Isolation of Rat Adipose Tissue Mesenchymal Stem Cells for Differentiation into Insulin-producing Cells

Summary

Adipose tissue-derived mesenchymal stem cells (Ad-MSCs) can be a potential source of MSCs that differentiate into insulin-producing cells (IPCs). In this protocol, we provide detailed steps for the isolation and characterization of rat epididymal Ad-MSCs, followed by a simple, short protocol for the generation of IPCs from the same rat Ad-MSCs.

Abstract

Mesenchymal stem cells (MSCs)-especially those isolated from adipose tissue (Ad-MSCs)-have gained special attention as a renewable, abundant source of stem cells that does not pose any ethical concerns. However, current methods to isolate Ad-MSCs are not standardized and employ complicated protocols that require special equipment. We isolated Ad-MSCs from the epididymal fat of Sprague-Dawley rats using a simple, reproducible method. The isolated Ad-MSCs usually appear within 3 days post isolation, as adherent cells display fibroblastic morphology. Those cells reach 80% confluency within 1 week of isolation. Afterward, at passage 3-5 (P3-5), a full characterization was carried out for the isolated Ad-MSCs by immunophenotyping for characteristic MSC cluster of differentiation (CD) surface markers such as CD90, CD73, and CD105, as well as inducing differentiation of these cells down the osteogenic, adipogenic, and chondrogenic lineages. This, in turn, implies the multipotency of the isolated cells. Furthermore, we induced the differentiation of the isolated Ad-MSCs toward the insulin-producing cells (IPCs) lineage via a simple, relatively short protocol by incorporating high glucose Dulbecco's modified Eagle medium (HG-DMEM), β-mercaptoethanol, nicotinamide, and exendin-4. IPCs differentiation was genetically assessed, firstly, via measuring the expression levels of specific β-cell markers such as MafA, NKX6.1, Pdx-1, and Ins1, as well as dithizone staining for the generated IPCs. Secondly, the assessment was also carried out functionally by a glucose-stimulated insulin secretion (GSIS) assay. In conclusion, Ad-MSCs can be easily isolated, exhibiting all MSC characterization criteria, and they can indeed provide an abundant, renewable source of IPCs in the lab for diabetes research.

Introduction

Mesenchymal stem cells (MSCs), also known as mesenchymal stromal cells, are among the most widely used cell types for regenerative medicine^1,2. They are classified as adult stem cells and characterized by multilineage differentiation potential and self-renewal capacity³. MSCs can be isolated and obtained from various sources, including adipose tissue, bone marrow, peripheral blood, umbilical cord tissue and blood, hair follicles, and teeth^4,5.

The isolation of stem cells from adipose tissue is seen as both appealing and promising due to their easy access, rapid expansion in vitro, and high yield⁶. Adipose tissue-derived mesenchymal stem cells (Ad-MSCs) can be isolated from different species such as humans, bovines, mice, rats, and, more recently, goats⁷. It has been proven that Ad-MSCs are now potential candidates for tissue engineering and gene/cell therapy that can even be used to develop an autologous alternative for the long-term repair of soft tissue injury or defects^7,8.

The International Society for Cell and Gene Therapy (ISCT) has defined three minimum criteria that must be exhibited by MSCs for full characterization⁹. First, they must be plastic adherent. Second, MSCs should express mesenchymal stem cell surface markers such as CD73, CD90, and CD105 and lack expression of the hematopoietic markers CD45, CD34, CD14 or CD11b, CD79α or CD19, and HLA-DR. Finally, MSCs should exhibit the ability to differentiate into the three mesenchymal lineages: adipocytes, osteocytes, and chondrocytes. Interestingly, MSCs can also differentiate into other lineages such as neuronal cells, cardiomyocytes, hepatocytes, and epithelial cells^10,11.

In fact, MSCs possess unique properties that enable them to be applied as potential therapeutic agents in regenerative therapy for different diseases. MSCs can secrete soluble factors to induce an immunomodulatory environment that provides therapeutic benefits¹². In addition, MSCs can migrate toward sites of injury and tumor microenvironments to deliver targeted therapy; however, the mechanisms are not fully elucidated¹³. In addition, MSCs have the ability to secrete exosomes, extracellular vesicles in the nanoscale that carry a cargo of non-coding RNAs, protein, and soluble factors, which lately emerged as a novel mechanism of the MSCs' therapeutic potential in various diseases¹⁴.

More importantly, MSCs have generated marked attention for their potential to differentiate into insulin-producing cells (IPCs), either by genetic modification^15,16 or through utilizing various extrinsic-inducing factors within the culture media in vitro¹⁷. The IPC induction period varies greatly, as it depends on the used induction protocol and the utilized extrinsic factors. The process of differentiation can last from days to months, and it requires a combination of exogenous-inducing factors that must be added and/or withdrawn in different stages. Many of these factors that have been used for endocrine pancreatic differentiation are biologically active compounds that have been shown to promote the proliferation or differentiation/neogenesis of insulin-secreting β-cells and/or increase the insulin content of IPCs^18,19,20,21. It is noteworthy here that MSCs have also been reported to have therapeutic effects in diabetes and its complications via several mechanisms, including their secretome, as well as a wide array of immuno-modulatory actions^22,23,24.

In this protocol, we present a detailed stepwise protocol for the isolation and characterization of Ad-MSCs from rat epididymal fat, followed by a simple, relatively short protocol for the generation of IPCs from Ad-MSCs.

Protocol

All experiments were carried out according to the approved guidelines, and all procedures were approved by the Ethical Committee of the Faculty of Pharmacy, The British University in Egypt (BUE), Cairo, Egypt. The Ad-MSC isolation protocol was adopted from Lopez and Spencer, with modifications¹⁵.

1. Isolation of Ad-MSCs from rat epididymal fat pads

1. Use male Sprague-Dawley rats weighing 250-300 g that are not more than 1 month of age (two per isolation). Anesthetize the animals, then euthanize them by cervical dislocation. Spray the euthanized animal with 70% ethanol. Excise the skin and the muscle at the lower part of the abdomen, and then pull out the two testes to expose the epididymal fat pads.
2. Gently cut the epididymal fat pads and be careful not to cut the blood vessels.
3. Isolate the fat tissue surrounding the epididymis, then place it in a Petri dish containing phosphate-buffered saline (PBS).
4. In the biosafety cabinet, cut these fat pads into small pieces using forceps and scalpel. Transfer these cut adipose tissue pieces into a 50 mL centrifuge tube containing 10 mL of sterile PBS.
5. Wash the minced fat tissues 5 times with 10 mL of PBS each time to remove the contaminating blood. The following washing procedures must be meticulously carried out.
   1. Add 10 mL of PBS to the tissue and mix thoroughly for 45 s. Then, allow the tissue to settle via gravity by keeping the tube standing for 5 min to separate into two layers.
   2. Aspirate the PBS from the infranatant using a 10 ml syringe and replace with fresh 10 mL of PBS for another wash.
   3. Repeat this washing step 4-5 times until the PBS is clear of blood. This indicates that most, if not all, of the blood is removed.
6. After washing, resuspend the adipose tissue in 10 mL of collagenase solution (0.1% collagenase type 1 in PBS). Seal the tube tightly with parafilm, then incubate it in a shaking water bath (37 °C, 80 rpm, for 45 min) until the tissue is almost homogenous.
   NOTE: Avoid the complete digestion of the tissue (when the solution becomes completely homogenous with complete disappearance of all tissue residues/pieces), because it adversely affects the culturing of cells afterward. Usually, the digestion takes 30-45 min.
7. Once the collagenase digestion is done, vortex the tube for 15 s, then centrifuge for 5 min at 300 x g. Vortex the tube again for 10 s, followed by another 5 min centrifugation. Three layers will then be observed. Carefully discard the oil layer, followed by the aqueous layer, without disturbing the stromal vascular fraction (SVF) pellet.
   NOTE: Remove the supernatant containing adipocytes and the collagenase solution. First, remove the adipocytes and the accompanying oil layer with a 10 mL pipette to ensure complete removal of the oil droplets, then remove the underneath aqueous layer.
8. Resuspend the SVF pellet at the bottom of the tube in 10 mL of sterile BSA solution (1% albumin, bovine serum Fraction V solution in PBS), then centrifuge the tube for 5 min at 300 x g.
9. After centrifugation, discard the supernatant and suspend the SVF pellet in 8.5 mL of complete media for Ad-MSCs (composed of Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 [DMEM/F12] media supplemented with 10% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, and 2 mM L-glutamine).
10. Culture the cells in a 25 cm² flask at 37 °C under 5% CO_2. On the following day, check the attached cells, remove the suspended cells, and replace the media. Afterward, change the media every other day.
11. Passage the cells every 5-7 days when they are 80%-90% confluent using Trypsin-EDTA. Use cells between passages 3-5 for the subsequent experiments described in this protocol. A schematic presentation of all the isolation steps is provided in Figure 1.
    NOTE: Usually, Trypisn-EDTA potency may vary among different suppliers, so try to minimize the time of trypsinization to avoid toxic effects on the cells.

2. Characterization of Ad-MSCs by immunophenotyping using flow cytometry analyses

1. At passage 3, split the cells using Trypsin-EDTA. Wash with PBS 2 times and then count the cells with a hemocytometer.
2. Incubate 100,000 cells at 4 °C in the dark for 20 min with either mouse anti-rat CD90 or CD105 (mesenchymal markers) or CD34 (hematopoietic marker) monoclonal antibody labeled with fluorescein-isothiocyanate (FITC).
3. Wash the cells and suspend them in 500 µL of FACS buffer. Analyze by flow cytometry²⁵.

3. Assessment of the differentiation potential of isolated Ad-MSCs into various mesenchymal lineages

1. Adipogenic differentiation
   1. Resuspend the cells in complete media (as described in step 1.9.), then culture the cells at a density of 3.7 x 10⁴ cells/well in a 24-well tissue culture plate. Incubate at 37 °C in a humidified atmosphere of 5% CO₂. Next,change the media every 3 days until the cells reach almost 100% confluency, which usually takes 3 days.
   2. When the cells reach the desired confluency, replace the proliferation media with the adipogenic differentiation media (consisting of LG-DMEM media supplemented with 10% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, and 2 mM L-glutamine with 1x adipogenic supplement, supplied with the Mesenchymal Stem Cells Functional Identification Kit) to induce adipogenesis. Then, change the media every 3 days (0.5 mL/well). Take care to perform the media replacement gently so as not to disrupt the lipid vacuoles.
   3. After 21 days, assess the adipogenic differentiation by microscopic examination of the lipid vacuoles appearance and by Oil Red staining.
   4. Prepare a stock solution of Oil Red by dissolving 30 mg of Oil Red stain in 10 mL of isopropanol, and then keep it for at least 20 min at room temperature. Afterward, prepare a working solution by mixing 3 parts stock solution with 2 parts double-distilled water (ddH₂O), mix them well, and keep it for 10 min at room temperature, then filter afterward by filter paper.
   5. To document the adipogenic differentiation, wash the cells 2 times with PBS, then fix them using neutral-buffered formalin 10% (0.75 ml/well) for 15 min. After that, wash the cells 2 times with PBS using 1 mL/well and incubate the cells for 5 min each time. It is important to completely aspirate the PBS before adding the Oil Red working solution.
   6. After the last wash, add the Oil Red working solution to the cells and incubate them for 60 min at 37 °C. Afterward, remove the stain solution and gently wash the cells 2 times with PBS. Observe the stained lipid droplets under the microscope.
2. Osteogenic differentiation
   1. Seed 7.4 x 10³ cells/well (0.5 mL medium/well) in a 24-well plate and incubate them at 37 °C in a humidified atmosphere of 5% CO₂ in complete media (as described in step 1.9.) for 3 days to reach almost 70% confluency.
   2. Induce the cells with the osteogenic supplement (provided with the kit) in LG-DMEM media supplemented with 10% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, and 2 mM L-glutamine.
   3. Continue the osteogenic induction for 21 days, changing the differentiation media every 3 days.
   4. Prepare a working solution of Alizarin Red S stain by dissolving 200 mg of Alizarin Red S stain in 9 mL of ddH₂O, and then adjust pH to 4.1-4.3 using ammonium hydroxide and HCl. Next, make up the volume to 10 mL by ddH₂O. Following this, remove any precipitates by filtration using filter paper.
   5. Wash the cells 2 times with PBS, then fix them using 10% buffered formalin (0.75 mL/well) for 15 min. Afterward, wash the cells 2 times using PBS (1 mL/well). Each time, incubate the cells for 5 min.
   6. Incubate the fixed cells with the prepared 2% Alizarin-Red S solution for 30 min in a 37 °C incubator.
   7. After that, remove the stain solution, wash the cells 2 times with ddH₂O and once with PBS, and then observe the stained calcium-rich extracellular matrix to assess osteogenic differentiation under the microscope.
3. Chondrogenic differentiation
   1. Seed 7.4 x 10³ cells/well (0.5 mL medium/well) in a 24-well plate and incubate these at 37 °C in a humidified atmosphere of 5% CO₂ in complete media (as described in step 1.9.) for 3 days to reach almost 70% confluency.
   2. When the desired confluency is reached, induce the chondrogenic differentiation of the cells with serum-free DMEM/F12 containing insulin-transferrin selenium (ITS), chondrogenic supplement (provided with the kit), 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, and 2 mM L-glutamine²¹.
   3. Incubate the cells with the chondrogenic media for 21 days, while changing the chondrogenic differentiation media every 3 days.
   4. Prepare a working solution of Alcian Blue 8GX stain as follows: First, prepare a 3% glacial acetic acid solution in ddH₂O by adding 3 mL of glacial acetic acid to 97 mL of ddH₂O. Then, prepare a working solution of Alcian Blue 8GX stain by mixing 0.1 g in 100 mL of 3% glacial acid solution, and remove any precipitates by filtration using filter paper.
   5. Wash the cells 2 times with PBS, then fix them using 10% buffered formalin (0.75 mL/well) for 15 min. Afterward, wash the cells 2 times using PBS (1 mL/well). Each time, incubate the cells for 5 min.
   6. The next step is to incubate the cells in the prepared 0.1% Alcian Blue 8GX stain in 3% glacial acetic acid for 60 min at 37 °C. Wash the stained cells 2 times with ddH₂O and once with PBS, and then observe the stained sulfated proteoglycans under the microscope.

4. Differentiation of Ad-MSCs into IPCs

1. At passage 3, split the Ad-MSCs using Trypsin- EDTA. First, remove the media, then wash the cells while still attached in the culture flask with 5 mL of PBS. Next, add 5 mL of Trypsin- EDTA to the 75 cm² flask and incubate at 37 °C for 3-10 min.
   NOTE: Try to induce the cells at early passages, usually between P3-P5, as late passages adversely affect the cells' properties and differentiation abilities^17,24.
2. Afterward, inspect the cells for detachment and for being a single-cell suspension. Add 5 mL of complete DMEM/F12 media to the flask to inhibit the trypsin action. Collect the cell suspension and transfer it to a 15 mL tube, and then add another 5 mL of complete DMEM/F12 media to the tube.
3. Centrifuge the cells at 300 x g for 2 min to pellet the cells.
4. Wash the cells once with PBS, centrifuge again at 300 x g for 2 min, and then resuspended the cell pellet in 3-5 mL of complete DMEM/F12 media.
5. Count the cells using trypan blue exclusion dye and a hemocytometer.
6. Then, seed the cells in 6-well plates (1 x 10⁶ cells/plate) and a 12-well plate (for GSIS assay; 1 x 10⁶ cells/plate) and incubate in a 37 °C, 5% CO₂ incubator in complete media (as described in step 1.9.) for 3 days to reach almost 90% confluency.
7. On the day of induction, remove the media, wash the cells with PBS, and then pre-induce the cells for 2 days by pre-induction media (DMEM/F12 supplemented with 10% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, 2 mM L-glutamine, 10 mM nicotinamide [NA], and 1mM β-mercaptoethanol [β-ME]).
8. Induce the cells for another 1 day using high glucose DMEM (HG-DMEM, 4.5g/L glucose) supplemented with 2.5% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, 2 mM L-glutamine, 10 mM NA, and 1mM β-mercaptoethanol. Collect cell pellets at the end of this stage (designated D3 cells in this protocol).
9. Incubate the cells for an additional 7 days in the final differentiation induction media composed of HG-DMEM supplemented with 2.5% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, 2 mM L-glutamine, 10 mM NA, 1mM β-mercaptoethanol, and 10 nM exendin-4.
10. At the end of the specified period, collect cell pellets (named Final in this protocol), and assess the successful differentiation of the cells by DTZ staining and GSIS assay, as follows in this protocol.
11. Assess the generated IPCs by following steps 5 and 6 below.

5. Dithizone staining

1. Prepare dithizone (DTZ) stain stock solution as follows: Completely dissolve 25 mg of DTZ in 2.5 mL of dimethyl sulfoxide (DMSO), divide into aliquots, and store at −20 °C in the dark until use.
2. For staining, prepare a working solution 1:100 (volume/volume) by diluting the stock solution in complete culture medium (HG-DMEM supplemented with 5% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, and 2 mM L-glutamine). Then, filter the working solution through a 0.2 µm syringe filter.
3. Next, for the specified DTZ staining culture cells in a 6-well plate and, after aspirating the culture media, wash the cells once with PBS, and then add 2 mL of DTZ working solution into each well. Incubate for at least 2 h at 37 °C in the CO₂ incubator.
4. Carefully wash the cells 2 times with PBS. After the last wash, add 2 mL of PBS into each well. Then, observe the crimson red-stained IPCs under an inverted microscope. Use uninduced Ad-MSCs initially cultured in complete growth medium (10% FBS - DMEM/F12) as a control.

6. Gene expression of β-cell markers by RT-qPCR

1. RNA extraction
   1. After differentiation, collect the cell pellets and store them at −80 °C until use. Suspend each cell pellet (derived from the six wells of one 6-well plate pooled) in 1 mL of guanidium thiocyanate RNA extraction reagent in a 1.5 mL nuclease-free tube, along with pipetting up and down several times. Incubate the lysed samples at room temperature for 5 min to permit complete dissociation of the nucleoprotein complexes.
   2. Add 200 µL of chloroform per 1 mL of RNA extraction reagent, and securely cap the tubes to be vigorously shaken by hand for 15 s. Next, incubate for 3 min at room temperature.
   3. Centrifuge the samples at 13,800 x g for 15 min at 4 °C. This will lead to mixture separation into a lower chloroform phase, an interphase, and a colorless upper aqueous phase, with the RNA remaining in the aqueous phase.
   4. Place the upper aqueous phase into a new tube, while carefully avoiding touching the interphase.
   5. Add 600 µL of 100% isopropanol to the aqueous phase (1:1 volume), then mix the samples thoroughly by inversion 25 times, and incubate at room temperature for 10 min.
   6. Centrifuge the samples at 18,800 x g for 30 min at 4 °C. The precipitated RNA forms a small gel-like pellet on the tube side.
   7. Remove the supernatant and wash the pellets with 1 mL of 80% ice-cold ethanol. After adding the ethanol, slowly conduct multiple pipetting of the RNA pellet for 10 s.
   8. Centrifuge the samples for 5 min at 9,600 x g at 4 °C. Discard the supernatant and leave the RNA pellets to air-dry for 5-10 min.
   9. After drying, dissolve the RNA pellets in 25-100 µL of RNase-free water (according to the initial pellet size) by pipetting up and down several times until complete solubilization in 1.5 mL nuclease-free tubes. Avoid excessive drying of the RNA pellet.
      NOTE: Usually, the pellet becomes transparent when it dries. However, once it is clear, promptly resuspend it to avoid excessive dryness of the pellet.
   10. Quantify RNA by determining the optical densities (OD) at 260 nm and 280 nm, using nuclease-free water as blank.
   11. Ensure that the samples have OD260/OD280 = 1.8-2.0.
2. cDNA synthesis
   1. Synthesize cDNA from the isolated total RNA using a cDNA synthesis kit.
   2. Carry out the cDNA synthesis reaction according to the manufacturer's instructions. In a 200 µL PCR tube, add a volume of RNA solution containing 0.5 µg of total RNA to the reaction master mix shown in Table 1.
   3. After adding the RNA to the master mix, enter the mixture through a cycling program of 50 °C for 30 min for one cycle, followed by an inactivation cycle of 95 °C for 2 min, using a thermal cycler.
   4. Dilute the cDNA using nuclease-free water to a final concentration of 2 ng/µL. Store at −20 °C for subsequent RT-qPCR.
3. RT-qPCR using SYBR Green Master Mix
   1. Carry out the RT-qPCR reaction for each target gene using cDNA template according to the reaction mix shown in Table 2. Do all the measures in triplicates.
   2. The sets of primers used are shown in Table 3. Perform all the RT-qPCR procedures on ice.
   3. Carry out the RT-qPCR reaction using a real-time PCR machine on default program settings. The thermal cycling conditions included initial denaturation of 95 °C for 10 min, followed by 45 cycles of denaturation (95 °C, 15 s) and combined annealing/extension (60 °C, 1 min).
   4. Determine the C_t values and detect the expression levels in accordance to 2^-ΔΔCt, with β-actin as an internal control.

cDNA synthesis master mix	Volume (µl)
5x cDNA synthesis buffer	4
dNTP	2
RNA primer	1
Verso Enzyme Mix	1
RT enhancer	1
Nuclease Free water	Variable
Total RNA	Variable
Total Reaction volume	20

Table 1: cDNA synthesis master mix volumes.

RT-qPCR reaction mix	Volume (µl)	Final concentration in 10 µL
cDNA	2	2 ng/well
RT-qPCR Forward primer (3 µM)	1	300 nM
RT-qPCR Reverse primer (3 µM)	1	300 nM
Nuclease free water	1	-------
2x SYBR Green master mix	5	1x
Total reaction volume	10

Table 2: RT-qPCR reaction mixture.

Gene	Forward primer	Reverse primer
FOXA2	GAGCCGTGAAGATGGAAGG	ATGTTGCCGGAACCACTG
PDX-1	ATCCACCTCCCGGACCTTTC	CCTCCGGTTCTGCTGCGTAT
NKX6.1	ACACCAGACCCACATTCTCCG	ATCTCGGCTGCGTGCTTCTT
MafA	TTCAGCAAGGAGGAGGTCAT	CCGCCAACTTCTCGTATTTC
Ins-1	CACCTTTGTGGTCCTCACCT	CTCCAGTGCCAAGGTCTGA
β-actin	TGGAGAAGATTTGGCACCAC	AACACAGCCTGGATGGCTAC

Table 3: Forward and reverse primer sequences.

7. Glucose-stimulated insulin secretion

1. Preparation of Kreb's Ringer bicarbonate (KRB) buffer
   1. Prepare Kreb's Ringer bicarbonate (KRB) buffer solution with both 2 mM glucose (low glucose) and 20 mM glucose (high glucose) concentrations for the glucose-stimulated insulin secretion (GSIS) assay. The components used for the KRB buffer preparation are given in Table 4.
   2. Adjust the pH of the buffer using 1 N HCl to about 7.25-7.35 (i.e., 0.1-0.2 units below the desired pH 7.4, because it may rise during filtration).
   3. Add bovine serum albumin (BSA) freshly in a concentration of 0.1 % (weight/volume).
   4. Add glucose afterward (18 mg for 50 mL of KRB to prepare the 2 mM low glucose KRB buffer, and 180 mg for 50 mL of KRB to prepare the 20 mM high glucose KRB buffer).
   5. Sterilize the prepared LG and HG KRB buffers by filtration through a 0.2 µm syringe filter to be ready for the GSIS assay.
2. GSIS assay
   1. Initially seed 1 x 10⁵ cells/well in a 12-well cell culture plate and induce these cells by using the exact same differentiation induction protocol.
   2. At the end of the induction protocol, gently wash the generated IPCs (in plate) 2 times with PBS and once with LG-KRB.
   3. Afterward, incubate the IPCs with 300 µL of LG-KRB/well for 1 h, and then discard this buffer.
   4. Next, incubate the IPCs with 300 µL of either 2 mM (LG) or 20 mM (HG) KRB buffer for an additional 1 h. At the end of the incubation period, collect the supernatant and store at −80 °C for the subsequent secreted insulin assay using a commercial ELISA kit and following the manufacturer's instructions.
      NOTE: Try to be as gentle as possible while aspirating or adding the PBS and KRB buffer when performing the GSIS assay.

Component	Concentration
Magnesium Chloride (Anhydrous)	0.0468 g/L
Potassium Chloride	0.34 g/L
Sodium Chloride	7.00 g/L
Sodium Phosphate Dibasic (Anhydrous)	0.1   g/L
Sodium Phosphate Monobasic (Anhydrous)	0.18 g/L
Sodium Bicarbonate	1.26 g/L
Calcium Chloride	0.2997 g/L

Table 4: The components used for the KRB buffer preparation.

8. Statistical analysis

1. Express all data as mean ± standard error of the mean (SEM). All comparisons were done using one-way analysis of variance (ANOVA) and Tukey's post hoc test using statistical software. Results with p-values **p ≤ 0.01 and *p ≤ 0.05 were considered statistically significant.

Representative Results

Isolation and characterization of Ad-MSCs
As shown in Figure 2, the isolated cells from adipose tissue showed a heterogeneous population of rounded and fibroblast-like cells starting from the next day of isolation (Figure 2A). 4 days post isolation, the fibroblast cells started to increase in number and size and grow as a homogenous population by passage 1 (Figure 2B,C). These cells continued to grow as plastic-adherent, fibroblastic-like cells as shown until passage 3, fulfilling the first criterion of MSC characteristics (Figure 2D). These Ad-MSCs showed very good culture characteristics, and this protocol was found to be a relevant, easy, and relatively fast protocol to isolate Ad-MSCs from epididymal fat pads.

The next step was to characterize the isolated Ad-MSCs. According to ISCT, MSCs should follow the three criteria of plastic adherence, expression of mesenchymal CDs with a lack of hematopoietic markers, and the ability to differentiate into adipocytes, osteocytes, and chondrocytes. As shown in Figure 3A, the flow cytometry analysis showed that most of these cells expressed CD90 and CD105 (76.4% and 73.6%, respectively). Meanwhile, they were almost negative for CD34 (0.1%).

Moreover, upon induction of differentiation of these cells, they showed the ability to differentiate into adipocytes, osteocytes, and chondrocytes. As shown in Figure 3B (upper panel), the adipocytes showed Oil Red staining of lipid vacuoles when compared to control uninduced cells. The osteocytes showed characteristic Alizarin Red staining (Figure 3B, middle panel) when compared to control cells. Finally, chondrocyte-induced cells showed blue staining of the extracellular matrix when compared to control uninduced cells (Figure 3B, bottom panel).

These data clearly indicate that isolated cells from adipose tissue not only exhibit good culture characteristics but also exhibit all the criteria proposed for MSCs.

Differentiation of Ad-MSCs into insulin-producing cells (IPCs)
As shown in Figure 4A, we used a relatively simple, short protocol in order to differentiate Ad-MSCs into IPCs. After the induction of differentiation, the induced IPCs were assessed in several ways. The induced cells showed marked morphological changes. As shown in Figure 4B (upper panel), the induced cells showed rounded, cluster-like morphology when compared to the normal fibroblastic-like morphology of Ad-MSCs. Interestingly, upon staining with dithizone, these clusters showed a crimson stain, which is a characteristic of zinc granules of β-cell stain (Figure 4B, lower panel).

Afterward, the generated IPCs were genetically assessed for the expression of the specific β-cell markers when compared to the uninduced control cells. As shown in Figure 5A-E, the induced cells were able to express various specific β-cell markers, indicating their ability to generate IPCs. As for FOXA2-a definitive endoderm marker (as shown in Figure 5A)-, it was highly expressed at D3 differentiation when compared to control, reaching almost 30 fold and then decreasing to only 10 fold of the control in the final differentiated cells (D3: 28.37 ± 0.88; Final: 12.10 ± 1.27; p < 0.05). As for Pdx-1 (which is considered an early marker of β-cells), it was elevated in both D3 and final differentiated cells, reaching almost 20 fold when compared to control uninduced cells (D3: 22.39 ± 5.14; Final: 17.13 ± 0.342; p < 0.05; Figure 5B). Concerning the other β-cell markers, namely NKX6.1, MafA, and insulin-1 (Ins1), they all showed elevation starting from D3 until final differentiation, reaching almost 8 fold, 12 fold, and 300 fold, respectively, when compared to control uninduced cells (NKX6.1: D3: 1.94 ± 0.86, Final: 7.97 ± 1.34, p<0.05; MafA: D3: 6.59 ± 0.4, Final: 11.54 ± 2.40, p < 0.05; and Ins1: D3: 27.29 ± 20.27, Final: 318.20 ± 76.09, p < 0.05) (Figure 5C-E). This indicates that these Ad-MSCs can differentiate into IPCs expressing β-cell markers.

Finally, these cells were assessed for the secretion of insulin when challenged with increasing concentrations of glucose. As shown in Figure 5F, the insulin secreted in the supernatant of the induced IPCs when challenged with 20 mM glucose was significantly higher than that secreted when the cells were challenged with 2 mM glucose (HG: 390 pg/mL ± 33 pg/mL; LG: 234 pg/mL ± 32 pg/mL, p < 0.05; Figure 5F)

These data confirmed that the used protocol managed to differentiate the Ad-MSCs into IPCs, which was genetically and functionally confirmed.

Figure 1: A schematic presentation of the steps of the protocol used for the isolation and characterization of Ad-MSCs. Generated by Biorender.com. Please click here to view a larger version of this figure.

Figure 2: Photomicrographs showing the isolated Ad-MSCs. (A) Isolated cells exhibiting plastic-adherent, fibroblast-like morphology start to appear the day following isolation. (B) Over time, these adherent Ad-MSCs (with fibroblast-like morphology) proliferate and increase in number, reaching a more homogenous fibroblast-like population in (C) P1 and (D) P3. Please click here to view a larger version of this figure.

Figure 3: Characterization of Ad-MSCs. (A) Flow cytometric analysis of Ad-MSCs shows that these cells are almost negative for CD34 (upper panel), while the majority of cells express CD90 and CD105 (lower panel). Ad-MSCs can differentiate into the three mesenchymal lineages, namely (B) adipocytes (where oil droplets are stained by oil red), (C) osteocytes, stained by alizarin red, and (D) chondrocytes, stained by Alcian Blue (when compared to control uninduced cells). Control: uninduced cells, Diff: differentiated cells. Please click here to view a larger version of this figure.

Figure 4: Differentiation of Ad-MSCs into IPCs. (A) Schematic presentation of the differentiation protocol used to generate IPCs from Ad-MSCs, together with photomicrographs for the cells at each stage during the induction of differentiation towards IPCs. Upon differentiation, cells lose their fibroblastic morphology and tend to aggregate forming clusters, which tend to detach and grow in suspension media. (B) Photomicrographs show control Ad-MSCs and IPCs generated by the above protocol showing round cluster morphological changes (right panel) when compared to the fibroblast-like morphology of the un-induced Ad-MSCs (left panel), either unstained (upper panel), or DTZ stained (lower panel).
Control: un-induced cells; IPCs: insulin-producing cells; NA: nicotinamide; β-ME: beta mercaptoethanol; D3: Induced cells at Day 3 during the induction of differentiation towards IPCs; D10: final differentiated IPCs at the end of the induction protocol; Ex-4: exendin-4. Please click here to view a larger version of this figure.

Figure 5: Relative expression levels of β-cell markers and GSIS for IPCs. Relative expression levels by qRT-PCR for (A) FOXA2, (B) Pdx-1, (C) NKX6.1, (D) MafA, and (E) Ins-1. (F) Levels of secreted insulin in the supernatant upon challenging the generated IPCs with 2mM glucose (LG) or 20mM glucose (HG). Control: uninduced Ad-MSCs, Day-3: differentiated cells collected at D3; Final: final differentiated IPCs; LG: low glucose; HG: high glucose. a: mean is different from control at p < 0.05; b: mean is different from Day-3 at p < 0.05; *: mean of LG is different from HG at p < 0.05; the comparison was done using an independent samples t-test. Please click here to view a larger version of this figure.

Discussion

In this protocol, we managed to present a detailed protocol for the isolation of Ad-MSCs from rat epididymal fat and the differentiation of these Ad-MSCs into IPCs. In fact, rat epidydimal fat is an easily attainable source of adipose tissue for obtaining Ad-MSCs and does not require any special equipment, neither for collection nor for processing^15,26,27. The isolated Ad-MSCs showed excellent culture expansion and exhibited all the criteria to be defined as MSCs. The used protocol was previously described with slight modifications¹⁵. This protocol has been proven to be effective and reproducible. The cells showed fibroblastic-like morphology from day 1 after isolation and continued to expand until they reached a homogenous population. Interestingly, we used the same protocol to isolate human Ad-MSCs from lipo-aspirate with comparable success to rat tissue (data not shown). The only limitation of this process is the chemical digestion using collagenase when put side to side with mechanical digestion in other protocols²⁸. This step also represents a critical measure, as the chemical digestion of the cells can adversely affect their viability^29,30. Otherwise, this protocol offers a good start for any researcher who would consider launching an Ad-MSC line of research in their lab.

The use of MSCs in the treatment of diabetes has opened new pathways and given new hopes for the treatment of diabetes. However, the generation of fully mature IPCs from MSCs is still a matter of debate and challenge³¹. Currently, there are several protocols for inducing the differentiation of MSCs toward IPCs in the literature. These protocols utilize a plethora of chemical compounds and growth factors for various periods of time^20,32,33. These factors mainly depend on the MSC type and source to begin with^34,35. Nevertheless, obtaining mature functional IPCs from MSCs is still a matter of debate and research in the field²⁰.

In the presented protocol, we provide a short, relatively simple, efficient way to obtain functional IPCs from Ad-MSCs. The resulting cells showed marked morphological changes with positive DTZ staining, expressed most of the β-cell markers, and showed increased insulin secretion in response to increased glucose concentration challenge. All this evidence confirms the efficiency of this protocol as a β-cell induction protocol from Ad-MSCs. We used this protocol in another type of MSCs, namely human Wharton's jelly MSCs (WJ-MSCs), derived from the umbilical cord, and it actually showed similar results^21,36. These outcomes warrant trying our protocol on other types and sources of MSCs, rendering the procedure a universal protocol for the generation of IPCs from MSCs. It is noteworthy to highlight the importance of inducing the cells at early passages, usually between P3-P5, as late passages adversely affect the cells' properties and differentiation abilities^17,24.

As mentioned before, attaining fully mature β-cells from MSCs is a matter of debate and far from complete elucidation. However, such protocols as those described here provide a simple, fast means to better understand the underlying mechanisms of the differentiation of Ad-MSCs, or even other types of MSCs, into IPCs. The ability of the added compounds for the induction of the Ad-MSCs to express specific β-cell markers provides a useful tool to study the genetic and epigenetic factors that govern the differentiation of MSCs into IPCs. In addition, the quick, simple protocol allows researchers to study other intrinsic factors that may improve the outcome of such differentiation. These factors may represent either an adjuvant therapy with stem cells or even may provide a therapeutic modality for diabetes. In our lab, we used a similar approach to prove that obestatin, a gut hormone, can be a novel potential factor for the generation of IPCs from WJ-MSCs³⁷.

It is also worth mentioning that the current protocol has two main limitations. First, as mentioned previously, we used chemical digestion by collagenase, which can adversely affect the viability of the cells^29,30. Second, we employed the differentiation process in vitro and did not investigate the expected further maturation and differentiation enhancement of the generated IPCs in vivo. It is important to point out that the transplantation of in vitro-differentiated MSCs into IPCs showed a profound induction of the expression of various β-cells markers. This increase reached about 100 fold 12-18 months post transplantation in vivo³⁸. Thus, future studies to further investigate the in vivo maturation of generated IPCs by this simple protocol will be of good value.

In conclusion, we provided a detailed protocol for the isolation and characterization of Ad-MSCs, followed by a relatively simple, fast, and efficient protocol for the generation of IPCs from Ad-MSCs. These protocols not only provide an efficient tool to initiate a stem cell therapy line of research but also can help to develop the ever-growing field of MSC cell therapy for diabetes.

Materials

Name	Company	Catalog Number	Comments
Albumin, bovine serum Fraction V	MP Biomedicals
Alcian Blue 8GX	Sigma-Aldrich, USA	A3157
Alizarin Red S	Sigma-Aldrich, USA	A5533
Ammonium hydroxide	Fisher Scientific, Germany
Antibody for Rat CD90, FITC	Stem Cell Technologies	60024FI
Bovine serum albumin	Sigma Aldrich	A3912
Calcium Chloride	Fisher Scientific, Germany
CD105 Monoclonal Antibody, FITC	Thermo Fisher Scientific, Invitrogen, USA	MA1-19594
CD34 Polyclonal Antibody	Thermo Fisher Scientific, Invitrogen, USA	PA5-85917
Chloroform	Fisher Scientific, USA
Collagenase type I, powder	Gibco, Thermo Fisher, USA	17018029
D-Glucose anhydrous, extra pure	Fisher Scientific, Germany	G/0450/53
Dimethyl sulfoxide (DMSO)	Fisher Scientific, Germany	BP231-100
Dithizone staining	Sigma-Aldrich, USA	D5130
DMEM - High Glucose 4.5 g/L	Lonza, Switzerland	12-604F
DMEM - Low Glucose 1 g/L	Lonza, Switzerland	12-707F
DMEM/F12 medium	Lonza, Switzerland	BE12-719F
DNAse/RNAse free water	Gibco Thermo Fisher, USA	10977-035
Ethanol absolute, Molecular biology grade	Sigma-Aldrich, Germany	24103
Exendin-4	Sigma-Aldrich, Germany	E7144
Fetal Bovine Serum (FBS)	Gibco Thermo Fisher, Brazil	10270-106
Formaldehyde 37%	Fisher Scientific
Hydrochloric acid (HCl)	Fisher Scientific, Germany
Isopropanol, Molecular biology grade	Fisher Scientific, USA	BP2618500
L-Glutamine	Gibco Thermo Fisher, USA	25030-024
Magnesium Chloride (Anhydrous)	Fisher Scientific, Germany
Mesenchymal Stem Cell Functional identification kit	R&D systems Inc., MN, USA	SC006
Nicotinamide	Sigma-Aldrich, Germany	N0636
Oil Red Stain	Sigma-Aldrich, USA	O0625
Penicillin-Streptomycin-Amphotericin	Gibco Thermo Fisher, USA	15240062
Phosphate buffered saline, 1X, without Ca/Mg	Lonza, Switzerland	BE17-516F
Potassium Chloride	Fisher Scientific, Germany
Rat Insulin ELISA Kit	Cloud-Clone Corp., USA	CEA682Ra
Sodium Bicarbonate	Fisher Scientific, Germany
Sodium Chloride	Fisher Scientific, Germany
Sodium Phosphate Dibasic (Anhydrous)	Fisher Scientific, Germany
Sodium Phosphate Monobasic (Anhydrous)	Fisher Scientific, Germany
SYBR Green Maxima	Thermo Scientific, USA	K0221
Syringe filter, 0.2 micron	Corning, USA	431224
TRIzol	Thermo Scientific, USA	15596026
Trypan blue	Gibco Thermo Fisher, USA	15250061
Trypsin-Versene-EDTA, 1X	Lonza, Switzerland	CC-5012
Verso cDNA synthesis kit	Thermo Scientific, USA	AB-1453/A
β-mercaptoethanol	Sigma-Aldrich, Germany	M3148