A subscription to JoVE is required to view this content. Sign in or start your free trial.

Research Article

The Impact of CYP3A4, COMT V158M, and OPRM A118G Gene Polymorphisms on the Effectiveness of Sufentanil in Labor Analgesia

403 views

DOI:

10.3791/69160

September 16th, 2025

* These authors contributed equally

In This Article

Summary

Here, we present a method to evaluate the impact of CYP3A4, COMT V158M, and OPRM1 A118G polymorphisms on sufentanil efficacy and maternal outcomes during labor analgesia, enabling pharmacogenetic analysis to guide personalized pain management.

Abstract

Genetic polymorphisms in CYP3A4, COMT V158M, and OPRM A118G may influence analgesic response, hemodynamic regulation, and postpartum recovery, while parity is thought to affect labor outcomes and adverse events. This study investigated how these genotypes and parity impact maternal and neonatal outcomes, labor duration, pain control, and postpartum complications in 380 pregnant women stratified by genotype. Data on baseline characteristics, labor duration, VAS pain scores, and postpartum adverse events were collected, and safety indicators such as blood pressure, heart rate, fetal outcomes, and Apgar scores were analyzed. Associations between parity and postpartum responses were explored using univariate and logistic regression models. Baseline variables were largely comparable across genotypes except for a higher BMI in the CYP3A4 CT/TT group. Sufentanil consumption was significantly higher in CYP3A4 CT/TT and OPRM A118G GA/GG carriers, although labor duration did not differ among genotypes. OPRM A118G GA/GG carriers also showed a higher incidence of fever (P = 0.016) and greater reductions in blood pressure after intervention (P < 0.001), though all groups achieved similar pain relief. Multiparas experienced less urinary retention (P = 0.005) but more pruritus (P = 0.011), and logistic regression confirmed smaller decreases in systolic blood pressure (OR = 1.049, P = 0.001) and lower risk of pruritus (OR = 0.326, P = 0.01) in this group. Although CYP3A4, COMT, and OPRM A118G genotypes did not broadly influence maternal or neonatal outcomes, carriers of CYP3A4 CT/TT and OPRM A118G GA/GG required higher sufentanil doses and displayed genotype-specific hemodynamic responses, while parity was associated with distinct adverse event profiles and blood pressure changes. These findings highlight the relevance of genetic polymorphisms and parity in guiding personalized postpartum care.

Introduction

Labor pain ranks among the most severe forms of pain a woman can experience. Effective pain management is crucial, not only for comfort but also to reduce associated stress and psychological distress1,2. Inadequate control of labor pain may trigger shifts in maternal hormones, such as catecholamines and endorphins, which can lower pain thresholds and heighten anxiety about childbirth. This increased pain sensitivity may induce significant adverse emotional reactions in both the mother and fetus, potentially resulting in trauma3,4. Therefore, pain relief is a priority for many laboring women. Epidural analgesia remains one of the most effective and widely used methods for labor pain relief, with intravenous opioids and non-pharmacological options providing alternative approaches under specific conditions5,6.

Labor pain management is a considerable challenge for modern medicine. A range of pharmacologic and nonpharmacologic strategies is available to ease labor pain in pregnant women7. Sufentanil, a moderate-acting opioid, is frequently administered via epidural for labor analgesia8,9,10. While dosage is typically guided by factors such as age, weight, and clinical expertise, individual responses to sufentanil can vary greatly. Standard doses may be insufficient for some women, while others might experience adverse effects like weakened contractions, prolonged labor, or respiratory depression11,12. Effective labor analgesia not only alleviates maternal pain but also reduces rates of cesarean delivery, postpartum hemorrhage, postpartum depression, and neonatal asphyxia.

The OPRM1 A118G, CYP3A4, and COMT V158M polymorphisms are associated with individual variations in response to sufentanil. Sufentanil, a potent synthetic opioid, is primarily metabolized by the hepatic enzyme CYP3A4 of the cytochrome P450 family13,14. The presence of the G allele in OPRM1 A118G is linked to lower pain and tolerance thresholds, suggesting its significant role in individual differences in pain perception. Specifically, 118G allele mutations may heighten pain sensitivity and diminish tolerance, highlighting genetic contributions to pain response variability15. Variants in CYP3A4, particularly the CYP3A4*1G allele, correlate with reduced sufentanil consumption due to decreased enzymatic activity16,17,18. This variant's frequency varies considerably by race, observed in 18.8%-27.9% of Chinese populations versus 7.9% in Caucasians19. Although CYP3A4*1B is prevalent (up to 45% in African Americans), it does not impact CYP3A4 substrate metabolism. The COMT V158M polymorphism influences dopamine metabolism, with the Met allele linked to increased dopamine levels, potentially enhancing prefrontal cortex-driven executive functions20.

Genetic variations have the potential to affect drug safety and effectiveness by altering metabolic pathways and receptor binding affinities. However, the influence of OPRM1 A118G, COMT V158M, and CYP3A4 polymorphisms on the efficacy of sufentanil epidural analgesia during labor in Chinese populations remains unexplored. This study seeks to evaluate whether these genetic polymorphisms could serve as predictive markers of analgesic response, thereby providing a theoretical and practical framework for individualized sufentanil dosing in epidural labor analgesia.

Compared with traditional empirical dosing, which relies primarily on age, body weight, or clinician experience, a pharmacogenetic approach offers the advantage of tailoring sufentanil administration to the patient's genetic background. This strategy has the potential to reduce ineffective dosing, minimize adverse effects, and improve maternal-fetal safety by predicting analgesic needs more precisely than standard methods or alternative protocols.

Nevertheless, the clinical applicability of pharmacogenetic dosing must be considered within specific contexts. Genetic testing may not be feasible in urgent settings due to time and cost constraints, and allele frequencies differ across populations, limiting the generalizability of findings. Therefore, this approach is most suitable for elective or high-risk cases where pre-labor genotyping is available, and for populations in which relevant polymorphisms occur at clinically meaningful frequencies.

Access restricted. Please log in or start a trial to view this content.

Protocol

The reagents and equipment used in this study are listed in the Table of Materials.

1. Study design, setting, and participant selection

This prospective observational study investigated the effects of OPRM1 A118G, COMT V158M, and CYP3A4 genetic polymorphisms on the safety and efficacy of sufentanil for labor analgesia. Participants were recruited from women aged 18-45 years with uncomplicated singleton cephalic pregnancies between 37-42 weeks of gestation, who received labor analgesia at the study institution from September 1, 2020, to December 31, 2023. The study was conducted in accordance with the Declaration of Helsinki, and the protocol was approved by the Institutional Review Board (IRB) of Xiamen Maternity and Child Health Care Hospital (Approval No. KY-2019-056), and written informed consent was obtained from all participants.

  1. Inclusion criteria
    The inclusion criteria were: Maternal age between 18-45 years; Gestational age 37-42 weeks; Singleton pregnancy with cephalic presentation; ASA physical status I or II.
  2. Exclusion criteria:
    The exclusion criteria were: Multifetal pregnancies; Significant hepatic or renal impairment; Hypertensive disorders of pregnancy; Intrauterine infection; History of substance abuse or chronic pain syndromes; Recent use of blood products or monoamine oxidase inhibitors; Contraindications to epidural anesthesia.

2. Epidural anesthesia procedure for labor analgesia

  1. Preparation
    The patient's identity, medical history, and informed consent were verified. The necessary equipment, including a 16 G Tuohy needle, epidural catheter, ropivacaine, sufentanil, and PCEA system, was prepared.
  2. Needle insertion and epidural puncture
    The patient was positioned appropriately, in the left lateral posture. The L3-L4 intervertebral space was located by palpating the iliac crest. The 16 G Tuohy needle is inserted, and the loss-of-resistance technique is used to identify the epidural space.
  3. Confirming epidural space and catheter placement
    Once resistance is lost, advance the epidural catheter. Aspirate the catheter to confirm correct placement; neither blood nor CSF should be aspirated. Catheter resistance is verified to confirm proper positioning.
  4. Bolus administration and monitoring block efficacy
    A bolus of 6-15 mL of 0.08% ropivacaine with 0.3 µg/mL sufentanil was injected. Pain relief was expected to begin within 10-15 min, at which point efficacy is assessed in terms of pain relief and motor block. If the block is inadequate or incomplete, the dose or infusion rate is adjusted.
  5. Continuous infusion and PCEA use
    A continuous infusion was started at a rate of 8 to 12 mL/h. The PCEA system was set with the appropriate bolus dose and lock-out interval (e.g., 6-8 mL with a 10-min lock-out).
  6. Post-procedure monitoring
    Continuous monitoring was performed for potential adverse effects such as hypotension, bradycardia, blood pressure, fever, and pruritus. The infusion rate or PCEA settings are adjusted based on patient feedback and pain levels21.

3. Genotyping and quality control

  1. Sample collection and DNA extraction
    Peripheral venous blood samples (5-6 mL) were collected from each participant prior to labor analgesia administration, using anticoagulant-treated collection tubes. Samples were immediately stored at -80 °C until DNA extraction. Genomic DNA was extracted from whole blood samples using a commercial DNA extraction kit, following the manufacturer's standard protocol. DNA concentration and purity were assessed by spectrophotometry (e.g., measuring the A260/A280 ratio).
  2. Primer sequences for genotyping
    Genotyping of OPRM1 A118G, COMT V158M, and CYP3A4 polymorphisms was performed by polymerase chain reaction (PCR) coupled with ligase detection reaction (LDR). Specific primers for each polymorphism were designed and synthesized according to published sequences. CYP3A4*1G (rs2242480) primers included forward: ATCACTAGCACATCATTTGGAG-, reverse: GGGGATTTGAGGGGCTTCACTTA. OPRM1 A118G (s1799971) primers included forward: GGTCAACTTGTCCCACTTAGATCG, reverse: GGTGCATAGAGGGTTGATGAGTAC. COMT V158M (rs4680) primers included Reverse: forward: TCGAGATGTTTTCAGAGCATGG, reverse: GATGGTGGATTTCGCTGGC.
  3. Polymerase Chain Reaction (PCR) conditions
    PCR reactions were carried out in a 15 µL volume containing 3 µL of 10× buffer, 0.5 µL of dNTP mixture, 1 µL of DNA template (20-50 ng/µL), 10 µM of each primer, 0.3 µL of Taq DNA polymerase, and distilled water. Thermal cycling conditions consisted of an initial denaturation at 95 °C for 5 min, followed by 35 cycles of 94 °C for 20 s, 55 °C for 20 s, and 72 °C for 40 s, with a final extension step.
  4. Ligase Detection Reaction (LDR) conditions
    For LDR, a 10 µL reaction mix containing 3 µL of PCR product, 1 µL of 10× Taq DNA ligase buffer, 0.125 µL of Taq DNA ligase (40 U/µL), and 10 µM probes was prepared. Cycling conditions included 30 cycles of 94 °C for 20 s and 58 °C for 90 s, followed by a final denaturation at 95 °C for 3 min, and storage at 4 °C22.
  5. Genotyping analysis and quality control
    Genotyping results were obtained by sequencing the purified PCR products using a capillary electrophoresis DNA sequencer (a specific model and manufacturer are detailed in the Table of Materials). Purification was performed using a commercial PCR purification kit per the manufacturer's instructions. Sequence comparison and SNP analysis were conducted using GeneMarker software. The software was used to align sequence reads bidirectionally, identify polymorphic sites, and call genotypes based on peak patterns. Two independent researchers manually reviewed all genotype calls to ensure accuracy.
    Quality control measures included checking Mendelian inheritance consistency within family trios, calculating genotyping call rates, assessing Hardy-Weinberg equilibrium for each polymorphism using exact tests, and determining minor allele frequencies. These analyses were performed using Haploview software (version 4.2). SNPs deviating from the Hardy-Weinberg equilibrium (P < 0.01) or with call rates below 95% were excluded from further analysis23.

4. Data collection

Pain intensity was assessed using the Visual Analog Scale (VAS) at multiple time points: 0 min, 5 min, 10 min, 15 min, and 20 min after sufentanil administration. Maternal vital signs and fetal heart rate (FHR) patterns were continuously monitored, and safety parameters such as Apgar scores were recorded.

5. Statistical analysis and visualization

  1. Statistical methods
    For continuous variables, means ± SD were used for normally distributed data, while medians and interquartile ranges (IQR) were used for non-normally distributed data. Categorical variables were analyzed using Pearson's chi-square or Fisher's exact test. Comparisons of maternal characteristics across genotype groups were made using independent t-tests or non-parametric tests as appropriate. Propensity score matching was used to adjust for confounders such as maternal age, BMI, and parity. Repeated-measures ANOVA was used to analyze longitudinal data across multiple time points, including VAS scores, labor duration, and maternal vital signs. Statistical significance was defined as a two-sided p-value < 0.05.
  2. Multivariate analysis of clinical outcomes
    To analyze the relationship between clinical variables and physiological outcomes, multivariate logistic regression was performed using statistical software. This analysis assessed associations between parity, systolic blood pressure (SBP) changes, and the incidence of pruritus. As shown in Table 1, multiparity was significantly associated with a smaller reduction in SBP during the first 15 min (odds ratio [OR] = 1.049, 95% confidence interval [CI]: 1.020-1.079, P = 0.001). Conversely, pruritus was inversely associated with multiparity (OR = 0.326, 95% CI: 0.838-13.696, P = 0.01), indicating that multiparous individuals were less likely to experience pruritus. These findings suggest that parity influences early post-procedural hemodynamic stability and adverse symptom development, emphasizing the need to consider parity in postpartum clinical care.

Access restricted. Please log in or start a trial to view this content.

Results

General information
A schematic representation of the study framework is presented in Figure 1. A total of 380 eligible participants were identified. The mean (SD) age was 30.49 ± 3.87 years for the CYP3A4 CC group, 30.44 ± 3.68 years for the CYP3A4 CT/TT group, 30.53 ± 3.95 years for the COMT GG group, 30.40 ± 3.62 years for the COMT GA/AA group, 30.70 ± 3.89 years for the OPRM1 A118G AA group, and 30.30 ± 3.73 years for the OPRM1 A118G GA/GG group, with no significant ...

Access restricted. Please log in or start a trial to view this content.

Discussion

This study aimed to investigate the effects of CYP3A4, COMT V158M, and OPRM genotypes on maternal and infant outcomes, duration of labor, postpartum adverse reactions, and visual analog scale (VAS) pain scores in 380 pregnant women. Key findings indicate that, although demographic factors were generally comparable across groups, women with the CYP3A4 CT/TT genotype had higher pre-pregnancy and prenatal BMI levels than those with the CYP3A4 CC genotype (P = 0.002 and P = 0.021, respectively). Moreover, s...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have no conflicts of interest to declare.

Acknowledgements

None.

DATA AVAILABILITY:
All data generated in this study have been fully discussed and presented in Supplementary File 1.

AUTHOR CONTRIBUTION:
Huiqiong Huang, Yunhong Zhang, and Junxiang Jia contributed equally to this work. Huiqiong Huang and Yunhong Zhang were responsible for study design and planning, data collection and entry, as well as literature analysis and research. Junxiang Jia contributed to data collection, statistical analysis, and data interpretation. Zhuanghui Zhu supervised the study, contributed to the study design and data interpretation, and provided funding support. All authors were involved in manuscript preparation and final approval.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
16-Gauge Polyethylene CatheterSmiths Medical504-009Used for tracheal intubation in rats
17-Gauge Tuohy NeedleB. Braun331090Used for epidural puncture at L3-L4
Annexin V-FITCBD Biosciences556547Used in apoptosis detection with flow cytometry
Capillary Electrophoresis DNA SequencerApplied Biosystems3730xlUsed to sequence PCR products for genotyping
Collagenase Type IIWorthingtonLS0041760.2%, for enzymatic digestion of cardiac tissue
DNA Extraction KitQiagen69504Extracts genomic DNA from whole blood samples
Flow Cytometer (488 nm)BD Biosciences342940Used to detect Annexin V-FITC/PI labeled cells
GeneMarker SoftwareSoftGeneticsGM2024Used for SNP analysis and genotype calling
Generic Graphing SoftwareGraphPadv9.5Used for visualization of statistical data
Haploview SoftwareBroad Institutev4.2Used for Hardy-Weinberg equilibrium and LD analysis
Infusion PumpSmiths MedicalCADD-5700Used for continuous epidural drug infusion
LidocaineNot specifiedNot specified0.8%, 3 ml test dose for epidural test block
Nylon Suture (8-0)EthiconW9823Used for LAD coronary artery ligation in MIRI model
PCEA SystemB. Braun331090Patient-controlled epidural analgesia system
PCR Purification KitOmega Bio-TekD2500-01Purifies PCR products before sequencing
Pentobarbital SodiumMerck1.460053% solution, 50 mg/kg for anesthesia of rats
Polyethylene TubingBecton Dickinson431432Used to create reversible coronary ligation
Propidium Iodide (PI)Sigma-AldrichP4170Used at 5 µg/ml for apoptosis detection
ProteaseSigma-AldrichP51470.1%, used with collagenase for tissue digestion
RopivacaineNot specifiedNot specified0.08% concentration for labor analgesia
Statistical SoftwareIBM SPSSv29.0Used for RM-ANOVA, logistic regression, and PSM
SufentanilNot specifiedNot specifiedUsed for epidural labor analgesia (0.3 µg/ml)
Taq DNA LigaseNew England BiolabsM0208LUsed in LDR reaction for genotyping
Taq DNA PolymeraseTakaraRR001AUsed in PCR amplification for genotyping

References

  1. Anim-Somuah, M., Smyth, R. M., Cyna, A. M., Cuthbert, A. Epidural versus non-epidural or no analgesia for pain management in labour. Cochrane Database Syst Rev. 5 (5), Cd000331(2018).
  2. Westlind-Johnsson, A., et al. Comparative analysis of CYP3A expression in human liver suggests only a minor role for CYP3A5 in drug metabolism. Drug Metab Dispos. 31 (6), 755-761 (2003).
  3. Zhu, R., Pan, Q., Cao, X. Comparisons of nonpharmaceutical analgesia and pharmaceutical analgesia on the labor analgesia effect of parturient women. Immun Inflamm Dis. 11 (7), e869(2023).
  4. Agrawal, D., Makhija, B., Arora, M., Haritwal, A., Gurha, P. The effect of epidural analgesia on labour, mode of delivery and neonatal outcome in nullipara of india, 2011-2014. J Clin Diagn Res. 8 (10), Oc03-Oc06 (2014).
  5. Freeman, L. M., et al. Patient-controlled analgesia with remifentanil versus epidural analgesia in labour: Randomised multicentre equivalence trial. Bmj. 350, h846(2015).
  6. Czech, I., et al. Pharmacological and non-pharmacological methods of labour pain relief-establishment of effectiveness and comparison. Int J Environ Res Public Health. 15 (12), 2792(2018).
  7. Ahirwar, A., et al. Patient-controlled epidural labour analgesia (PCEA): A comparison between ropivacaine, ropivacaine-fentanyl and ropivacaine-clonidine. J Clin Diagn Res. 8 (8), Gc09-Gc13 (2014).
  8. Wang, X., et al. Comparison between the use of ropivacaine alone and ropivacaine with sufentanil in epidural labor analgesia. Medicine (Baltimore). 94 (43), e1882(2015).
  9. Rs, S., D'lima, S. K., Shahanaz,, Mateti, U. V., Sonkusare, S. Assessment of pain and maternal complications after normal vaginal delivery. J Obstet Gynaecol. 42 (5), 989-993 (2022).
  10. Dabo, F., Grönbladh, A., Nyberg, F., Sundström-Poromaa, I., Akerud, H. Different SNP combinations in the gch1 gene and use of labor analgesia. Mol Pain. 6, 41(2010).
  11. Hashemnejad, M., et al. Administering intrathecal sufentanil during the second stage of labor: Impact on duration. Ann Med Surg (Lond). 87 (4), 1828-1832 (2025).
  12. Yang, C., Li, Y., Hu, J., Wu, J., Huang, S. The relationship between pre-operative glycosylated haemoglobin and opioid consumption after caesarean section in women with gestational diabetes mellitus. Front Endocrinol (Lausanne). 13, 910914(2022).
  13. Shu, X., Yan, Y., Yu, J., Chi, L. Cytochrome p4503a4 gene polymorphisms guide safe sufentanil analgesic doses in pregnant Chinese mothers: A multi-center, randomized, prospective study. Pharmacogenet Genomics. 34 (1), 8-15 (2024).
  14. Chen, Y., et al. Effect of Oprm1/comt gene polymorphisms on sufentanil labor analgesia: A cohort study based on propensity score matching. Pharmacogenomics. 24 (12), 675-684 (2023).
  15. Cheng, H., et al. Establishment of predicting equation for individual sufentanil dosage postoperatively based on gene polymorphisms. Pain Pract. 22 (1), 39-46 (2022).
  16. Li, J., et al. The impact of UGT2B7 C802 T and cyp3a4*1 G polymorphisms on pain relief in cancer patients receiving OxyContin. Support Care Cancer. 26 (8), 2763-2767 (2018).
  17. Liu, S., et al. Effect of CYP3A4 (*)1g and CYP3A5 (*)3 polymorphisms on pharmacokinetics and pharmacodynamics of ticagrelor in healthy Chinese subjects. Front Pharmacol. 8, 176(2017).
  18. Zhang, H., Chen, M., Wang, X., Yu, S. Patients with CYP3A4*1 G genetic polymorphism consumed significantly lower amount of sufentanil in general anesthesia during lung resection. Medicine (Baltimore). 96 (4), e6013(2017).
  19. Zhang, W., et al. CYP3A4* 1g genetic polymorphism influences CYP3A activity and response to fentanyl in Chinese gynecologic patients. Eur J Clin Pharmacol. 66, 61-66 (2010).
  20. Sridharan, K., Jassim, A., Qader, A. M., Pasha, S. A. A. Unraveling the role of COMT polymorphism in dopamine-mediated vasopressor effects: An observational cross-sectional study. Curr Drug Metab. 25 (2), 152-156 (2024).
  21. Wang, Y., et al. Different doses of ropivacaine either with sufentanil or with dexmedetomidine for labor epidural anesthesia regarding painless childbirth: A retrospective, multi-center study. Pharmacology. 107 (7-8), 386-397 (2022).
  22. He, S., Renne, A., Argandykov, D., Convissar, D., Lee, J. Comparison of an emoji-based visual analog scale with a numeric rating scale for pain assessment. Jama. 328 (2), 208-209 (2022).
  23. Shen, K., et al. Polymorphism rs1057147 located in mesothelin gene predicts lymph node metastasis in patients with gastric cancer. Appl Microbiol Biotechnol. 107 (11), 3637-3651 (2023).
  24. Zhao, Z., Lv, B., Zhao, X., Zhang, Y. Effects of OPRM1 and ABCB1 gene polymorphisms on the analgesic effect and dose of sufentanil after thoracoscopic-assisted radical resection of lung cancer. Biosci Rep. 39 (1), BSR20181211(2019).
  25. Li, Z. X., et al. The effect of genetic variation on the sensitivity to opioid analgesics in patients with postoperative pain: An updated meta-analysis. Pain Physician. 26 (5), E467-E485 (2023).
  26. Zhang, J., et al. Association between MDR (1)/CYP3A4/oprm(1) gene polymorphisms and the post-caesarean fentanyl analgesic effect on Chinese. Gene. 661, 78-84 (2018).
  27. Liao, Q., et al. Effect of cyp3a4*18b polymorphisms and interactions with OPRM1 A118 G on postoperative fentanyl requirements in patients undergoing radical gastrectomy. Mol Med Rep. 7 (3), 901-908 (2013).
  28. Rutherford, D. V., et al. Effects of CYP3A4 and CYP2C9 genotype on systemic anastrozole and fulvestrant concentrations in swog s0226. Pharmacogenomics. 24 (12), 665-673 (2023).
  29. Taqi, M. M., Faisal, M., Zaman, H. Oprm1 a118g polymorphisms and its role in opioid addiction: Implications on severity and treatment approaches. Pharmgenomics Pers Med. 12, 361-368 (2019).
  30. Elgendy, H. M., et al. Genetic factors associated with morphine consumption in women undergoing laparoscopic cholecystectomy: A prospective cohort study. J Pain Res. 16, 2407-2417 (2023).
  31. Chou, W. Y., Hsu, C. J. A118g polymorphism of the oprm1 gene caused different morphine consumption in female patients after total knee replacement. J Orthop Sci. 26 (4), 629-635 (2021).
  32. Takemura, M., et al. Comparison of the effects of Oprm1 A118 G polymorphism using different opioids: A prospective study. J Pain Symptom Manage. 67 (1), 39-49.e35 (2024).
  33. Karataş, E., Kahraman, ÇY., Akbıyık, N. Association between polymorphisms in catechol-o-methyl transferase, opioid receptor mu 1, and serotonin receptor genes with postoperative pain following root canal treatment. Int Endod J. 54 (7), 1016-1025 (2021).
  34. Sadhasivam, S., et al. Genetics of pain perception, COMT, and postoperative pain management in children. Pharmacogenomics. 15 (3), 277-284 (2014).
  35. Yang, M., et al. Comt val158met affects the analgesic response to acupuncture among cancer survivors with chronic pain. J Pain. 24 (9), 1721-1730 (2023).
  36. Jayasundara, D., Jayawardane, I. A., Weliange, S. D. S., Jayasingha, T., Madugalle, T. Impact of continuous labor companion- who is the best: A systematic review and meta-analysis of randomized controlled trials. PLoS One. 19 (7), e0298852(2024).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Sufentanil AnalgesiaCYP3A4 PolymorphismPain ControlHemodynamic RegulationPostpartum ComplicationsMaternal Outcomes
Video Coming Soon