Duplex Digital PCR for Simultaneous Quantification of Dual Genetic Markers

Overview

In this video, we demonstrate the duplex digital PCR (ddPCR) technique — a modification of the traditional PCR technique that is useful in detecting two different genetic markers simultaneously. A single PCR reaction is partitioned into nanoliter-sized emulsified droplets that are independently amplified, and the detection of differently colored fluorescence amplification signals from the fraction of droplets is used to compute the initial concentration of the target sequences.

Protocol

1. Assay Mixture Preparation

1. Make 100 µmol/L stock concentrations for all primers in molecular grade water and probes in TE pH 8 buffer [Entero F1A, Entero R1, GPL813TQ; HF183-1, BthetR1, BthetP].
   NOTE: Probes for the two targets are fluorescently labeled with different fluorophores as indicated in the List of Materials/Equipment.
2. Prepare master mix by mixing, per reaction planned, 12 µl digital PCR mix (2x stock, see List of Materials/Equipment), 0.216 µl each forward and reverse primer, 0.06 µl each fluorescent probe, and 5.016 µl nuclease-free water (final concentration: 900 nM each primer, 250 nM each probe). Pipette up and down at least 10 times to mix while taking caution not to introduce air bubbles in the solution.
3. Pipette 18 µl master mix (from step 1.2) into a regular PCR tube or plate, mixing in 6 µl DNA template (extracted as described previously) to make an assay mixture for droplet generation. If running samples in duplicate, pipette 36 µl of master mix and 12 µl DNA template into each well. Leave the corresponding replicate wells empty on the plate. Include positive controls (see List of Materials/Equipment) and no template controls (NTC) (i.e. with molecular grade water used as the template).
   NOTE: Positive control is necessary to ensure the assay is running properly and the NTC is necessary to ensure there is no contamination within the plate and to set the fluorescent baseline later in data analysis. First-time users are recommended to use both undiluted and diluted DNA samples.

2. Droplet Generation and PCR Plate Setup

1. Mix the assay mixtures by pipetting up and down approximately 15 times using a multichannel pipette. Ensure that the pipette tip stays within the liquid to avoid making excess bubbles within the mixture.
2. Insert cartridge 1 (containing 8 wells) into a white cartridge holder and click the cartridge holder shut. Cartridge 1 is now firmly in place and cannot be dislodged from the holder while generating droplets. Using a multichannel pipet, gently transfer 20 µl of assay mixture into the middle position of the cartridge marked 'Sample' without introducing air bubbles.
3. Pipette in 70 µl of droplet generation oil to the left side of the cartridge (marked 'Oil').
4. Cover the cartridge with a gasket making sure the gasket is flat and held evenly by the 4 ticks toward the edge of the cartridge. Press the green-lit button on the droplet generator to open and place the cartridge. Press green-lit button again to close the generator.
   Note: Once the door closes, the button is dimmed, the door cannot be reopened and droplet generation begins immediately continuing for approximately 1 min.
5. If doing more than 8 reactions, place cartridge 2 in a second white cartridge holder and prepare in the same manner as cartridge 1 while the droplet generation is in progress to save total setup time.
6. Open the droplet generator door when the dim-lit button turns green indicating the completion of droplet generation. Remove the white cartridge holder containing cartridge 1, set it aside, and place cartridge 2 onto the droplet generator.
7. Remove the gasket from cartridge 1 and discard. Gently transfer the total volume (approximately 40 µl) of generated droplets from the third column of the cartridge (marked 'Droplets') onto a final PCR plate (maintained at room temperature) for thermal cycling.
   Note: Do not unclick the white cartridge holder as the action may break the newly generated droplets; only open the cartridge holder after the droplets have been transferred to the final plate.
8. Repeat steps 2.1-2.7 for additional samples.
9. When all the droplets are in the final PCR plate, place a pierceable foil cover on top of the plate and place it on a plate sealer. Set the sealer to 180 °C, press 'Play' on the sealer and let seal for 10 sec.

3. Thermal Cycling and Droplet Reading

1. Place the sealed plate on the thermal cycler, one compatible with the final PCR plate used in step 2.7, and a temperature ramping speed of 2.0 °C/sec.
2. Run thermal program as follows: 10 min at 95 °C, followed by 40 cycles of 30 sec at 94 °C and 60 sec at 60 °C, followed by a 10 min hold at 98 °C (optional: final hold at 4 or 15 °C).
3. Upon completion of cycling, transfer the plate to a Droplet Reader for automatic measurement of fluorescence in each droplet in each well. Alternatively, store the plate at 4 °C for up to 3 days before droplet reading. Ensure the droplets are at room temperature before proceeding with reading.
   1. Open the accompanying software to set up the droplet reading. In the default 'Setup' menu containing a schematic of an empty 96 well plate, double click on well A1 to open the menu containing three sections: 'Sample,' 'Assay 1' and 'Assay 2.'
   2. In the 'Sample' section type the sample ID into the box labeled 'Name' and press enter or check the box to the right marked 'Apply.' Next, click the drop-down menu labeled 'Experiment' and choose 'RED' (rare event detection), and click enter.
   3. Move to the section denoted 'Assay 1.' In the 'Name' section fill out the assay (e.g. Enterococcus) and click enter. In the box below labeled 'Type' click the drop-down menu and choose 'Channel 1 Unknown' and click enter.
   4. Move to the section denoted 'Assay 2.' In the 'Name' section fill out the assay (e.g. HF183) and click enter. In the box below labeled 'Type' click the drop-down menu and choose 'Channel 2 Unknown' and click enter. All the information from Steps 3.3.2 to 3.3.4 is now present in well A1.
   5. Name all subsequent wells containing droplets. To save total setup time, click 'Shift' or 'Ctrl,' to choose multiple wells simultaneously.
   6. When the digital depiction of the plate mirrors the physical plate, press 'OK' at the bottom right of the menu. In the new menu that appears at the top of the plate schematic, under the 'Template' section choose 'Save As' and name and save the plate.
   7. To the left of the screen click 'Run' and select appropriate Dye Set in the pop-out "Run Options" window. Data collection initiates and is displayed in real-time in the software.

Materials

Name	Company	Catalog Number	Comments
Low Bind Microtubes	Costar	3207	For storage of reagents, samples/production of master mixes
Nuclease-Free Water	FisherSci	BP2484-50
TE pH 8 buffer	FisherSci	BP2473-100
Hardshell 96-Well Plate	BioRad	HSP-9601	For initial master mix and sample inoculation
Aluminium Sealing Film	BioRad	359-0133	To seal sample plate
Droplet Generator	BioRad	186-3002
Droplet Generation Oil	BioRad	186-3005
Cartridge	BioRad	186-4008
DG8 Cartridge Holder	BioRad	186-3051
Gasket	BioRad	186-3009
20uL pipette tips	Rainin	GP-L10F	For tansferring sample/master mix to cartidge
200uL pipette tips	Rainin	GP-L200F	For transferring droplets to final Twin.Tec Plate
Twin.Tec 96-Well Plate	Eppendorf	951020320	For final droplets thermal cycling and reading
Pierceable Heat Seal Foil	BioRad	181-4040	To seal Twin.Tec plate before thermal cycling
PX1 PCR Plate Sealer	BioRad	181-4000	Only the thermal cycler is needed, no optics
CFX96 Thermal cycler	BioRad	CFX96 and C1000
QX100 Droplet Reader	BioRad	186-3001
Droplet Reader Oil	BioRad	186-3004
Droplet PCR Supermix	BioRad	186-3024	i.e. the digital PCR mix in manuscript
QuantaSoft software (v1.3.2)	Quantasoft	QX100	For viewing, analyzing, and exporting ddPCR data
Entero Forward Primer (Ent F1A)	Operon	GAGAAATTCCAAACGAACTTG	Alternative vendor can be used
Entero Reverse Primer (Ent R1)	Operon	CAGTGCTCTACCTCCATCATT	Alternative vendor can be used
Entero Probe (GPL813TQ)	Operon	[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]	Alternative vendor can be used, but the fluorophore has to be FAM
HF183 Forward Primer (HF183-1)	Operon	ATCATGAGTTCACATGTCCG	Alternative vendor can be used
HF183 Reverse Primer (BthetR1)	Operon	CGTAGGAGTTTGGACCGTGT	Alternative vendor can be used
HF183 Probe (BthetP1)	Operon	[6-HEX]-CTGAGAGGAAGGTCCCCC ACATTGGA-[BHQ1]	Alternative vendor can be used, but the fluorophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.)
Positive control			Mixture of E.faecalis genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalis and sequences of the ordered HF183 plasmid, please see Cao et al. 2015 (doi:10.1016/j.watres.2014.12.008). Commercially available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.