to MF (MFAG 11676) and to MN (Special Program Molecular Clinical Oncology - 5 per mille n. 9980, 2010/15) and from the Italian Ministry of Instruction, University and Research FIRB 2011 to MN (Project RBAPIIBYNP).

MicroRNA Isolation from Plasma or Serum
Note: Plasma and serum preparation is a relevant step in circulating miRNA quantification. There is no preferred procedure for plasma and serum preparation. The only important thing to consider is that all the samples from the same experiment must be processed using exactly the same workflow. Start from 200 &#181;l serum or plasma. Total RNA can be isolated from serum or plasma using commercially available kits.
1. Protocol for Total RNA (including miRNA) Isolation
<ol>
	<li>Thaw serum/plasma samples on ice.</li>
	<li>Add 1 ml of Lysis Reagent (e.g., QIAzol) to 200 &#181;l serum/plasma.</li>
	<li>Mix by vortexing and place the tube containing the homogenate on the bench at RT for 5 min.</li>
	<li>Add 3 &#181;l of a 4.16 nM solution of the synthetic miRNA cel-miR-39-3p from C. elegans.</li>
	<li>Add 200 &#181;l of chloroform. Shake the tube vigorously for 15 sec. Place the tube on the bench at RT for 2 min.</li>
	<li>Centrifuge for 15 min at 12,000 x g at 4 &#176;C to obtain phases separation: the upper aqueous phase contains RNA.</li>
	<li>Transfer the aqueous phase to a new tube, about 700 &#181;l, avoid transfer of any white interphase material.</li>
	<li>Add 1 ml of 100% ethanol and mix by inversion.</li>
	<li>Pipet up 700 &#181;l of the sample into a mini spin column placed on a 2 ml collection tube. Close the lid and centrifuge at 12,000 x g for 15 sec. Discard the flow-through.</li>
	<li>Repeat this step using the remaining sample.</li>
	<li>Add 700 &#181;l Buffer RWT to the mini spin column, close the lid and centrifuge for 15 sec at 12,000 x g to wash the column. Discard the flow-through.</li>
	<li>Pipet 500 &#181;l Buffer RPE into the mini spin column. Close the lid and centrifuge for 15 sec at 12,000 rpm. Discard the flow-through. Repeat this step again.</li>
	<li>Centrifuge the mini spin column at full speed for 2 min to dry the spin column membrane from residual ethanol.</li>
	<li>Transfer the mini spin column to a new 1.5 ml&#160;collection tube and pipet 35 &#181;l RNase-free water on the membrane of the column.</li>
	<li>Centrifuge for 1 min at 12,000 x g to elute the RNA.</li>
	<li>Store the RNA at -80 &#176;C. 
	Note: Since RNA concentration cannot be determined accurately, use fixed volumes as a measure for input amount.</li>
</ol>
2. MicroRNA Reverse Transcription
<ol>
	<li>Thaw the reverse transcription (RT) reagent mix components: 5x reaction buffer, nuclease-free water. Mix gently inverting the tubes and place on ice. Immediately before use, remove the enzyme mix from the freezer and place on ice. Spin down all reagents.</li>
	<li>Prepare the RT reagent mix on ice as described in Table 1. Prepare at least 10% exceeding mix.</li>
	<li>Mix the reaction by pipetting, and then spin down.</li>
	<li>Incubate for 60 min at 42 &#730;C.</li>
	<li>Heat-inactivate the reverse transcriptase for 5 min at 95 &#730;C.</li>
	<li>Immediately cool to 4 &#176;C.</li>
	<li>Store the cDNA at -20 &#176;C.</li>
</ol>
3. cDNA Dilution
<ol>
	<li>Dilute the amount of cDNA template needed for the planned ddPCR reactions in nuclease free water. Dilute the cDNA reaction between 1:50 and 1:500 in water, dependent on target miRNA abundance. Store the diluted cDNA at -20 &#176;C. The diluted cDNA proved to be stable for at least 3 months at -20 &#176;C.</li>
</ol>
4. Droplet Generation and PCR
Note: Droplet generation should be performed on 8 samples at a time. Technical replicates are not required, due to the high reproducibility of this technology 12,15.A No Template Control (NTC) sample should be run in every plate and for each different ddPCR condition.
<ol>
	<li>Thaw and equilibrate the master mix (e.g., EvaGreen Master Mix), microRNA primer set and cDNA at RT.</li>
	<li>Mix the Master Mix thoroughly by inverting the tube several times. Spin down all the reagents.</li>
	<li>Prepare the ddPCR mix as described in Table 2. When multiple ddPCR reactions are performed, prepare a ddPCR mix working-solution. Prepare at least 10% exceeding mix.</li>
	<li>Once assembled, thoroughly mix and spin down the ddPCR mix.</li>
	<li>Dispense 12 &#181;l of ddPCR mix into a 96-well PCR plate or PCR tubes.</li>
	<li>Add 8 &#181;l of diluted cDNA template to each tube/well.</li>
	<li>Insert the droplet generator cartridge into the holder.</li>
	<li>Transfer 20 &#181;l of each prepared sample to the sample wells (middle row) of the droplet generator cartridge carefully while avoiding air bubbles at the bottom of the well.</li>
	<li>Fill each oil well (bottom row) with 70 &#181;l of droplet generator oil.</li>
	<li>Hook the gasket over the cartridge holder and insert into the droplet generator.</li>
	<li>Close the lid to start droplet generation according to manufacturer&#39;s protocol. When droplet generation has finished, open the lid, remove the disposable gasket. The top wells of the cartridge contain the droplets.</li>
	<li>Pipet slowly and smoothly 40 &#181;l of the contents of the eight top wells (the droplets) into a single column of a 96-well PCR plate.</li>
	<li>Seal the PCR plate with foil immediately after transferring droplets to avoid evaporation. Use pierceable foil plate seals that are compatible with the needles in the droplet reader.</li>
	<li>Begin thermal cycling (PCR) within 30 min of sealing the plate.</li>
	<li>Perform the cycling protocol according to Table 3.</li>
</ol>
5. Droplet Reading
<ol>
	<li>Power on the droplet reader.</li>
	<li>Move the plate from the thermal cycler to the droplet reader.</li>
	<li>Place the 96-well PCR plate containing the post-PCR droplets into the base of the plate holder.</li>
	<li>Place the top of the plate holder on the PCR plate. Firmly press both release tabs down to secure the PCR plate in the holder.</li>
	<li>Start the software from the system PC.
	<ol>
		<li>Click Setup to define the experiment (Absolute quantification) then click Run to start the droplet reading.</li>
		<li>When droplet reading is complete, click &#34;Analyze&#34; button to open and analyze the data.</li>
		<li>Use the 2D amplitude plot in the analysis software to select the positive droplets (lasso tool) (Figure 1B).</li>
		<li>Use the Events tab to check the number of positive and total droplets. A total number of 18,000 - 21,000 droplets is usually achieved with probeless ddPCR.</li>
		<li>Once the positive droplets are selected, export the miRNA concentration values using the export .csv option from the Concentration tab.</li>
	</ol>
	</li>
</ol>

<ol><li>Arroyo, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Argonaute2+complexes+carry+a+population+of+circulating+microRNAs+independent+of+vesicles+in+human+plasma%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma.</a> Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).</li>
<li>Skog, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Glioblastoma+microvesicles+transport+RNA+and+proteins+that+promote+tumour+growth+and+provide+diagnostic+biomarkers%5BTitle%5D)+AND+%22Nat+Cell+Biol%22%5BJournal%5D)">Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers.</a> Nat Cell Biol. 10, 1470-1476 (2008).</li>
<li>Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((MicroRNAs+are+transported+in+plasma+and+delivered+to+recipient+cells+by+high-density+lipoproteins%5BTitle%5D)+AND+%22Nat+Cell+Biol%22%5BJournal%5D)">MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins.</a> Nat Cell Biol. 13, 423-433 (2011).</li>
<li>Braicu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Exosomes+as+divine+messengers%3A+are+they+the+Hermes+of+modern+molecular+oncology%5BTitle%5D)+AND+%22Cell+Death+Differ%22%5BJournal%5D)">Exosomes as divine messengers: are they the Hermes of modern molecular oncology.</a> Cell Death Differ. 22, 34-45 (2015).</li>
<li>Creemers, E. E., Tijsen, A. J., Pinto, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Circulating+microRNAs%3A+novel+biomarkers+and+extracellular+communicators+in+cardiovascular+disease%5BTitle%5D)+AND+%22Circ+Res%22%5BJournal%5D)">Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease.</a> Circ Res. 110, 483-495 (2012).</li>
<li>Guay, C., Regazzi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Circulating+microRNAs+as+novel+biomarkers+for+diabetes+mellitus%5BTitle%5D)+AND+%22Nat+Rev+Endocrinol%22%5BJournal%5D)">Circulating microRNAs as novel biomarkers for diabetes mellitus.</a> Nat Rev Endocrinol. 9, 513-521 (2013).</li>
<li>Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Clinical+relevance+of+circulating+cell-free+microRNAs+in+cancer%5BTitle%5D)+AND+%22Nat+Rev+Clin+Oncol%22%5BJournal%5D)">Clinical relevance of circulating cell-free microRNAs in cancer.</a> Nat Rev Clin Oncol. 11, 145-156 (2014).</li>
<li>Moldovan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Methodological+challenges+in+utilizing+miRNAs+as+circulating+biomarkers%5BTitle%5D)+AND+%22J+Cell+Mol+Med%22%5BJournal%5D)">Methodological challenges in utilizing miRNAs as circulating biomarkers.</a> J Cell Mol Med. 18, 371-390 (2014).</li>
<li>Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Challenges+in+Using+Circulating+miRNAs+as+Cancer+Biomarkers%5BTitle%5D)+AND+%22Biomed+Res+Int%22%5BJournal%5D)">Challenges in Using Circulating miRNAs as Cancer Biomarkers.</a> Biomed Res Int. 2015, 731479(2015).</li>
<li>Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+validity+of+circulating+microRNAs+in+oncology%3A+five+years+of+challenges+and+contradictions%5BTitle%5D)+AND+%22Mol+Oncol%22%5BJournal%5D)">The validity of circulating microRNAs in oncology: five years of challenges and contradictions.</a> Mol Oncol. 8, 819-829 (2014).</li>
<li>Witwer, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Circulating+MicroRNA+Biomarker+Studies%3A+Pitfalls+and+Potential+Solutions%5BTitle%5D)+AND+%22Clin+Chem%22%5BJournal%5D)">Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions.</a> Clin Chem. 61, 56-63 (2015).</li>
<li>Miotto, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quantification+of+Circulating+miRNAs+by+Droplet+Digital+PCR%3A+Comparison+of+EvaGreen-+and+TaqMan-Based+Chemistries%5BTitle%5D)+AND+%22Cancer+Epidemiol+Biomarkers+Prev%22%5BJournal%5D)">Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries.</a> Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).</li>
<li>Ferracin, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Absolute+quantification+of+cell-free+microRNAs+in+cancer+patients%5BTitle%5D)+AND+%22Oncotarget%22%5BJournal%5D)">Absolute quantification of cell-free microRNAs in cancer patients.</a> Oncotarget. , (2015).</li>
<li>Mangolini, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Diagnostic+and+prognostic+microRNAs+in+the+serum+of+breast+cancer+patients+measured+by+droplet+digital+PCR%5BTitle%5D)+AND+%22Biomarker+Research%22%5BJournal%5D)">Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR.</a> Biomarker Research. , (2015).</li>
<li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nat Methods. 10, 1003-1005 (2013).</li>
<li>Mestdagh, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evaluation+of+quantitative+miRNA+expression+platforms+in+the+microRNA+quality+control+%28miRQC%29+study%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study.</a> Nat Methods. 11, 809-815 (2014).</li>
</ol>

The authors have nothing to disclose.

Circulating miRNAs are present in blood at extremely low concentrations and the amount of RNA that can be extracted from plasma and serum samples is low. For this reason, they are difficult to quantify with other techniques such as microarray and RNA sequencing. Moreover, there is a generalized lack of agreement on data normalization and the presence of endogenous &#34;reference&#34; miRNAs in the blood. In this context, a sensitive technology like droplet digital PCR, capable of counting the number of miRNA copies per m...

MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles 1-3. They are believed to function as cell-to-cell communicators 4, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases 5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already described elsewhere 8,9, miRNA quantification in serum or plasma, as well as other body fluids, could be very challenging 10,11. We recently developed a method for the absolute quantification of circulating miRNAs, based on miRNA-specific LNA primers and DNA-binding dye droplet digital PCR (ddPCR) technology 12. This methodology has been applied to the validation of miRNA breast cancer biomarkers 13,14. 
After the partitioning of each reverse-transcribed miRNA molecule inside a nanoliter-sized droplet, it is possible to count the copy number of each miRNA in each sample, basically counting the number of green, and therefore positive, fluorescent droplets. As soon as a PCR reaction occurs, a positive count is achieved, without the need to establish a standard curve or taking PCR efficiency into account in target amount calculation, as it happens with quantitative RT-PCR (RT-qPCR). In addition, ddPCR proved to be more sensitive and accurate than RT-qPCR in circulating miRNA quantification 15. In this article we present the detailed protocol of this methodology, discussing the most relevant steps andspecifically considering serum and plasma clinical samples.

<table><tbody><tr><td>miRNeasy Mini Kit</td><td>Qiagen</td><td>217004</td><td>Columns for total RNA, including miRNA, extraction from serum/plasma</td></tr><tr><td>100 nmole RNA oligo Cel-miR-39-3p</td><td>Integrated DNA Technologies</td><td>Custom</td><td>Sequence: UCACCGGGUGUAAAUCAGCUUG</td></tr><tr><td>Universal cDNA synthesis kit II, 8-64 rxns</td><td>Exiqon</td><td>203301</td><td>Kit for microRNA reverse transcription</td></tr><tr><td>MicroRNA LNA PCR primer set&amp;nbsp;</td><td>Exiqon</td><td>204000-206xxx and 2100000-21xxxxx</td><td>Primers for miRNA amplification inside droplets</td></tr><tr><td>QX200 droplet generator</td><td>BioRad</td><td>186-4002</td><td>Instrument used for droplet reading</td></tr><tr><td>QX200 droplet reader</td><td>BioRad</td><td>186-4003</td><td>Instrument used for droplet generation</td></tr><tr><td>QuantaSoft software</td><td>BioRad</td><td>186-3007</td><td>Software for data collection and analysis</td></tr><tr><td>PX1 PCR plate sealer</td><td>BioRad</td><td>181-4000</td><td>Plate sealer</td></tr><tr><td>DG8 droplet generator cartridges and gaskets</td><td>BioRad</td><td>186-4008</td><td>Cartridges used to mix sample and oil to generate droplets</td></tr><tr><td>QX200 ddPCR EvaGreen supermix</td><td>BioRad</td><td>186-4033/36</td><td>PCR supermix</td></tr><tr><td>QX200 droplet generator oil for EvaGreen dye</td><td>BioRad</td><td>186-4005</td><td>Oil for droplet generation</td></tr></tbody></table>

circulating microrna quantification using dna-binding dye chemistry and droplet digital pcr

Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been linked to a disease state and has the potential to be used as disease biomarker. A sensitive and accurate method for circulating microRNA quantification using a dye-based chemistry and droplet digital PCR technology has been recently developed. Specifically, using Locked Nucleic Acid (LNA)-based miRNA-specific primers with a green fluorescent DNA-binding dye in a compatible droplet digital PCR system it is possible to obtain the absolute quantification of specific miRNAs. Here, we describe how performing this technique to assess miRNA amount in biological fluids, such as plasma and serum, is both feasible and effective.

The absolute amount of specific miRNAs per ml of plasma or serum can be determined using a green fluorescent DNA-binding dye and droplet digital PCR technology. Figure 1 presents the process of positive-droplets selection, which determines the final miRNA concentration (copies/µl) in the amplification reaction calculated by the analysis software. The amount of each miRNA in the blood is very different, being some miRNA species more abundant than others. Using a 1:50 dilut...

A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been ...

The overall goal of this procedure is to quantify circulating microRNAs and biological fluids, such as plasma or serum, using droplet digital PCR technology. The method can help answer question in the biomarket field. By identifying diagnostic and prognostic, biomarketing cancer.The main advantage of this technique is at the high sensitivity. It can be used to quantify also the less abundant microRNAs without requiring an androgynous reference gene. Implication of this method extend toward cancer diagnostic because it has the potential to identify people with early stage cancer.It can also be applied to other diseases such as neurological or cardiac disorders. Generally, individuals need to pay attention to the manipulation of droplets before thermal cycling step to avoid their disruption. Hence, a visual demonstration of the droplet generation is critical because the droplets can be destroyed by careless manipulation or too fast pipetting.Begin this procedure by isolating plasma or serum microRNAs. Then reverse transcribing and diluting them as described in the accompanying document. Remove the EvaGreen master mix microRNA primer set and cDNA from the freezer and allow them to thaw at room temperature.After it has thawed, invert the master mix tube several times. And then spin down all of the reagents. Prepare a droplet digital, or ddPCR mix working solution according to the instructions in the accompanying document.Prepare enough for up to eight samples with a no-template control for each condition plus an excess of 10%Once assembled, thoroughly mix and spin down the ddPCR mix. Note that technical replicates are not required due to the high-reproducibility of this technology. After the spin, dispense 12 microliters of ddPCR mix into each well of a 96-well PCR plate.Add eight microliters of diluted cDNA template to each well. Then insert the droplet generator cartridge into the cartridge holder. To the middle row of the droplet generator cartridge, carefully transfer 20 microliters of each prepared sample.Avoid introducing air bubbles to the bottom of the well. Fill each of the oil wells in the bottom row with 70 microliters of droplet generator oil. Hook the gasket over the cartridge holder.Insert into the droplet generator and close the lid to start the droplet generation. When the droplet generation has finished, open the lid, remove the cartridge from the droplet generator, and remove the disposable gasket. The top wells of the cartridge contain the droplets.Slowly and smoothly transfer 40 microliters from each of the eight top wells into a single column of a 96-well PCR plate. Immediately seal the plate with foil to avoid evaporation. Within 30 minutes of sealing the plate, begin thermal cycling using the PCR protocol described in table three of the accompanying document.Power on the droplet reader. Then move the plate from the thermal cycler to the droplet reader. Place the 96-well PCR plate containing the post-PCR droplets into the base of the plate holder in the droplet reader.Place the top of the plate holder on the PCR plate. Firmly press both release tabs down to secure the PCR plate in the holder. Start the QuantaLife software from the system PC.Click Setup and open the template data file which has information about the samples, target genes, and assays.From the left-side navigation bar, select Run. A Run Options window will appear. From the Dye Set menu, select EVA, and click OK to start the droplet reading.Once the run is complete, use the 2D Amplitude plot in the analysis software to select the positive droplets. To select the positive droplets, use the lasso tool from the left-side navigation bar. Next, click on the Events tab to check the number of positive and total droplets.A total number of 18, 000 droplets are usually achieved with probeless ddPCR. Then click on the Concentration tab to visualize the final sample of concentration. Finally use the Export.CSV to export the microRNA concentration values. The mRNA miR-181a-5p was quantified in two plasma samples, S1 and S2, using 0.5 and one microliter primer concentration at annealing temperatures of 58 and 60 degrees Celsius. This figure presents the copies of microRNA per microliter in the amplification reaction for each condition.PCR positive droplets for each sample are shown in blue, and negative droplets are shown in black. As can be seen here, the control sample has no positive droplets as expected. Performing the PCR at 60 degrees Celsius with using either a 0.5 or one microliter of primer resulted in a better separation of positive and negative droplets.In this figure, the error bars represent the Poisson 95%confidence interval. And here, the number of positive droplets shown in blue, are compared to the total number of droplets, shown in green. Taken together, these data demonstrate that the droplet digital PCR can be used to determine the absolute number of copies of microRNA per microliter of a biological fluid.After watching this video, you should have a good understanding on how to perform a mRNA quantification using droplet digital PCR. Once mastered, 96 samples can be analyzed in just a few hours, which is an optimal output for a clinical setting. After each development, this technique pave the way to the field of liquid biopsy to explore microRNA and other nucleic acid as disease biomarkers.

circulating-microrna-quantification-using-dna-binding-dye-chemistry

Research

JoVE Journal

Bioengineering

Here we describe an optimized multiplex reverse transcriptase quantitative PCR (qRT-PCR) protocol in combination with a microfluidic platform as a cost and time effective high-throughput screening tool for microRNA (miRNA) expression levels, especially when working with limited amounts of sample.

High Throughput MicroRNA Profiling: Optimized Multiplex qRT-PCR at Nanoliter Scale on the Fluidigm Dynamic ArrayTM IFCs

In this video, we present a step-by-step procedure to generate emulsified nano-droplets to detect target nucleic acids by digital polymerase chain reaction or dPCR.

Droplet Digital Polymerase Chain Reaction: A Method to Generate Nanodroplet PCR Reactions for Detecting Rare Tumor Mutations

In this video, we demonstrate the duplex digital PCR (ddPCR) technique — a modification of the traditional PCR technique that is useful in detecting two different genetic markers simultaneously. A single PCR reaction is partitioned into nanoliter-sized emulsified droplets that are independently amplified, and the detection of differently colored fluorescence amplification signals from the fraction of droplets is used to compute the initial concentration of the target sequences.

Duplex Digital PCR for Simultaneous Quantification of Dual Genetic Markers

MicroRNAs (miRNAs) are a widely conserved class of regulatory molecules. Here we describe a miRNA cloning method that relies upon two potent ligation steps followed by high-throughput sequencing. Our method permits accurate genome-wide quantitation of miRNAs.

Highly Efficient Ligation of Small RNA Molecules for MicroRNA Quantitation by High-Throughput Sequencing

Circulating microRNAs have recently emerged as promising and novel biomarkers for various cancers and other diseases. The goal of this article is to discuss three different probe-based real-time PCR platforms and methods that are available to quantify and determine the abundance of circulating microRNAs.

Probe-based Real-time PCR Approaches for Quantitative Measurement of microRNAs

We describe an endpoint digital assay for quantifying nucleic acids with a simplified (analog) readout. We measure bulk fluorescence of droplet-based digital assays using a standard qPCR machine rather than specialized instrumentation and confirm our results by microscopy.

Simple Bulk Readout of Digital Nucleic Acid Quantification Assays

This report describes a protocol for measuring the absolute levels of plasma miRNA, using quantitative real-time reverse transcription PCR with or without pre-amplification. This protocol affords better understanding of the quantity of plasma miRNAs and allows qualitative assessment of corresponding data from different studies or laboratories.

Absolute Quantification of Plasma MicroRNA Levels in Cynomolgus Monkeys, Using Quantitative Real-time Reverse Transcription PCR

Circulating microRNAs have shown promise as biomarkers for cardiovascular diseases and acute myocardial infarctions. In this study, we describe a protocol for miRNA extraction, reverse transcription, and digital PCR for the absolute quantification of miRNAs in the serum of patients with cardiovascular disease.

Digital PCR for Quantifying Circulating MicroRNAs in Acute Myocardial Infarction and Cardiovascular Disease

Here, we present a protocol to detect tumor somatic mutations in circulating DNA present in patient biological fluids (biofluids). Our droplet digital polymerase chain reaction (dPCR)-based method enables quantification of the tumor mutation allelic frequency (MAF), facilitating a minimally invasive complement to diagnosis and temporal monitoring of tumor response.

Detection and Monitoring of Tumor Associated Circulating DNA in Patient Biofluids

Here we present a protocol for measuring absolute mitochondrial (mt)DNA copy number and mtDNA deletion heteroplasmy levels in single cells.

Measuring Single-Cell Mitochondrial DNA Copy Number and Heteroplasmy Using Digital Droplet Polymerase Chain Reaction

This protocol describes the detailed method of digital droplet PCR (dd-PCR) for precise quantification of circular RNA (circRNA) levels in cells using divergent primers.

Quantification of Circular RNAs Using Digital Droplet PCR

Learn to quantify circulating microRNAs in plasma or serum using droplet digital PCR with DNA-binding dye chemistry. This sensitive method enables cancer biomarker detection without reference genes.

Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

Explore More Videos