Induceret differentiering af M celle-lignende celler i humane stamcelle-afledte ileal Enteroid Monolayers

Immunology and Infection
 

Summary

Denne protokol beskriver, hvordan man inducerer differentieringen af M-celler i humane stamcelle-afledte ileal monolag og metoder til at vurdere deres udvikling.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Fasciano, A. C., Blutt, S. E., Estes, M. K., Mecsas, J. Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers. J. Vis. Exp. (149), e59894, doi:10.3791/59894 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

M (mikrofold) celler i tarmen funktion til at transportere antigen fra den apikale lumen til den underliggende peyers patches og lamina propria hvor immunceller bor og derfor bidrage til slimhinde immunitet i tarmen. En komplet forståelse af, hvordan M celler differentiere i tarmen samt de molekylære mekanismer antigen optagelse af M celler mangler. Dette skyldes, at M-celler er en sjælden population af celler i tarmen, og fordi in vitro-modeller til M-celler ikke er robuste. Opdagelsen af en selvfornyende stamcelle kultur system af tarmen, kaldet enteroider, har givet nye muligheder for dyrkning M celler. Enteroider er fordelagtige over standard dyrkede cellelinjer, fordi de kan differentieres i flere store celletyper, der findes i tarmen, herunder Flammernes Pokal celler, Paneth celler, enteroendokrine celler og enterocytter. Cytokin rankl er afgørende i M celle udvikling, og tilsætning af rankl og TNF-α til kultur medier fremmer en delmængde af celler fra ileal enteroider til at differentiere i M-celler. Følgende protokol beskriver en metode til differentiering af M celler i en transwell epitelial polariseret enkeltlags system af tarmen ved hjælp af humane ileal enteroider. Denne metode kan anvendes til studiet af M celle udvikling og funktion.

Introduction

M (mikrofold) celler er specialiserede intestinale epitelceller findes primært i follikel forbundet epitel (FAE) af tarmen overliggende små lymfoide regioner betegnes Peyer s patches1. M celler har korte uregelmæssige apikale mikrovilli og er dybt invaderet på deres basolaterale side, som tillader immunceller til at opholde sig tæt på deres celle krop2. Denne unikke morfologi gør det muligt for M-celler at prøve antigen fra tarmens apiske lumen og levere det direkte til de underliggende immunceller2. På denne måde, M-celler er vigtige for immun overvågning i tarmen, men kan også udnyttes af patogener for indrejse i lamina propria1,2,3,4,5, 6,7.

Studiet af M-celler er blevet hæmmet af flere faktorer. Først, M celler findes på en lav frekvens i mus og human tarm8. I dyrkede celler systemer, M celle-lignende celler er blevet induceret til at skelne ved co-culturing en polariseret adenokarcinom cellelinje, CaCO-2, med enten b-lymfocytter fra mus Peyer patches eller B celle lymfomer cellelinje, Raji b9,10 . Dette resulterer i en delmængde af CaCO-2 celler, der udtrykker M celle markører sialyl Lewis et antigen og UEA-1 i det polariserede epitel9,10. (Disse markører er også udtrykt på Flammernes Pokal celler i tarm væv, så i dag er mindre hyppigt anvendes som definitive M celle markører11,12.) Dette CaCO-2-M cellesystem er blevet brugt til at studere partikel optagelse og bakterier omplacering13,14. CaCO-2 celler er dog en etableret cellelinje fra en stor intestinal adenokarcinom med den forstyrrende faktor, at forskellige kilder til CaCO-2-celler viser forskellige fænotyper blandt Labs15. Yderligere, de kan ikke fuldt ud rekapitulere transkriptionen niveauer af True M-celler, da de mangler udtryk for i øjeblikket kendte M celle markører GP2 og SpiB16. Derfor er der behov for yderligere og mere fysiologisk relevante kultur modeller for at kunne studere M celle udvikling og funktioner.

Inden for de sidste ti år, feltet af enteroid-afledte modelsystemer af tarmen har hurtigt fremskridt fra den første opdagelse, at tarm stamceller afledt af menneskelig tarm biopsi kunne selv udbrede og selv forny i kulturen 17 , 18. vigtigere, fjernelse af stamcelle fremme faktorer fra vækstmedier tillader disse stamceller kulturer at skelne i de mange celletyper findes i tarmen18. Endvidere, nylige arbejde tyder på betydningen af rankl-Rank signalering i M celle udvikling i tarmen19,20. RANG receptoren er medlem af TNF-familien af receptorer, der udtrykkes på epiteliale prækursorceller i tarmen19 , mens rankl (rang receptoren ligand) frigives af stromale celler i peyers patches20. Da epiteliale celletyper til stede i ileal enteroider ikke producerer rankl, M Celledifferentiering i ileal enteroid kulturer kan induceres ved tilsætning af rankl til kulturmediet21,22. Inklusion af TNFα i kultur medierne hjælper med at støtte M celle udvikling i ileal enteroider23. Her beskriver vi metoderne til inducerende differentiering af M-celler i tarm monolag afledt af humane ileal enteroider. Vores metoder er delvist baseret på modifikationer fra følgende protokoller21,22,23.

Protocol

Alle metoder, der er beskrevet her, er godkendt af Tufts University IBC og IRB.

1. inducerende M Celledifferentiering i humane ileal Enteroid-afledte Monolayers

Bemærk: Denne protokol anvender ileal enteroider afledt af humant vævs biopsi. Se publicerede protokoller for metoder til, hvordan du dyrker og passage disse celler18,24. Følgende metoder til udvikling af monolag blev tilpasset fra Zou et al.24. Metoder til inducerende M-celler i ileal enteroid-afledte kulturer blev tilpasset fra tidligere rapporter21,22,23. Alt arbejde udføres i en steril vævskultur hætte, og inkubationer er i Hood eller vævskultur kuvøse som angivet. Se tabel over materialer, der er nødvendige for at forberede ileal enteroid monolag og forskellige Medias.

  1. Vokse ileal enteroider for 4-10 dage i ekstracellulære matrix (ECM) (Se tabel over materialer) (figur 1), afhængigt af deres iboende vækstrater, før såning på transwells.
  2. Belægning transwell membraner
    1. Placer det ønskede antal transboringer i en 24-brønd plade, der skaber et tokammersystem.
    2. I kold steril fosfat-bufferet saltvand (PBS) fortyndes ECM 25 gange og tilsættes 100 μL kold fortyndet opløsning i hvert øvre kammer på membranen.
      Bemærk: ECM og fortyndet ECM-opløsning skal opbevares på is indtil umiddelbart før tilsætning.
    3. Dæk 24-brønd pladen med låg, og Anbring pladen i en vævskultur-inkubator ved 37 °C i 2 timer for at tillade ECM-størkning på membranen.
    4. Efter 2 timer fjernes pladen fra inkubator og placeres i en vævskultur hætte. Ved hjælp af sterile pincet, inverter hver transwell til forsigtigt at fjerne resterende opløsning. Lad membranerne lufttørre i hætte med låget åbent, mens cellerne opsamles (trin 1.3.1-1.3.11).
  3. Dissocierer de ileal enteroider i enkeltceller
    1. Fjern pladen af ileal enteroider fra inkubatoren og fjern forsigtigt kulturmediet fra hver brønd ved vakuum aspiration eller med en pipette.
      Bemærk: En brønd af ileal enteroider, der indeholder ca. 100 raske cyster er tilstrækkelig til frø 1.5-2 brønde.
    2. Tilsæt 500 μL iskold 0,5 mM ethylenediaminetetraeddikesyre (EDTA) til hver brønd indeholdende ileal enteroider suspenderet i ECM at bryde op ECM. Pipetten op og ned kraftigt med en P1000 pipette sat til 500 μl for at nedbryde ECM og derved frigive ileal enteroider i opløsningen. For at forbedre opløsningen af ECM efter pipettering rystes pladen kraftigt ved 4 °C i 30 minutter.
    3. Opløsningen opsamles fra hver brønd i 15 mL koniske rør.
      Bemærk: Saml op til 10 brønde pr. 15 mL konisk slange for optimal enkelt celle samling.
    4. Pellet cellerne i en centrifuge ved 140 x g og 4 °c i 5 min. pellet skal være synlig, men kan let aflægges, så langsomt fjerne supernatanten ved vakuum aspiration eller med en pipette.
      Bemærk: Hvis du er bekymret for tab af pellet og celler, skal du bruge en pipette og gemme supernatanten i et separat rør.
    5. For at fordøje tætte samle forbindelser og nedbryde de ileal enteroider i enkeltceller, resuspendere pellet i 500 μL rumtemperatur trypsin pr. hver 5 brønde indsamlet i trin 1.3.3. Ved hjælp af en P1000, pipette op og ned for at adskille klumper og inkuberes rørene i et 37 °C vandbad i 5 min eller mindre.
      Bemærk: Optimering er nødvendig for at bestemme den passende mængde tid, der kræves for at inkuberes rørene, således at cellerne er brudt op, men ikke over-trypsinized til det punkt, at de dør. Brug Trypan Blue i trin 1.3.9 for at sikre, at cellerne er levedygtige efter behandling med trypsin.
    6. Tilsæt 1 mL fremskreden DMEM/F12 med 10% føtal bovint serum (FBS) pr. 500 μL trypsin for at inaktivere trypsin.
    7. Pipetten op og ned med et P1000-sæt på 500 μL mindst 50 gange mod siden af det koniske rør for yderligere at opsamle de resterende klumper i enkeltceller.
    8. Placer en 40 μm cellefilter over en 50 mL konisk og tilsæt 1 mL fremskreden DMEM/F12 med 10% FBS til våd celle sien. Den enkelte cellesuspension afpipetteres fra 15 mL konisk på sien. Skyl sien med 1 mL avanceret DMEM/F12 med 10% FBS.
    9. Overfør cellerne, der gik gennem celle sien fra 50 mL konisk til et nyt 15 mL konisk rør. Under Centrifugerings trinnet 1.3.10 vil celle pellet lettere kunne ses i et 15 mL konisk rør. Tæl cellerne ved hjælp af et hemocytometer. Brug Trypan Blue til at kontrollere, at cellerne stadig er i live. Typisk observeres > 95% levedygtighed.
    10. Mens cellerne tælles, centrifugeres cellerne i det nye 15 mL rør ved 400 x g og stuetemperatur i 5 min. celle pellet skal være synlig. Fjern forsigtigt supernatanten med en pipette, og Gem derefter supernatanten igen i tilfælde af, at pellet bliver afstillet.
    11. Forbered modificeret komplet vækst Media25 (mcmgf + Media) suppleret med 10 μM Y-27632. Resuspension foderpiller celler ved 2,5 x 105 celler/200 μl i mcmgf +. Se bemærkninger i diskussionen om optimering af celle såning nummer.
      Bemærk: MCMGF + medier er avanceret DMEM/F12 med 75% L-Wnt3a konditionerede medier, 10% R-spondin konditionerede medier, 5% Noggin konditionerede medier, 1x B27 supplement, 1x N2 supplement, 1 mM N-acetylcystein, 50 ng/mL mus rekombinant EGF, 500 nM A-8301, 10 nM [Leu15] 10 mM HEPES, 2 mM GlutaMAX og 1x penicillin/streptomycin (valgfrit).
    12. Sørg for, at de ECM-belagte membraner, der er fremstillet i trin 1,2, er fuldt tørrede, vurderet af øjet. Vask det øvre kammer med 200 μL MCMGF +. Tilsæt 200 μL celle opløsning i hvert øvre kammer.
    13. Tilsæt 700 μL MCMGF + med 10 μM Y-27632 til hvert nedre kammer. Pladen placeres i en 37 °C-vævskultur inkubator med 5% CO2.
    14. Efter 1 dag med vækst skal du fjerne mediet fra det øverste kammer og udskifte med 200 μL frisk MCMGF + for at forhindre vækst af flere cellelag.
  4. Udskiftning af medium
    1. Når monolag er ~ 80% confluent, normalt mellem dage 1-3 efter såning, erstatte basolaterale medier med differentiering medier (DM) for kontrol brønde (Se trin 1.4.2 for flere detaljer) eller med m celle medier for m celle induktion brønde (Se trin 1.4.3 for flere detaljer). Udskift mediet i øverste kammer med DM under begge forhold.
      Bemærk: DM er avanceret DMEM/F12 med 5% Noggin konditionerede medier, 1x B27 supplement, 1x N2 supplement, 1 mM N-acetylcystein, 50 ng/mL mus rekombinant EGF, 500 nM A-8301, 10 nM [Leu15]-gastrin I, 10 mM HEPES buffer, 2 mM GlutaMAX og 1x penicillin/streptomycin (valgfri ). M celle mediet er DM suppleret med 200 ng/mL RANKL og 50 ng/mL TNFα.
    2. For kontrol brønde, der ikke må indeholde M-celler, tilsættes 200 μL DM til det øverste kammer og 700 μL DM til bund kammeret.
    3. For at fremkalde M-celler tilsættes 200 μL DM til det øverste kammer og 700 μL af M-celle mediet til bund kammeret.
    4. Udskift mediet hver 2. For kontrol brønde, Udskift DM i øvre og nedre kamre. For M-celle brønde erstattes DM i det øverste kammer og M-celle mediet i det nedre kammer.
      Bemærk: Ved dag 7 efter celle-såning, M celler er fuldt induceret i monolayers.

2. verificering af M-Celledifferentiering ved qRT-PCR

Bemærk: Udfør følgende arbejde på en steril RNAse-fri bænk plads. Se tabel over materialer for en liste over foretrukne materialer til QRT-PCR.

  1. Fjern mediet fra de øverste og nederste kamre og vask det øverste kammer 2x forsigtigt med 300 μL rumtemperatur PBS.
  2. Tilsæt 300 μL Trizol til hvert øvre kammer. Inkuber ved stuetemperatur i 5 minutter.
    Forsigtig: bær handsker og øjenværn, når du bruger Trizol for at undgå kontakt med huden som angivet i producentens anvisninger.
  3. I mellemtiden skal du mærke mikrocentrifuge rørene for hver brønd og tilføje 700 μL Trizol til hvert rør.
  4. Indsaml cellens homogenitet ved at pipettere op og ned 3x forsigtigt med en P1000 og overføre indholdet til et tilsvarende mikrocentrifuge glas. Vortex for 5 s at blande.
  5. Opbevar prøverne ved stuetemperatur i yderligere 3 minutter. Opbevar derefter ved-80 °C i op til en måned.
  6. Følg standard qRT-PCR-metoden for RNA-isolation, DNase-behandling, reverse transkription og qRT-PCR-reaktioner. Se primer-listen i tabel over materialer.

3. kontrol af M Celledifferentiering ved immunofluorescens

Bemærk: Opbevar altid det nedre kammer af pladen fyldt med PBS, så membranerne forbliver våde. Denne procedure udføres på bænken. Se tabel over materialer for en liste over foretrukne materialer til immunofluorescens.

  1. Fjern mediet fra det øverste kammer og vask 2x forsigtigt med 300 μL rumtemperatur PBS. Tilsæt 100 μL rumtemperatur 4% PFA i PBS til det øverste kammer. Dæk pladen med folie og lad stå i 25 min ved stuetemperatur. Fjern 4% PFA.
    Forsigtig: 4% PFA skal bortskaffes korrekt som farligt kemikalieaffald.
  2. Vask det øvre kammer 3x med 300 μL rumtemperatur PBS. På dette tidspunkt kan prøverne forblive ved 4 °C i op til en måned før farvning. Når farves, prøver bør visualiseres inden for en uge for bedste kvalitet billeder.
  3. Monolayerne inkubates med 100 μL 5% bovint serum albumin (BSA) opløst i PBS i 30 min i mørke ved stuetemperatur for at blokere monolayerne.
  4. Forbered den primære antistof opløsning i 1% BSA i PBS ved en fortynding på 1:100. Tilsæt 100 μL pr. brønd. Pletter i 1 time ved stuetemperatur i mørket. Fjern opløsningen.
    Bemærk: Må ikke permeabilize monolag før primær bejdsning for GP2 opstår, fordi optimal primær GP2 overflade farvning af M celler opnås uden permeabilisering.
  5. Vask det øvre kammer 3x gange med 300 μL rumtemperatur PBS.
  6. Forbered sekundær bejdsning af fluorescently Tagged ged anti-mus IgG på 1:200, phalloidin på 1:100 og DAPI i 1% BSA + 0,1% Triton i PBS. Tilsæt 100 μL pr. brønd. Pletter i 30 minutter ved stuetemperatur i mørket.
    Bemærk: Triton tilsættes til den sekundære plet opløsning for at permeabilize cellerne under dette trin for korrekt phalloidin bejdsning.
  7. Vask 3x med 300 μL PBS.
  8. Anbring en 5 μL dråbe montage opløsning (tabel over materialer) på et glas skred. Fjern brønden fra 24 brønd pladen og vend. Skær forsigtigt membranen fra brønden ved hjælp af en skalpel. Placer membranen med cellerne opad på dråbe monterings opløsningen på glas sliden. Tilsæt 10 μL monterings opløsning på toppen og midten af membranen, og Placer en dækseddel på toppen for at forsegle membranen mellem glas sliden og dæksedlen.
  9. Tør slides ved stuetemperatur i mørket i 24 h. farvede slides skal visualiseres på confokale mikroskop inden for 1 uge efter farvning.

Representative Results

Ileal enteroider dyrket i ECM analyseres visuelt og ved qRT-PCR for deres relative sundhedsstatus og differentiering stater som et middel til kvalitetskontrol for ileal enteroid kulturer og til brug i monolayers. Udifferentierede ileal enteroider dyrket i ECM synes klar og cystisk i morfologi, hvilket indikerer tilstedeværelsen af mange stamceller (figur 1a). Over tid, udifferentierede ileal enteroider dyrket i vækstmedier kan tage på en intermediær fænotype, hvor nogle vil blive vist cystisk og nogle synes uigennemsigtige (figur 1b). Ofte ligner vores udifferentierede prøver dem, der er vist i figur 1b , i stedet for figur 1a. Disse mellemliggende kulturer indeholder mere terminalt differentieret enterocytcellerne som målt ved ekspression af i markør, isomaltase sucrase (SI), og formentlig ekstruderede døde enterocytter i lumen bidrage til deres tætte udseende. Ileal enteroider kan anvendes i denne mellemliggende tilstand til udvikling af enkeltlags, men det skal erindres, at mængden af tarm stamceller, der findes i kulturerne, kan være lav, og nogle differentierede celletyper kan være til stede (f. eks. Se QRT-PCR niveauer i udifferentierede prøver, som dyrkes i ECM, og som ligner figur 1b i figur 2). Til sammenligning, ileal enteroider kulturperler med differentiering medier i ECM for 5 + dage vil fremstå ensartet formørket og luftrør og kulturer med denne morfologi er ikke gode kandidater til såning monolag (figur 1c).

Ekspression af stamcelle gener og gener fra intestinal Celledifferentiering kan analyseres ved QRT-PCR som et andet middel til at vurdere sundhedsstatussen for ileal enteroider dyrket i ECM og deres differentierings evne, når de er sået som monolag på transwells. Udtrykket af et stamcelle-gen, LGR5, et enterocyt-gen, si, et Flammernes Pokal-celle-gen, MUC2og et Paneth-celle-gen, lyz, sammenlignes mellem udifferentierede ileal-enteroid-kulturer dyrket i ECM og differentieret ileal i nærværelse af eller fravær af RANKL/TNFα (figur 2). Mens værdierne kan variere mellem eksperimenter, bør ekspression af LGR5 falde efter differentiering af monolag18,26. LGR5 -ekspression registreres normalt ikke i de differentierede ileal-monolag uden rankl og tnfα efter dag 7. Omvendt, ekspression af markører for differentiering af specifikke celletyper, såsom si og MUC2, stige efter differentiering18. Udtryk af Lyz falder generelt efter differentiering i vores kulturer. Hvis de ileal enteroid-kulturer, der anvendes til fremstilling af monolag, ser mere ud som figur 1b end figur 1a, kan stigninger i tarm differentierings markører være beskedne efter differentiering, fordi disse oprindelige kulturer er heterogene i tarm celletyper og har et højere basal niveau af si og MUC2. Differentieringen i monolag forekommer dog stadig som vurderet ved tab af LGR5 udtryk og mikroskopi (se nedenfor). Desuden reducerer tilsætning af RANKL og TNFα til differentierings mediet tabet af LGR5 -ekspression (figur 2). Parallelt hermed er ekspression af si og MUC2 lidt lavere end i den differentierede tilstand, der mangler Rankl og tnfα, selv om deres niveauer stiger over den udifferentierede tilstand.

M Celledifferentiering i monolag bestemmes både af QRT-PCR og immunofluorescens ved hjælp af to M celle specifikke markører, herunder celleoverfladen glykoprotein 2 (GP2) og transkriptionsfaktoren spib21. Udtryk af GP2 og spib er upregulated i de ileal enteroid-afledte monolag i nærværelse af rankl og tnfα og er ikke påvist i ikke-rankl og tnfα-behandlede prøver (figur 3). Ekspression af disse markører kan også normaliseres til et stykke lille tarm væv22, hvis det er muligt. Dette tillader fold ændring af disse m celle markører skal sammenlignes med væv, der har M celler i stedet for at kontrollere monolag, der ikke har nogen udtryk for disse markører og tillader standardisering mellem eksperimenter i et laboratorium. M celler detekteres også ved overflade ekspression af GP2 ved immunofluorescens (figur 4). Typisk observeres der i et konfluent-monolayer 1 til 5 M-celler i et givet mikroskop felt ved 40X forstørrelse efter dag 6 til 8 efter såning i prøver behandlet med RANKL og TNFα (figur 4a-D). Der ses intet GP2-udtryk i de ubehandlede prøver (figur 4E). Den ortogonale visning af XZ-flyet, der er overlagt med en phalloidin-sonde, viser actin-strukturer omkring hver celle og GP2-udtryk på den apikale overflade af M-celler (figur 4F-G). Denne model rekapitulerer den lave hyppighed af M celler fundet i den menneskelige tarm1,2,8. For at rense og isolere M-celler til yderligere undersøgelse kan M-celler farves ved hjælp af GP2-overflade ekspression og sorteres ved hjælp af FACS for GP2 +-celler.

M-cellerne binder til og transporterer antigen fra tarm lumen til immuncellerne, som er bosat under epitelet2. Secretory IgA produceret i tarmen binder sig til bakterier og kan binde til den apikale overflade af M-celler for at lette transporten af mikrober27,28. For at afgøre, om M celler udviklet i denne model er i stand til at binde til IgA, Human serum IgA tilsættes til det øvre kammer, lov til at binde for 1 h, og derefter monolag er forberedt til immunofluorescens analyse. Tilstedeværelsen af IgA på M-celler visualiseres ved hjælp af et fluor-konjugeret sekundært antistof, der genkender den tunge kæde af humant serum IgA. M-celler behandlet med IgA i 1 time har IgA bundet til den apiske overflade (figur 5a), hvorimod m-celler i kontrol brønde, der kun blev behandlet med det sekundære antistof til IgA, ikke har noget detekterbart signal (figur 5b). Yderligere, IgA specifikt binder sig til den apikale overflade af M-celler og er ikke fundet bundet til nogen celler mangler GP2 overflade plet. Derudover har M-celler karakteristisk kortere tæt actin på deres apikale overflade2. At analysere M celle morfologi i denne model, ileal enteroid-afledte monolag dyrkes i 7 dage og høstes til immunofluorescens analyse af F-actin ved hjælp af phalloidin. Målinger af actin pixel intensitet beregnes for M-celler og for ikke-M-celler, der støder direkte op til hver M-celle ved hjælp af ImageJ software (figur 6a). Actin-intensiteten reduceres på GP2 + M-celler i denne model, og et repræsentativt billede vises i figur 6b. Samlet set, m celler udviklet i denne ileal enteroid-afledte enkeltlags model har karakteristisk genekspression, morfologi og nogle M celle funktioner af humane tarm M celler, såsom binding til IgA.

Figure 1
Figur 1: repræsentativ morfologi af humane ileal enteroider i ECM en-ugers efter opdeling. A) klare og cystiske udifferentierede ileal enteroider. B) intermediær fænotype med nogle cystiske ileal enteroider og nogle uigennemsigtige lobulære ileal enteroider. C) formørkede og lobulære differentierede ileal enteroider. Billeder taget gennem linsen af et optisk lys mikroskop ved 4X forstørrelse ved hjælp af et iPhone7 kamera. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: relativ ekspression af stamcelle-og differentierings markører for humane ileal-enteroider dyrket i ECM eller differentieret som monolayers. Ileal enteroider blev dyrket i 7 dage i ECM (udifferentieret) eller dyrket og differentieret som monolag uden (differentieret) eller med rankl og tnfα (differentieret + R/T). Ileal enteroid-kulturer eller monolag blev høstet i Trizol til RNA-ekstraktion. Genekspression blev bestemt af qRT-PCR og udtrykkes i forhold til Gapdh. Data er gennemsnit af 3 uafhængige brønde af ileal enteroider eller monolag per tilstand. Fejllinjer angiver, at SEM. ND ikke er registreret. Statistisk signifikans blev fastlagt på Log-transformerede værdier ved hjælp af en-vejs ANOVA med Dunnetts multiple sammenligninger test sammenlignet med den udifferentierede. * * p < 0,01, * * * p < 0,001 venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: relativ ekspression af M celle specifikke markører GP2 og spib fra humane ileal enteroid-afledte monolayers. Rankl/tnfα-behandlede og ikke-behandlede humane ileal enteroid-afledte monolag blev høstet i Trizol til RNA-ekstraktion efter 7 dages eftersåning. Genekspression blev bestemt af qRT-PCR og udtrykkes i forhold til Gapdh. Data er gennemsnit af 6 uafhængige monolag per tilstand. Fejllinjer angiver, at SEM. ND ikke er registreret. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: immunofluorescens af overflade GP2 udtryk på M celler i humane ileal enteroid-afledte monolag over tid. Rankl/tnfα behandlede og ikke-behandlede humane ileal enteroid-afledte monolag blev fikseret i 4% PFA og plettet til immunofluorescens på forskellige angivne dage efter såning. Billeder blev analyseret ved hjælp af ImageJ software. DAPI = blå; Glykoprotein 2 (GP2) = rød. (A-D) Rankl/tnfα behandlede monolag på forskellige dage efter såning. E) ikke-behandlet enkeltlags høstet på dag 7 efter såning. (F-G) Ortogononal XZ plane af monolag på dag 7 efter såning overlagt med phalloidin sonde for F-actin. Phalloidin = cyan. Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5: IgA binder sig specifikt til den apikale overflade af M-celler. Rankl/tnfα-behandlede humant ileal enteroid-afledte monolag blev dyrket i 7 dage og derefter (A) behandlet med 10 μg humant serum IgA i 1 time eller (B) mock-behandlet med PBS kun (ingen IgA kontrol). Efter 1 time blev monolag vasket 2x i PBS, blev fikseret i 4% PFA, permeabilized med 0,1% tritonx-100 og farves for immunofluorescens. Billeder blev analyseret ved hjælp af ImageJ software og er repræsentative for 3 uafhængige eksperimenter. DAPI = blå; Glykoprotein 2 (GP2) = rød; Antistof til humant serum IgA = grøn; Phalloidin = cyan. Sorte pile betegner IgA bundet til apikale overflade af M-celle. Venligst klik her for at se en større version af dette tal.

Figure 6
Figur 6: M-celler har reduceret actin-intensiteten sammenlignet med tilstødende ikke-M-celler. Rankl/tnfα-behandlede humane ileal enteroid-afledte monolag blev dyrket i 7 dage og derefter fikseret i 4% PFA og blev plettet til immunofluorescens. (A) ved hjælp af IMAGEJ blev GP2 + M-celler skitseret ved hjælp af frihånds markeringsværktøjet, og målinger af areal og integreret tæthed blev taget i Phalloidin-kanalen. Den samme analyse blev derefter afsluttet for hver tilstødende ikke-M celle, der naboer M-cellen. Den rå integrerede tæthed blev divideret med arealet af hver enkelt celle til normalisering. Den gennemsnitlige integrerede tæthed/område blev beregnet for hver tilstødende ikke-M-celler for hver M-celle. Billeder blev analyseret fra 3 uafhængige eksperimenter; hver prik er en M-celle eller gennemsnit af tilstødende celler. Fejllinjer indikerer SD. Statistisk signifikans blev fastlagt på Log-transformerede værdier ved hjælp af en parret t-test. p = 0,0001 (B) repræsentativt billede af XZ plane fra plot in A. billeder blev analyseret ved hjælp af ImageJ software. DAPI = blå; Glykoprotein 2 (GP2) = rød; Phalloidin = cyan. Venligst klik her for at se en større version af dette tal.

Discussion

For at udvikle monolag, der skelner korrekt i de vigtigste tarm celletyper og M-celler, er det afgørende at være opmærksom på flere faktorer. Ileal enteroider skal høstes fra ECM-kulturer, der er udifferentierede og har en høj andel af Lgr5 + stamceller. Visuelt, de fleste af de ileal enteroider i ECM kulturer bør ikke formørkes og multilobular, og LGR5 udtryk bør påvises i disse kulturer ved QRT-PCR analyse. Kvalitetskontrol af konditionerede medier er afgørende for udbredelsen af udifferentierede kulturer over tid og skal udfyldes for hver batch af konditionerede medier, der produceres. Kvalitetskontrol kan gennemføres ved at teste et nyt parti af medier på nogle ECM kulturer og sammenligne morfologi af ileal enteroider til en tidligere batch af medier i løbet af en uge. LGR5 udtryk bør forblive relativt ens i de ileal enteroid kulturer dyrket i det nye parti af medier i forhold til den foregående batch.

Under forberedelsen af de ileal enteroider til såning som monolayers, er det vigtigt kraftigt at pipettere celle opløsningen efter inkubation med trypsin for at nedbryde de ileal enteroider i enkeltceller. Celle klumper kan føre til Multi-Layer dannelse, når seedet for monolayers. Desuden er det vigtigt at empirisk bestemme antallet af celler, der kræves for at danne en enkeltlags for hver enkelt ileal enteroid linje, der opnås. Typisk, denne værdi kan variere fra 2,5 x 105 – 5,0 x 105 celler/godt, men afhænger af graden af cystisk til ikke-cystisk ileal enteroider i kulturer og varierer for hver enkelt ileal enteroid linje. Fra erfaring, ileal enteroider dyrket i ECM, der synes mindre cystisk kræver højere celle såning tæthed for at opnå monolayers. Det er tilrådeligt at vaske det øvre kammer efter 1 dag med vækst ved forsigtigt at pipettere medierne op og ned 2-3 gange og erstatte med friske vækstmedier. Denne proces forrykke celler, der er landet på toppen af andre celler reducere sandsynligheden for flerlags dannelse. Skifte medierne i det øvre kammer fra vækstmedier til M celle medier, når monolag er ~ 80% confluent, som normalt sker på dag 2 efter såning, hjælper med at opnå god M Celledifferentiering. Tilsætning af rankl/tnfα til det øvre kammer under M celle induktion fører ikke til udvikling af et større antal M-celler pr. enkeltlags og kan derfor lades ude af det øvre kammer medie. Transwells af varierende porestørrelser kan anvendes i denne protokol uden at påvirke M celle udvikling; dog, celle såning tæthed skal optimeres for dem med større porestørrelser. Kollagen IV kan erstattes af ECM som en kælder membran protein belægning for transwells eller brønd plader, som kan være bedre egnet til visse anvendelser.

Ileal enteroid-afledte monolag på transwells giver et to-kammer system, der giver mulighed for oprettelse af definerede apikale og basolaterale overflader, således at 4-5 forskellige typer af epitel tarmceller kan polarisere til at udtrykke overflade markører på hver side i forhold til den, der findes i tarmen. Yderligere faktorer kan tilføjes til begge sider, såsom partikler, infektiøse agenser eller andre celletyper. Men til dato nogle begrænsninger stadig. Som beskrevet, dette system er et statisk system, der mangler fysiologiske flow, intestinal sammentrækninger, og tarmindhold. Desuden er villus-Crypt-arkitekturen tabt ved dannelsen af en flad monolayer. Disse systemer mangler Peyer patch regioner, immunceller, og stromale celler. Hvorvidt manglen på immun og stromale celler bosiddende tæt under M celler påvirker de invaginationer, der ikke er observeret i dette system og andre fysiologiske funktion er et vigtigt fremtidigt område af undersøgelsen. Denne protokol kan tilpasses til en 96-brønd plade eller en multi-brønd plade format. Proceduren for belægning af 96-brønd pladen med ECM og såning med enkeltceller fra ileal enteroider forbliver den samme som for transwells. Titrering af celle såning tæthed kræves for at opnå monolag skal ske, men typisk spænder fra 1,0 x 105 – 3,0 x 105 celler/godt i en 96-brønd plade format. M celler er induceret ved at erstatte vækstmedier med M celle medier, når monolag er 80% flydende typisk af dage 1-3 afhængigt af den indledende celle såning tæthed.

Denne metode til at differentiere M celler fra ileal enteroider in vitro giver betydelige forbedringer i forhold til CaCO-2 metode. De ileal enteroider er primære celler og mindst 4-5 epiteliale celler typer er til stede i systemet. Desuden, ileal enteroid linjer afledt af forskellige mennesker kan undersøges for at undersøge, hvordan genetik eller sygdomstilstand indflydelse M celle udvikling og adfærd. Yderligere manipulation af de ileal enteroider under M Celledifferentiering vil give en bedre forståelse af M celle udvikling, herunder karakterisering af M celle prækursorer celler. Endelig, da de molekylære mekanismer af M celle fagocytose og transcytose er stadig ikke helt forstået3,29, denne model giver mulighed for at studere og visualisere antigen og partikel optagelse af M-celler.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Dette arbejde blev støttet af NIAID U19AI131126 til Dr. Isberg (Tufts University School of Medicine) og Dr. Kaplan (Tufts University); (JM er projekt 2 leder) og NIAID R21AI128093 til JM. ACF blev delvis støttet af NIAID T32AI007077. SEB og MKE blev støttet af NIAID U19AI116497-05. Vi takker medlemmerne af Mecsas Lab, ng Lab, og Dr. Isberg på Tufts University School of Medicine for nyttige diskussioner. Konfokale Imaging blev udført på Tufts Center for Neuroscience Research, P30 NS047243.

Materials

Name Company Catalog Number Comments
[Leu15]-Gastrin I Sigma-Aldrich G9145 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 10 µM
Final Concentration: 10 nM
0.5 M EDTA Invitrogen 15575020 For breaking up ECM
Solvent: PBS
Stock Concentration: 0.5 M
Final Concentration: 0.5 mM
40 µm cell strainer Corning 352340 For excluding clumps from single cells
Solvent:
Stock Concentration:
Final Concentration:
A-8301 Sigma-Aldrich SML0788-5MG MCMGF+ and DM ingredient
Solvent: DMSO
Stock Concentration: 500 µM
Final Concentration: 500 nM
Advanced DMEM/F12 Invitrogen 12634-028 MCMGF+ and DM Basal medium
Solvent:
Stock Concentration:
Final Concentration:
Alexa Fluor 594 goat anti-mouse IgG Thermo Fisher A-11005 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Alexa Fluor 647 Phalloidin Invitrogen A22287 Optional secondary stain for F-actin
Solvent:
Stock Concentration:
Final Concentration: 1:100
B27 Supplement Invitrogen 17504-044 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 50x
Final Concentration: 1x
Bovine Serum Albumin Chem-Impex 00535 5% for blocking solution
Solvent: PBS
Stock Concentration:
Final Concentration: 0.01
Chloroform Fisher Scientific C298-500 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Circle coverslips Thomas Scientific 1157B50 For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
DAPI (4′,6-diamidino-2-phenylindole) Thermo Fisher 62247 For secondary stain
Solvent: PBS
Stock Concentration: 100x
Final Concentration: 1x
DEPC Treated RNAse free H2O Fisher Scientific BP561-1 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
DNA Removal Kit Invitrogen AM1906 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Ethyl Alcohol, 200 proof Sigma Aldrich EX0276-4 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Feather Scalpels VWR 100499-580 For cutting membrane from transwells
Solvent:
Stock Concentration:
Final Concentration:
Fetal Bovine Serum (FBS) Gibco 26140079 For inactivating trypsin
Solvent: Advanced DMEM/F12
Stock Concentration: 1
Final Concentration: 0.1
Glass slides Mercedes Scientific MER 7200/90/WH For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
GlutaMAX Invitrogen 35050-061 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 200 mM
Final Concentration: 2 mM
GP2 Antibody MBL International D277-3 Surface stain for M cells
Solvent:
Stock Concentration:
Final Concentration: 1:100
HEPES Invitrogen 15630-080 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 1 M
Final Concentration: 10 mM
Human Serum IgA Lee BioSolutions 340-12-1 For functional analysis of M cells
Solvent: PBS
Stock Concentration: 1 mg/mL
Final Concentration: 10 µg
L-Wnt3a conditioned media Cell line from ATCC CRL-2647 Refer to ATCC Product Sheet for L Wnt­3A (ATCC CRL2647) for conditioned media protocol; MCMGF+ ingredient
Solvent:
Stock Concentration:
Final Concentration: 75% in MCMGF+
0% in DM
Matrigel, GFR, phenol free Corning 356231 Extracellular Matrix (ECM)
Solvent:
Stock Concentration:
Final Concentration:
Mouse recombinant EGF Invitrogen PMG8043 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 50 µg/mL
Final Concentration: 50 ng/mL
N2 Supplement Invitrogen 17502-048 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
N-acetylcysteine Sigma-Aldrich A9165-5G MCMGF+ and DM ingredient
Solvent: H2O
Stock Concentration: 500 mM
Final Concentration: 1 mM
Noggin conditioned media Cell line gift from Dr. Gijs van den Brink (University of Amsterdam) Ref 30 for conditioned media protocol; MCMGF+ and DM Ingredient
Solvent:
Stock Concentration:
Final Concentration: 5% in MCMGF+
5% in DM
Paraformaldehyde (PFA) MP Biomedicals 2199983 For fixing monolayers
Solvent: PBS
Stock Concentration: 0.16
Final Concentration: 0.04
PBS, -Mg, -Ca Corning MT21040CV Solvent for 0.5 mM EDTA
Solvent:
Stock Concentration:
Final Concentration:
Penicillin/Streptomycin Invitrogen 15140-122 Optional ingredient of MCMGF+ and DM
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
Prolong Gold Invitrogen P36930 Antifade mounting solution
Solvent:
Stock Concentration:
Final Concentration:
Qiagen RNeasy Kit Qiagen 74106 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Recombinant human RANKL Peprotech 310-01 Used to induce M cells
Solvent: H2O
Stock Concentration: 0.1 mg/mL
Final Concentration: 200 ng/mL
Recombinant murine TNFa Peprotech 315-01A Used to induce M cells
Solvent: H2O
Stock Concentration: 5 mg/mL
Final Concentration: 50 ng/mL
R-spondin conditioned media Cell line from Trevigen 3710-001-01 Refer to Trevigen Cultrex Rspo1 Cells product manual (HA-R-Spondin1 293T cell line) for conditioned media protocol; MCMGF+ Ingredient
Solvent:
Stock Concentration:
Final Concentration: 10% in MCMGF+
0% in DM
Secondary anti-human IgA antibody Jackson Immuno Research 109-545-011 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Super Script IV Reverse Transcriptase Thermo Fisher 18091200 For conversion of RNA to DNA
Solvent:
Stock Concentration:
Final Concentration:
Transwell inserts, 24 well-sized Greiner Bio-One 662641 0.4 µm pore size
Solvent:
Stock Concentration:
Final Concentration:
TritonX-100 Sigma-Aldrich T8787 Not required during GP2 primary stain
Solvent: 1% BSA
Stock Concentration:
Final Concentration: 0.001
TRIzol Invitrogen 15596018 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
TrypLE Express Invitrogen 12605010 Trypsin for breaking up enteroids into single cells
Solvent:
Stock Concentration:
Final Concentration:
Y-27632 Sigma-Aldrich Y-0503 MCMGF+ ingredient on day 0
Solvent: H2O
Stock Concentration: 5 mM
Final Concentration: 10 µM
GAPDH forward primer CATGAGAAGTATGACAACAGCCT
GAPDH reverse primer AGTCCTTCCACGATACCAAAGT
GP2 forward primer CAATGTGCCTACCCACTGGA
GP2 reverse primer ATGGCACCCACATACAGCAC
LYZ forward primer CGCTACTGGTGTAATGATGG
LYZ reverse primer TTTGCACAAGCTACAGCATC
MUC2 forward primer ATGCCCTTGCGTCCATAACA
MUC2 reverse primer AGGAGCAGTGTCCGTCAAAG
SI forward primer TCCAGCTACTACTCGTGTGAC
SI reverse primer CCCTCTGTTGGGAATTGTTCTG
SPIB forward primer CAGCAGCCGCTTTTAGCCAC
SPIB reverse primer GCATATGCCGGGGGAACC
LGR5 forward primer TCAGTCAGCTGCTCCCGAAT
LGR5 reverse primer CGTTTCCCGCAAGACGTAAC

DOWNLOAD MATERIALS LIST

References

  1. Kraehenbuhl, J. P., Neutra, M. R. Epithelial M cells: differentiation and function. Annual Review of Cell and Developmental Biology. 16, 301-332 (2000).
  2. Neutra, M. R., Frey, A., Kraehenbuhl, J. P. Epithelial M cells: gateways for mucosal infection and immunization. Cell. 86, (3), 345-348 (1996).
  3. Nakamura, Y., Kimura, S., Hase, K. M. cell-dependent antigen uptake on follicle-associated epithelium for mucosal immune surveillance. Inflammation and Regeneration. 38, 15 (2018).
  4. Clark, M. A., Hirst, B. H., Jepson, M. A. M-cell surface beta1 integrin expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse Peyer's patch M cells. Infection and Immunity. 66, (3), 1237-1243 (1998).
  5. Jensen, V. B., Harty, J. T., Jones, B. D. Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer's patches. Infection and Immunity. 66, (8), 3758-3766 (1998).
  6. Jones, B. D., Ghori, N., Falkow, S. Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches. Journal of Experimental Medicine. 180, (1), 15-23 (1994).
  7. Marra, A., Isberg, R. R. Invasin-dependent and invasin-independent pathways for translocation of Yersinia pseudotuberculosis across the Peyer's patch intestinal epithelium. Infection and Immunity. 65, (8), 3412-3421 (1997).
  8. Ohno, H. Intestinal M cells. Journal of Biochemistry. 159, (2), 151-160 (2016).
  9. Kerneis, S., Bogdanova, A., Kraehenbuhl, J. P., Pringault, E. Conversion by Peyer's patch lymphocytes of human enterocytes into M cells that transport bacteria. Science. 277, (5328), 949-952 (1997).
  10. Gullberg, E., et al. Expression of specific markers and particle transport in a new human intestinal M-cell model. Biochemical and Biophysical Research Communications. 279, (3), 808-813 (2000).
  11. Giannasca, P. J., Giannasca, K. T., Leichtner, A. M., Neutra, M. R. Human intestinal M cells display the sialyl Lewis A antigen. Infection and Immunity. 67, (2), 946-953 (1999).
  12. Jang, M. H., et al. Intestinal villous M cells: an antigen entry site in the mucosal epithelium. Proceedings of the National Academy of Sciences of the United States of America. 101, (16), 6110-6115 (2004).
  13. Beloqui, A., Brayden, D. J., Artursson, P., Preat, V., des Rieux, A. A human intestinal M-cell-like model for investigating particle, antigen and microorganism translocation. Nature Protocols. 12, (7), 1387-1399 (2017).
  14. Martinez-Argudo, I., Jepson, M. A. Salmonella translocates across an in vitro M cell model independently of SPI-1 and SPI-2. Microbiology. 154, (Pt 12), 3887-3894 (2008).
  15. Lee, J. B., et al. Quantitative analysis of lab-to-lab variability in Caco-2 permeability assays. European Journal of Pharmaceutics and Biopharmaceutics. 114, 38-42 (2017).
  16. Mabbott, N. A., Donaldson, D. S., Ohno, H., Williams, I. R., Mahajan, A. Microfold (M) cells: important immunosurveillance posts in the intestinal epithelium. Mucosal Immunology. 6, (4), 666-677 (2013).
  17. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, (7244), 262-265 (2009).
  18. Sato, T., et al. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium. Gastroenterology. 141, (5), 1762-1772 (2011).
  19. Knoop, K. A., et al. RANKL is necessary and sufficient to initiate development of antigen-sampling M cells in the intestinal epithelium. Journal of Immunology. 183, (9), 5738-5747 (2009).
  20. Taylor, R. T., et al. Lymphotoxin-independent expression of TNF-related activation-induced cytokine by stromal cells in cryptopatches, isolated lymphoid follicles, and Peyer's patches. Journal of Immunology. 178, (9), 5659-5667 (2007).
  21. de Lau, W., et al. Peyer's patch M cells derived from Lgr5(+) stem cells require SpiB and are induced by RankL in cultured "miniguts". Molecular and Cellular Biology. 32, (18), 3639-3647 (2012).
  22. Rouch, J. D., et al. Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids. PloS One. 11, (1), e0148216 (2016).
  23. Wood, M. B., Rios, D., Williams, I. R. TNF-alpha augments RANKL-dependent intestinal M cell differentiation in enteroid cultures. American Journal of Physiology: Cell Physiology. 311, (3), C498-C507 (2016).
  24. Zou, W. Y., et al. Human Intestinal Enteroids: New Models to Study Gastrointestinal Virus Infections. Methods in Molecular Biology. (2017).
  25. Kozuka, K., et al. Development and Characterization of a Human and Mouse Intestinal Epithelial Cell Monolayer Platform. Stem Cell Reports. 9, (6), 1976-1990 (2017).
  26. Barker, N., et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 449, (7165), 1003-1007 (2007).
  27. Mantis, N. J., et al. Selective adherence of IgA to murine Peyer's patch M cells: evidence for a novel IgA receptor. Journal of Immunology. 169, (4), 1844-1851 (2002).
  28. Rios, D., et al. Antigen sampling by intestinal M cells is the principal pathway initiating mucosal IgA production to commensal enteric bacteria. Mucosal Immunology. 9, (4), 907-916 (2016).
  29. Miller, H., Zhang, J., Kuolee, R., Patel, G. B., Chen, W. Intestinal M cells: the fallible sentinels? World Journal of Gastroenterology. 13, (10), 1477-1486 (2007).
  30. Heijmans, J., et al. ER stress causes rapid loss of intestinal epithelial stemness through activation of the unfolded protein response. Cell Reports. 3, (4), 1128-1139 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics