JoVE 비디오를 활용하시려면 도서관을 통한 기관 구독이 필요합니다. 전체 비디오를 보시려면 로그인하거나 무료 트라이얼을 시작하세요.

Summary

The three-dimensional, serum-free culture method for adult lacrimal gland (LG) stem cells is well established for the induction of LG organoid formation and differentiation into acinar or ductal-like cells.

Abstract

Lacrimal gland (LG) stem cell-based therapy is a promising strategy for lacrimal gland diseases. However, the lack of a reliable, serum-free culture method to obtain a sufficient number of LG stem cells (LGSCs) is one obstacle for further research and application. The three-dimensional (3D), serum-free culture method for adult mouse LGSCs is well established and shown here. The LGSCs could be continuously passaged and induced to differentiate to acinar or ductal-like cells.

For the LGSC primary culture, the LGs from 6-8-week-old mice were digested with dispase, collagenase I, and trypsin-EDTA. A total of 1 × 10⁴ single cells were seeded into 80 µL of matrix gel-lacrimal gland stem cell medium (LGSCM) matrix in each well of a 24-well plate, precoated with 20 µL of matrix gel-LGSCM matrix. The mix was solidified after incubation for 20 min at 37 °C, and 600 µL of LGSCM added.

For LGSC maintenance, LGSCs cultured for 7 days were disaggregated into single cells by dispase and trypsin-EDTA. The single cells were implanted and cultured according to the method used in the LGSC primary culture. LGSCs could be passaged over 40 times and continuously express stem/progenitor cell markers Krt14, Krt5, P63, and nestin. LGSCs cultured in LGSCM have self-renewal capacity and can differentiate into acinar or ductal-like cells in vitro and in vivo.

Introduction

Lacrimal gland stem cells (LGSCs) maintain lacrimal gland (LG) cell renewal and are the source of acinar and ductal cells. Therefore, LGSC transplantation is considered an alternative approach for treating severe inflammatory damage and aqueous-deficient dry eye disease (ADDED)^1,2,3. Several culture methods have been applied to enrich LGSCs. Tiwari et al. separated and cultured primary LG cells using collagen I and matrix gel supplemented with several growth factors; however, the LG cells could not be continuously cultured⁴. Using two-dimensional (2D) culture, mouse LG-derived stem cells were isolated by You et al.⁵ and Ackermann et al.⁶, found to express the stem/progenitor cell marker genes, Oct4, Sox2, Nanog, and nestin, and could be subcultured. However, there is no clear indication that these cells can differentiate into acinar or ductal cells, and there is no transplantation experiment to verify the differentiation potential in vivo.

Recently, c-kit⁺ dim/EpCAM⁺/Sca1^–/CD34^–/CD45^– cells were isolated from mouse LGs by flow cytometry, found to express LG progenitor cell markers, such as Pax6 and Runx1, and differentiated into ducts and acini in vitro. In mice with ADDED, orthotopic injection with these cells could repair damaged LGs and restore the secretory function of LGs². However, the number of stem cells isolated by this method was small, and there are no suitable culture conditions for expanding the isolated LGSCs. In summary, an appropriate culture system needs to be established to effectively isolate and culture adult LGSCs with stable and continuous expansion for the study of LGSCs in the treatment of ADDED.

Organoids derived from stem cells or pluripotent stem cells are a group of cells that are histologically similar to the related organs and can maintain their own renewal. After the mouse intestine organoid was successfully cultured by Sato et al. in 2009⁷, organoids from other organs were cultured in succession, based on Sato's culture system, such as gallbladder⁸, liver⁹, pancreas¹⁰, stomach¹¹, breast¹², lung¹³, prostate¹⁴, and salivary gland¹⁵. Due to the high proportion of adult stem cells before cell differentiation in organoid culture, the three-dimensional (3D) organoid culture method is considered optimal for the isolation and culture of adult stem cells of LG.

An adult mouse LGSC culture system was established in the present study by optimizing the 3D, serum-free culture method. It is proven that the LGSCs cultured from both normal and ADDED mice showed a stable capacity of self-renewal and proliferation. After transplantation into the ADDED mouse LGs, LGSCs colonized the impaired LGs and improved tear production. In addition, red fluorescent LGSCs were isolated from ROSA26^mT/mG mice and cultured. This work provides a reliable reference for LGSC enrichment in vitro and LGSC autograft in clinical application for ADDED therapy.

Protocol

All the experiments in this protocol followed the animal care guidelines of the Ethical Committee on Animal Trial of Sun Yat-sen University. All cell-related operations are to be performed on the ultraclean workbench in the cell operation room. All operations using xylene are to be carried out in fume hoods.

1. LGSC primary culture

1. LG isolation
   1. Obtain a 6-8-week-old BALB/c male mouse, and cut the skin behind the ear to expose the LG and the connective tissue around it. Peel off the connective tissue by blunt dissection with the help of tweezers and remove the LG.
   2. Rinse the LGs twice with 4 mL of sterile 10 mM PBS solution to remove blood in a 6 cm dish. Immerse the LGs in a 6 cm dish with 4 mL of 75% ethanol for 10 s and rinse with 10 mM PBS twice immediately.
2. Obtain single cells of LG
   1. Use HEPES buffer solution (50 mM HEPES/KOH, pH 7.4; 150 mM NaCl in ultrapure water) to prepare 25 U/mL dispase. Prepare the 0.1% collagenase I solution with ultrapure water.
   2. Cut the LGs into small fragments (about 1 mm³), transfer them to a sterile 15 mL centrifuge tube, and treat the tissues with 500 µL of 25 U/mL dispase and 500 µL of 0.1% collagenase I for 1 h at 37 °C.
   3. Use 10 mM PBS to prepare trypsin-EDTA solution (0.05 g/L trypsin, 0.04 g/L EDTA). Treat the LG fragments from step 1.2.2 with 1 mL of 0.05% trypsin-EDTA for 10 min at 37 °C and dissociate the fragments into single cells by pipetting repeatedly.
   4. Filter the suspension through a 70 µm filter, collect the filtrate into a sterile 15 mL centrifuge tube, and centrifuge at 150 × g for 5 min.
   5. After centrifugation, remove the supernatant, add 10 mL of 10 mM PBS to wash the cell pellet, and centrifuge the suspension.
   6. Repeat step 1.2.5, remove the supernatant, and add 1 mL of DMEM/F12 (1:1 mixture of Dulbecco's modified Eagle's medium and Ham's F-12) to resuspend the cell pellets.
3. LGSC primary culture
   1. Prepare the lacrimal gland stem cell medium (LGSCM) containing DMEM/F12, 1x N2 supplement, 1x B27 supplement, 2 mM glutamine substitute, 0.1 mM NEAAs (nonessential amino acids), 50 ng/mL murine epidermal growth factor (EGF), 100 ng/mL fibroblast growth factor 10 (FGF10), 10 ng/mL Wnt3A, and 10 µM Y-27632 (ROCK inhibitor).
   2. Add 20 µL of matrix gel-LGSCM matrix (matrix gel: LGSCM = 1:1) at the center of the well of a 24-well plate. Use a pipette tip to expand it to a circle (6-8 mm diameter) and incubate the mixture for 20 min at 37 °C to precoat the well.
   3. Use a cell counter to determine the cell number and add 40 µL of LGSCM with a total of 1 × 10⁴ cells into 40 µL of the matrix gel. Mix them gently with a pipette to obtain a matrix gel-LGSCM mixture (matrix gel: LGSCM= 1:1).
   4. Use a pipette to carefully drop 80 µL of the mixture over the precoated area in each well of the 24-well plate in step 1.3.2.
   5. Incubate the mixture for 20 min at 37 °C and add 600 µL of LGSCM.
   6. Change the culture medium in each well once every two days. After 7 days of culture, look for LGSC spheres that are 100-300 µm diameter under the inverted microscope (eyepiece: 10x, objective: 4x).
      NOTE: LGSCs can be cultured for more than 14 days in total.
4. Isolate and culture primary LGSCs of ROSA26^mT/mG mice and DED mice (NOD/ShiLtJ) following the steps described above.

2. LGSC maintenance and passage

1. Remove the culture medium from the sphere culture well.
2. Disaggregate the LGSC spheres cultured for 7 days by incubation in 20 µL of 10 U/mL dispase and 100 µL of 10 mM PBS for 30 min at 37 °C.
3. Transfer the suspension to a 15 mL centrifuge tube and centrifuge at 150 × g for 4 min. Remove the supernatant.
4. Treat the spheres with 1 mL of 0.05% trypsin-EDTA for 5 min at 37 °C. Add 1 mL of 0.05% trypsin inhibitor (TI) and pipette repeatedly to neutralize the trypsin and dissociate the spheres into single cells.
5. Centrifuge at 150 × g for 5 min and remove the supernatant to obtain LGSCs in the pellet. Add 1 mL of LGSCM to resuspend the LGSC pellet.
6. Plate the single cells as described in steps 1.3.1 to 1.3.6.

3. LGSC differentiation

1. Procedure 1: Extend the culture time of LGSCs from 7 to 14 days with the LGSC culture system for random differentiation.
2. Procedure 2: Change the ratio of the matrix gel-LGSCM mixture from 1:1 to 1:2 at the beginning of the LGSC culture for the differentiation of ductal cells. Seed the LGSCs into the matrix for induction for 14 days (refer to step 1.3).
3. Procedure 3: After passage, replace the LGSCM with the LGSCM-10% fetal bovine serum (FBS) mixture for the differentiation of acinar cells. Induce differentiation for 14 days.

4. LG tissue dehydration

1. Obtain LG tissues (step 1.1.1) and rinse the LGs with 4 mL of sterile 10 mM PBS solution in a 6 cm dish for 2 min. Move the tissues to 10% formalin solution for fixation for 24 h.
2. Rinse the fixed tissues with 10 mM PBS for 2 min to remove the formalin, and transfer the tissue to a tissue embedding box. Put the embedding box into the automatic dehydrator.
3. Use the automatic dehydrator to dehydrate the tissues as follows: 70% ethanol, 2 h; 80% ethanol, 2 h; 90% ethanol, 30 min; 95% ethanol, 30 min; absolute ethanol, 30min; absolute ethanol, 2 h; absolute ethanol: 100% xylene (1: 1) mixture, 30 min; 100% xylene, 30 min; 100% xylene, 2 h; 100% xylene: paraffin (1: 1) mixture, 30 min; paraffin, 2 h; paraffin,3 h.

5. LG organoid/sphere dehydration

1. Obtain LG organoids/spheres (steps 2.1-2.3) in a 1.5 mL microcentrifuge tube and rinse the LG organoids/spheres with 1 mL of sterile 10 mM PBS solution for 2 min.
2. Centrifuge at 100 × g for 1 min and remove the supernatant.
3. Prepare the 4% paraformaldehyde (PFA) solution as follows: add 20 g of PFA to a mixture of 400 mL of 10 mM PBS and 40 µL of 1 M NaOH, shake the solution well, and heat it in a 65 °C water bath for 2 h until the PFA is completely dissolved. After cooling to room temperature, use 10 mM PBS to make up the volume to 500 mL and store it at 4 °C.
4. Add 1 mL of 4% PFA into the microcentrifuge tube with the organoid/sphere pellet and put the tube in a 4 °C refrigerator for at least 24 h for fixation.
5. After fixation, centrifuge at 100 × g for 1 min and remove the supernatant. Add 1 mL of 10 mM PBS into the microcentrifuge tube with the organoid/sphere pellet and gently mix by pipetting for 2 min to rinse off the PFA. Repeat this step twice.
6. Centrifuge at 100 × g for 1 min and remove the supernatant.
7. Heat embedding hydrogel to dissolve and add 50-60 µL of embedding hydrogel to the organoid/sphere pellet and mix. Pipette the mixture onto the parafilm in the form of a droplet and wait for 5 min for it to solidify at room temperature.
8. Dehydrate the gel with the organoids/spheres in a new 1.5 mL microcentrifuge tube as follows.
   1. Add 1 mL of 50% ethanol to the tube, wait for 30 min at room temperature, and remove the liquid from the tube by pipetting. Repeat this step by changing the ethanol concentration to 70%, 80%, 90%, 95% successively.
   2. Add 1 mL of absolute ethanol to the tube, wait for 30 min at room temperature, and remove the liquid from the tube by pipetting. Repeat this step.
   3. Add 1 mL of a mixture of 0.5 mL of absolute ethanol and 0.5 mL of 100% xylene to the tube, wait for 30 min at room temperature, and remove the liquid from the tube by pipetting.
   4. Add 1 mL of 100% xylene to the tube, wait for 30 min at room temperature, and remove the liquid from the tube by pipetting. Repeat this step.
      NOTE: Steps 5.8.5-5.8.6 must be performed in a metal bath at 65 °C.
   5. Add 1 mL of a mixture of 0.5 mL of paraffin and 0.5 mL of 100% xylene to the tube, wait for 30 min at 65 °C, and remove the liquid from the tube by pipetting.
   6. Add 1 mL of paraffin to the tube, wait for 30 min at 65 °C, and remove the liquid from the tube by pipetting. Repeat this step and extend the processing time to 1 h.

6. Paraffin embedding and sectioning

1. Paraffin embedding
   1. Before embedding, turn on the embedding machine and preheat it to melt the paraffin wax in the paraffin tank.
   2. Place the dehydrated tissue or organoid/sphere gel into the groove of the embedding iron box, and put the iron box into the paraffin of the embedding machine.
   3. Remove the plastic lid and place the plastic embedding box on the iron box to cover it. Move the embedding iron box to a cooling table.
   4. After the paraffin has condensed into blocks in the embedding box, remove it from the iron box and slice it directly or store it temporarily in a 4 °C refrigerator.
2. Paraffin sectioning
   1. Before paraffin slicing, preassemble the paraffin slicer and add distilled water to the sink of the slicer for preheating. Start slicing when the water temperature rises to 42 °C.
   2. Fix the sample on the sample slot of the paraffin slicer. Adjust the section thickness to 5 µm during slicing.
   3. Section the sample continuously. Fix the fully tiled section on the antislip slide in the slicer tank.
   4. After sectioning, place the slides affixed with sample tissue in a biochemical incubator at 37 °C for drying for 24 h. Temporarily store the slides in a refrigerator at 4 °C.

7. Hematoxylin and eosin staining

1. Melt the paraffin sections at 60 °C for 30 min, soak the sections in 100% xylene for 15 min, and repeat.
2. Treat the sections with absolute ethanol on a shaker for 5 min.
3. Treat the sections with 90% ethanol, 80% ethanol, and 70% ethanol on a shaker, each for 3 min.
4. Treat the sections with deionized water on a shaker for 5 min and 2 min successively.
5. Stain the sections on a wet box for 5 min with 4 mg/mL hematoxylin solution. Rinse the sections in running water for 10 min.
6. Agitate the sections on a shaker first with deionized water for 2 min and then with 0.5%-1% eosin for 1 min.
7. Agitate the sections with 70% ethanol, 80% ethanol, and 90% ethanol on a shaker for 3 min (each) successively. Agitate the sections with absolute ethanol on a shaker for 5 min.
8. Soak the sections in 100% xylene for 15 min and repeat the soaking.
9. Use a pipette or dropper to add 3-4 drops of neutral balsam to the slide, and cover it slowly with a cover slide. Air-dry the slides at room temperature.

8. Immunohistochemical (IHC) staining

1. Melt the paraffin sections at 60 °C for 30 min, soak the sections in 100% xylene for 10 min, and repeat this step twice.
2. Agitate the sections on a shaker first with absolute ethanol, 90% ethanol, and 80% ethanol for 2 min (each), successively, and then with deionized water for 3 min. Repeat the agitation with deionized water twice.
3. Agitate the sections on a shaker first with a mixture of 20 mL of 30% H₂O₂ and 180 mL of methanol for 10 min and then deionized water for 5 min. Repeat this step three times.
4. Transfer the sections to preboiled citric acid buffer (1 L deionized water with 3 g of Na₃C₆H₅O₇.2H₂O and 0.4 g C₆H₈O₇, pH 6.0), microwave for 10 min to keep them at subcritical boiling point, and cool at room temperature for 30 min. Agitate the sections with deionized water on a shaker for 5 min. Repeat this step three times.
5. Agitate the sections with 10 mM PBS on a shaker for 5 min, and repeat this step three times. Enclose the tissue area on the wet box with a water-repellant marker, add a drop of ready-to-use nonimmune goat serum to cover the samples, and place them at room temperature for 1 h.
6. Remove the serum, add primary antibody to the samples (see the Table of Materials), and incubate them overnight at 4 °C. Remove the primary antibody, agitate the sections with 10 mM PBS on a shaker for 5 min, and repeat this agitation step with 10 mM PBS three times.
7. Add secondary antibody (see the Table of Materials) to cover the samples and incubate them on a wet box for 30 min at room temperature. Agitate the sections with 10 mM PBS on a shaker for 5 min, and repeat the agitation step three times.
8. Add freshly prepared 0.03-0.05% 3,3'-diaminobenzidine (DAB) solution to cover the samples on the wet box and stain for 30-90 s. Rinse the sections with running water for 10 min.
   NOTE: Control the staining time by observing under a light microscope until yellow color appears.
9. Add 4 mg/mL hematoxylin solution to cover the samples, stain for 5 min on a wet box, and rinse the sections with running water for 10 min.
10. Agitate the sections on a shaker with 80% ethanol, 90% ethanol, and absolute ethanol for 2 min each, successively, and soak the sections in 100% xylene for 30 min.
11. Use a pipette or dropper to add 3-4 drops of neutral balsam to the slide, and cover it slowly with a cover slide. Air-dry the slides at room temperature.

9. Global immunofluorescence staining of organoids/spheres

NOTE: Collect the organoids/spheres fixed with 4% PFA solution in a 1.5 mL microcentrifuge tube (see steps 5.1 to 5.4). Perform the fluorescence labeling as follows.

1. Dehydrate the organoids/spheres by adding 1 mL of 30% sucrose solution to the tube and incubate it overnight in a refrigerator at 4 °C.
2. Add 100 µL of PBST solution (10 mM PBS solution with 0.1% Triton X-100) to the tube to rinse the organoids/spheres for 5 min, centrifuge the tube at 100 × g for 1 min, and collect the pellet. Repeat this step three times.
3. Add 0.5-1 mL of ready-to-use nonimmune goat serum to the tube and seal it at room temperature for 1 h. Centrifuge the tube at 100 × g for 1 min and collect the pellet.
4. Add several drops of diluted primary antibody to just cover the pellet and incubate in a refrigerator at 4 °C for 48 h. Centrifuge the tube at 100 × g for 1 min and collect the pellet.
5. Repeat step 9.2.
6. Add several drops of a fluorescent secondary antibody and 4',6-diamidino-2-phenylindole (DAPI) solution to the tube to just cover the pellet and incubate in a refrigerator at 4 °C for 24 h, avoiding light.
7. Repeat step 9.2, avoiding light.
8. Add 100 µL of PBST solution to the tube and store it temporarily in a 4 °C refrigerator, away from light. Observe and photograph the organoids/spheres using the light-sheet scanning microscope.

10. LGSC pLX-mCherry transfection

NOTE: Production of lentiviral particles must be performed in a biosafety cabinet and a clean bench at BSL2 biosafety level.

1. Culture the lentivirus packaging cell 293T in a 6-well plate with DMEM + 10% FBS at 37 °C, 5% CO₂ for 3-5 days to reach 80% cell confluency.
2. Transfect the lentivirus vector pLX-mCherry into LGSCs.
   NOTE: Reagent preparation is indicated for one well of a 6-well plate.
   1. Prepare two sterile 1.5 mL centrifuge tubes and add 250 µL of DMEM/F12 to each tube.
   2. Add 7.5 µL of transfection reagent to one tube and mix the reagent thoroughly by pipetting.
   3. Add 2 µg of pLX-mCherry plasmid without endotoxin and matching lentivirus packaging plasmid into another tube, and add the transfection reagent (2 µL/µg of plasmid).
   4. Mix the liquid in both centrifuge tubes and let the mixtures stand for 5 min at room temperature.
   5. Remove the culture medium of the 293T cells and add the mixture from step 10.2.4 to the 293T cells. Change the culture medium to fresh DMEM + 10% FBS after 8 h.
   6. After 48 h, collect the virus supernatant for the first time and filter it through a 0.45 µm filter. After 72 h, collect the virus supernatant for the second time and filter it through a 0.45 µm filter again.
      NOTE: Store both filtered supernatants on ice until lentivirus transduction.
3. Obtain the LGSCs from DED mice (NOD/ShiLtJ) (see step 1).
4. Add 1 mL of the precollected pLX-mCherry lentivirus supernatant to resuspend the cells.
5. Set the centrifuge tube on a shaker in the CO₂ incubator at 37 °C. Shake it at 100 rpm to maximize contact between the lentivirus and the cells. After 8 h, centrifuge the mixture at 250 × g for 4 min and remove the supernatant.
6. Add 1 mL of DMEM/F12 to resuspend the cell pellet. Use a cell counter to determine the cell number and seed a total of 1 × 10⁴ cells into 100 µL of matrix gel-LGSCM matrix (matrix gel: LGSCM = 1:1) in each well of a 24-well plate precoated with 20 µL of matrix gel-LGSCM matrix (see step 1.3.2).
7. After 7 days of culture (see step 1), select spheres exhibiting red fluorescence under a fluorescence microscope to expand the culture.

11. LGSC orthotopic transplantation

NOTE: All surgical operations are performed in an SPF operating room, and all surgical instruments are sterilized.

1. Obtain the LGSC spheres from ROSA26^mT/mG mice with red fluorescence (td-Tomato) or mCherry transfection cultured for 7 days (see step 1).
2. Cool a 1.5 mL microcentrifuge tube containing a 1:1 mixture of matrix gel and DMEM/F12 on ice before use. Digest the LGSC spheres into single cells and resuspend the cells at a density of 2 × 10⁶ cells/mL in the tube.
3. Anesthetize the NOD/ShiLtJ mice by intraperitoneal injection of pentobarbital sodium (50 mg/kg).
   NOTE: NOD/ShiLtJ mouse is an ideal model with idiopathic ADDED symptoms, including reduced tear secretion, inflammatory infiltration, and orbital ulceration.
4. After anesthesia, use saline or vet ointment on eyes to prevent dryness, and then use ophthalmic scissors to make a 5-8 mm cut in the skin behind the ear (near the eye) of the anesthetic mice to expose the LGs.
   NOTE: Iodophor should be strictly used for disinfection around the incision.
5. Inject 2 × 10⁴ cells into the left-side LG and inject the mixture without cells (see step 11.2) into the right-side LG as the control.
6. After injection, restore the LGs to their original positions with ophthalmic forceps and suture the wound. Feed the mice for 2 months and observe the effect of the treatment.
   NOTE: The cage cushion material must also be strictly sterilized after the operation, and the cushion material should be replaced once a day. After suturing the wound, tramadol can be selectively injected into the tail vein of mice at the standard dose of 2.5 mg/kg to achieve analgesia.
7. Anesthetize these mice 2 months after the experiment (see step 11.3). Film the symptoms of the ocular region.
   1. During anesthesia, look for the following symptoms: neck and limb muscle relaxation; deep, slow, and steady breathing; pupil narrowing; corneal reflex disappearance.
   2. During anesthesia and operation, keep the body temperature of mice at 37 °C. After surgery, add appropriate antibiotics to the drinking water for mice to reduce the risk of wound infection. Do not leave the mice unattended until they have regained sufficient consciousness to maintain sternal recumbency. Do not return the mice that have undergone surgery to the company of other mice until fully recovered.
   3. After filming the symptoms of the ocular region, open the ImageJ software, click on File | Open | Freehand selections, hold down the left mouse button, and select the area of orbital ulceration in the image. Click on Analyze | Measure to obtain the relative area of ulceration.
8. Put the phenol red cotton thread on the lateral canthus of anesthetic mice for 10 s; measure and record the length of the discolored part of the cotton thread. Euthanize the mice by cervical vertebra dislocation after tear measurement.
9. Dissect the mice and obtain the LGs for IHC analysis.

12. RNA isolation

NOTE: Before the experiment, precool the centrifuge to 4 °C and guarantee all reagents and consumables are free from RNAse contamination.

1. Collect LGSCs or LG fragments in a microcentrifuge tube. Add 1 mL of cell lysis buffer and fully lyse the cells or tissues by vortex oscillation.
2. Add 0.2 mL of chloroform, and let it stand at room temperature for 10 min after vortex oscillation for 1 min. Centrifuge for 15 min at 4 °C, 12,000 × g.
   NOTE: After centrifugation, the liquid is divided into three layers, and the RNA is in the uppermost transparent aqueous phase.
3. Carefully pipette the uppermost transparent aqueous phase and transfer it to a new 1.5 mL RNAse-free centrifuge tube.
4. Add an equal volume of isopropyl alcohol and mix gently. Let the mixture stand at room temperature for 10 min and then centrifuge for 15 min at 4 °C, 12,000 × g.
5. Remove the supernatant, and add 1 mL of 75% ethanol. Invert the tube to wash the pellet and centrifuge for 5 min at 4 °C, 7,500 × g. Repeat this step.
6. Remove the supernatant carefully and put the centrifuge tube in the ultraclean workbench to dry it for about 20 min.
   NOTE: Proceed to the next step when the white pellet becomes translucent. Carry out all operations on ice.
7. Add 20 µL of RNAse-free water to dissolve the pellet completely. Measure the RNA concentration using a spectrophotometer (see the Table of Materials) and store the RNA solution at -80 °C.

13. PCR

1. Reverse transcription reaction
   1. Add 1 µg of total RNA (calculate the volume of added RNA solution according to the concentration of the RNA solution) into the PCR reaction tube and incubate at 65 °C for 5 min for denaturation.
   2. Put it on ice for 1 min and then add enzyme-free water until the total volume reaches 12 µL. Add 4 µL of 4x DNA Master Mix and incubate it at 37 °C for 5 min.
   3. Put the tube on ice, add 4 µL of 5x RT Master Mix, and mix it gently. Set the following PCR settings: 37 °C for 15 min, 50 °C for 5 min, 98 °C for 5 min, 4 °C for 1 min.
   4. Store it at -20 °C or proceed to the next step after the reverse transcription reaction is completed.
2. PCR reaction
   1. Prepare the PCR reaction in the PCR tube as follows: 14.1 µL of enzyme-free water, 2 µL of dNTP, 2 µL of 10x Buffer, 0.8 µL of Primer (10 µM, 0.4 µL of Forward Primer, and 0.4 µL of Reverse Primer, refer to the Table of Materials), 1 µL of reverse transcription cDNA (refer to step 13.1) and 0.1 µL of Taq enzyme.
   2. Place the prepared PCR reaction in the PCR apparatus for PCR. Refer to the instructions of the Taq enzyme kit for the PCR procedure (see the Table of Materials).
3. Agarose gel electrophoresis
   1. Use an analytical balance to weigh 242 g of Tris and 37.2 g of Na₂EDTA·2H₂O and add them to a 1 L beaker. Add ~800 mL of deionized water and 57.1 mL of glacial acetic acid to the beaker, mix well, add deionized water to 1 L to obtain 50x TAE buffer, and store it at room temperature.
      NOTE: Dilute 50x TAE buffer with deionized water before use.
   2. Use an analytical balance to weigh 1.2 g of agarose and add it to a conical flask containing 80 mL of 1x TAE buffer. Heat it repeatedly in the microwave oven until completely dissolved.
   3. Cool the flask under running tap water until the solution temperature drops to 60 °C. Add 8 µL of nucleic acid stain, pour the solution into the gelatinizing tank after mixing well, place the comb, and let it stand at room temperature for 30 min.
   4. Pull out the comb and load the PCR products in the prepared agarose gel. Perform electrophoresis at 120 V for 30 min.
   5. Place the gel in the ECL Gel imaging system and photograph.

Representative Results

Establish 3D, serum-free culture system
In this study, LGSCM containing EGF, Wnt3A, FGF10, and Y-27632 for mouse LGSCs was developed, and LGSCs were successfully isolated and cultured by a 3D culture method (Figure 1A). A successful 3D, serum-free culture system of LGSCs from C57BL/6 mice, NOD/ShiLtJ mice, BALB/c mice, and ROSA26^mT/mG mice has been established using this method¹⁶. For a male mouse, 1.5-2 × 10⁶ cells were obtained from two LGs by dissociation. After one week of culture, 30-60 spheres were formed when seeding 1 × 10⁴ LG cells at the beginning of culture. Moreover, the cells cultured by this method expressed Epcam, Krt5, Krt14, P63, nestin, and other stem cell markers¹⁶, indicating that the cells obtained had the properties of LGSCs. Krt14 and Ki67 were expressed in all spheres formed by LGSCs cultured for 7 days (Figure 1B), indicating that the LGSCs had self-renewal capacity.

During a 7-day culture, LGSCs spheres reached a diameter of 100 µm. Hematoxylin and eosin (H&E) staining showed cellularity at day 7 (Figure 1C and Figure 1F). The enrichment factors of LGSCs obtained after 7 days of primary culture and subculture indicated that the LGSCs enriched by this method had strong proliferative ability (Figure 1D). In this system, LGSCs could be passaged over 40 times, and they still maintained stem cell characteristics (Figure 1E and Figure 1G). In conclusion, this paper describes a protocol to establish a 3D, serum-free culture system for LGSCs in vitro. The cells cultured by this protocol have continuous and stable proliferative ability.

Induce differentiation in vitro
The differentiation capacity of LGSCs in vitro was analyzed. When cultured for more than 7 days, LGSCs gradually lost growth ability, and the expression of AQP5, Ltf, Krt19, and other markers associated with differentiation increased, while the expression of Krt14 gradually decreased¹⁶. LGSCs were induced to form more buds by FBS and a low proportion of matrix gel (Figure 2A,B). Furthermore, H&E staining indicated that FBS could induce the spheres to produce more cavitating structures (Figure 2C).

The previous work suggested that decreasing matrix hardness promoted the differentiation of LGSCs into ductal-like organoids. The basal layer cells maintained the characteristics of stem cells expressing Krt14, while the basal upper layer cells differentiated into duct-like structures with cavities and expressed Krt19. In addition, the addition of FBS could induce the differentiation of LGSCs into acinar-like organoids, which maintained the characteristics of stem cells with high nuclear/cytoplasmic ratio. Some differentiated acinar-like cells expressed high levels of AQP5 with low nuclear/cytoplasmic ratio¹⁶.

 Repair LGSCs  in vivo
Based on the above experiments, the ability of LGSCs to repair damaged LGs was explored by orthotopic injection. After orthotopic injection of ROSA-LGSCs in NOD/ShiLtJ mice, new lacrimal lobules were formed adjacent to the LGs (Figure 3A–C). Most of the lobules were composed of mature acinar cells with high expression of AQP5, and there was intralobular duct formation with low AQP5 expression (Figure 3D–F). After injection of ROSA-LGSCs for 8 weeks, the decay around the orbit of the recipients was measured. The measurements indicated that the injection of LGSCs reduced the decay area by ~60% (Figure 3G, H). The dissection showed that the LG volume increased after injection for 10 weeks (Figure 3I). The amount of tear secretion on the ROSA-LGSCs injection side was higher than on the control side but lower than in wild-type mice (Figure 3J). These results indicate that the cells harvested by this culture system have the characteristics of LGSCs and can be used for stem cell therapy in mice with ADDED and xerophthalmia.

Figure 1: Isolation and characterization of LGSCs. (A) The strategy of LGSC primary and continuous passage culture. (B) Immunofluorescence staining of LGSCs at day 7. LGSCs express epithelial cell marker E-cadherin (red), stem cell marker Krt14 (red), proliferative cell marker Ki67 (red). Counterstain, DAPI (blue). (C) The morphology of LGSCs in culture for 1, 3, 5, and 7 days.(D) Relative enrichment factor of LGSC culture in primary culture and subculture. Relative enrichment factor is the ratio of the total number of cells obtained after 7 days of culture to the number of cells seeded in culture. ***P < 0.01. (E) Transcription of adult stem/progenitor cell markers of the mouse LG and different passage LGSCs (P1, P10, P20, and P40). (F) The morphology (left) and H&E staining (right) of LGSCs in primary culture at day 7. (G) LGSCs cultured in different passages (P1, P10, P20, and P40). Scale bars = 50 µm (B, F, G), 100 µm (C). Abbreviations: LG = lacrimal gland; LGSCs = LG stem cells; DAPI = 4',6-diamidino-2-phenylindole;; NC = negative control; TE = trypsin-EDTA; H&E = hematoxylin and eosin. Please click here to view a larger version of this figure.

Figure 2: Differentiation of LGSCs in vitro. (A,B) Morphology of LGSCs cultured in normal medium or differentiation medium. (A) LGSCs cultured for 10 days in P10 (left: normal medium, right: FBS-containing medium). (B) LGSCs cultured for 14 days in P31 (left: normal medium, right: medium with 1/3^rd matrix gel). (C) H&E staining of the LGSCs cultured for 14 days (top: normal medium, bottom: FBS-containing medium). Scale bars = 100 µm (A), 200 µm (B), 50 µm (C). Abbreviations: LG = lacrimal gland; LGSCs = LG stem cells; H&E = hematoxylin and eosin; FBS = fetal bovine serum. Please click here to view a larger version of this figure.

Figure 3: Engraftment of LGSCs allotransplantation and relief of ADDED symptoms. (A–F) IHC staining of NOD/ShiLtJ LG transplanted with 7-day cultures of ROSA-LGSCs after 8 weeks. Use the left and right sides of the same mouse as the experimental group and the control group. (A–C) IHC staining with anti-td-Tomato antibody; (D–F) IHC staining with anti-AQP5 antibody; (A, D) LG injected with vehicle (1:1 mixture of matrix gel and DMEM/F12), (B, E) LG injected with ROSA-LGSCs, (C, F) the magnified images of the black squares in B, E (red arrow, intralobular duct). (G, H) The condition of the NOD/ShiLtJ mouse eye orbit after injection of ROSA-LGSCs at 8 weeks. The injection of LGSCs significantly alleviates the decay around the eye orbit. (I) LGs of the NOD/ShiLtJ mouse at 10 weeks (left: LG from the cell-injected side, right: LG from the control side). (J) Tear volume of wild-type and NOD/ShiLtJ mice transplanted with 7-day cultures of ROSA-LGSCs after 8 weeks. The tear volume of ROSA-LGSC-injected LGs is higher than that of the control LGs but significantly lower than that of WT LGs. n = 3; NOD/ShiLtJ mice, n = 4; ***P < 0.01; *P < 0.05. Scale bars = 50 µm (A–F). Abbreviations: LG = lacrimal gland; LGSCs = LG stem cells; IHC = immunohistochemical; WT = wild-type; ADDED = aqueous-deficient dry eye disease. Please click here to view a larger version of this figure.

Discussion

There are well-established methods for the isolation and in vitro culture of lacrimal stem cells for lacrimal stem cell culture and LG injury repair. Shatos et al.¹⁷ and Ackermannet al.⁶ successfully cultured and subcultured lacrimal stem cells of rats and mice by 2D culture methods, respectively, making it possible to transplant lacrimal stem cells for the treatment of ADDED. Studies on stem cells¹⁸ and mesenchymal stem cells^19,20 of LGs cultured in 2D showed that the transplantation of these cells could relieve the symptoms of ADDED to some extent. By fluorescence-activated cell sorting, Gromovaet al.² selected stem cells expressing LG progenitor cell markers from mouse LGs and differentiated them into ducts and acini in vitro, successfully realizing the differentiation of adult stem cells into functional cells of LGs. It was also shown that transplantation of a sufficient number of stem cells could alleviate ADDED symptoms in mice.

To meet the needs of stem cell enrichment and eliminate serum dependence in existing lacrimal stem cell culture methods, the serum-free culture system of lacrimal stem cells in this protocol was established based on previously published research and organoid 3D culture technology²¹. Thus, this system is expected to promote clinical research on lacrimal stem cells. In this protocol, the critical steps include primary culture, subculture and expansion of LGSCs, and in situ transplantation of LGSCs into injured LGs in mice.

Primary culture is the basis for obtaining LGSCs. It is necessary to maintain sterile conditions during primary culture. The well is precoated with matrix-gel to avoid adherent growth of cells at the bottom of the cell culture well. When using matrix-gel, it is necessary to follow the manufacturer's instructions, and always keep it in the liquid state before addition to the well to avoid matrix-gel loss during the experiment and the uneven matrix-gel in the culture.

The number of seeded cells in primary culture is 10,000 cells/well. In practice, the number of seeded cells can be increased if appropriate growth space and nutrient supply of cells are ensured. Subculture is an important step to purify and enrich stem cells. After passage, LGSCs in P1 generation formed more spheres, and there were more P1 generation cells than the P0 generation. This indicates that LGSCs with proliferative ability have been enriched in this system.

When LGSCs were cultured in this 3D system over 10 days, 0.05% trypsin-EDTA was sometimes not enough to fully digest the organoids into single cells during the passage. This problem was solved by extending the digestion time appropriately. In situ injection therapy is a necessary procedure to verify the clinical value of LGSCs. Due to the small size and the thin and loose tissues of LGs in mice, cells are always lost from the injection site if the cell suspension is prepared in normal saline or 10 mM PBS for injection. Therefore, it is recommended to mix the cell suspension with matrix-gel for injection. Because the matrix-gel used in this system solidifies at temperatures above 10 °C, cells can colonize readily when injected into the LGs. The mixture of cells and matrix-gel must always be kept on ice before injection, and the injection performed quickly.

In addition to isolating LGSCs from normal mice, adult LGSCs from ADDED mice were successfully isolated and cultured for the first time using this protocol¹⁶. However, this system still has deficiencies and unresolved problems. First, the matrix-gel used is derived from mice^22,23, which may cause rejection reactions in the human body and, therefore, has limited clinical applicability. It is necessary to improve the culture system by finding appropriate synthetic gels to replace the matrix gel.

Second, the differentiation strategy in this protocol needs to be improved. Instead of extending the culture time for differentiation²¹ or adding serum in the culture medium, adding specific growth factors and changing specific environmental conditions for directional induction are expected to give the desired results. It is necessary to further explore the mechanism of the maintenance and differentiation of LGSCs by elucidating the signaling pathways causing differentiation. Furthermore, previous studies have found that myoepithelial cells cultured in vitro also express stem cell genes, such as Nestin, Musashi, and Pax6, indicating that myoepithelial cells also have stem cell characteristics¹⁷.

This study did not pay any attention to myoepithelial cells and, hence, did not verify whether myoepithelial cells exist in the LG organoids by identifying specific expression markers of myoepithelial cells. Due to the limitation of the culture conditions, myoepithelial cells could not be induced or that their number was too small to be observed. The culture time can be extended to observe whether the organoids further differentiate into myoepithelial cells, or focus on myoepithelial cells in future studies of induction differentiation and system improvement.

In conclusion, this protocol provides a method for studying LGSCs for the development, repair, and regeneration of LGs. The differentiation of LGSCs in vitro could be the basis of future in vitro regeneration of LGs, while the isolation and culture of LGSCs can solve the problem of rejection in stem cell allotransplantation. This method provides an important basis for clinical individualized treatment of xerophthalmia with LGSCs.

Materials

Animal(Mouse)
Bal B/C	Model Animal Research Center of Nanjing University
C57 BL/6J	Laboratory Animal Center of Sun Yat-sen University
NOD/ShiLtJ	Model Animal Research Center of Nanjing University
ROSA26mT/mG	Model Animal Research Center of Nanjing University
Equipment
Analytical balance	Sartorius
Automatic dehydrator	Thermo
Blood counting chamber	BLAU
Cell Counter	CountStar
CO2 constant temperature incubator	Thermo
ECL Gel imaging system	GE healthcare
Electric bath for water bath	Yiheng Technology
Electrophoresis apparatus	BioRad
Fluorescence quantitative PCR instrument	Roche
Frozen tissue slicer	Lecia
Horizontal centrifuge	CENCE
Inverted fluorescence microscope	Nikon
Inverted microscope	Olympus
Laser lamellar scanning micrograph	Carl Zeiss
Liquid nitrogen container	Thermo
Low temperature high speed centrifuge	Eppendorf
Micropipettor	Gilson
Microwave oven	Panasonic
Nanodrop ultraviolet spectrophotometer	Thermo	measure RNA concentration
Paraffin slicing machine	Thermo
PCR Amplifier	Eppendorf
pH value tester	Sartorius
4 °C Refrigerator	Haier
Thermostatic culture oscillator	ZHICHENG
Tissue paraffin embedding instrument	Thermo
-80°C Ultra-low temperature refrigerator	Thermo
-20°C Ultra-low temperature refrigerator	Thermo
Ultra pure water purification system	ELGA
Reagent
Animal Experiment
HCG	Sigma	9002-61-3
PMSG	Sigma	14158-65-7
Pentobarbital Sodium	Sigma	57-33-0
Cell Culture
B27	Gibco	17504044
Collagenase I	Gibco	17018029
Dispase	BD	354235
DMEM	Sigma	D6429
DMEM/F12	Sigma	D0697
DMSO	Sigma	67-68-5
EDTA	Sangon Biotech	A500895
Foetal Bovine Serum	Gibco	04-001-1ACS
GlutaMax	Gibco	35050087
Human FGF10	PeproTech	100-26
Matrigel (Matrix gel)	BD	356231
Murine Noggin	PeproTech	250-38
Murine Wnt3A	PeproTech	315-20
Murine EGF	PeproTech	315-09
NEAA	Gibco	11140050
N2	Gibco	17502048
R-spondin 1	PeproTech	120-38
Trypsin Inhibitor (TI)	Sigma	T6522	Derived from Glycine max; can inhibit trypsin, chymotrypsin, and plasminase to a lesser extent. One mg will inhibit 1.0-3.0 mg of trypsin.
Trypsin	Sigma	T4799
Y-27632	Selleck	S1049
HE staining & Immunostaining
Alexa Fluor 488 donkey anti-Mouse IgG	Thermo	A-21202	Used dilution: IHC) 2 μg/mL, (IF) 0.2 μg/mL
Alexa Fluor 488 donkey anti-Rabbit IgG	Thermo	A-21206	Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL
Alexa Fluor 568 donkey anti-Mouse IgG	Thermo	A-10037	Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL
Alexa Fluor 568 donkey anti-Rabbit IgG	Thermo	A-10042	Used dilution: (IHC) 2 μg/mL, (IF) 4 μg/mL
Anti-AQP5 rabbit antibody	Abcam	ab104751	Used dilution: (IHC) 1 μg/mL, (IF) 0.1 μg/mL
Anti-E-cadherin Rat antibody	Abcam	ab11512	Used dilution: (IF)  5 μg/mL
Anti-Keratin14 rabbit antibody	Abcam	ab181595	Used dilution: (IHC) 1 μg/mL, (IF) 2 μg/mL
Anti-Ki67 rabbit antibody	Abcam	ab15580	Used dilution: (IHC) 1 μg/mL, (IF) 1 μg/mL
Anti-mCherry mouse antibody	Abcam	ab125096	Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL
Anti-mCherry rabbit antibody	Abcam	ab167453	Used dilution: (IF)  2 μg/mL
C6H8O7	Sangon Biotech	A501702-0500
Citric Acid	Sangon Biotech	201-069-1
DAB Kit (20x)	CWBIO	CW0125
DAPI	Thermo	62248
Eosin	BASO	68115
Fluorescent Mounting Medium	Dako	S3023
Formalin	Sangon Biotech	A501912-0500
Goat anti-Mouse IgG antibody (HRP)	Abcam	ab6789	Used dilution: 2 μg/mL
Goat anti-Rabbit IgG antibody(HRP)	Abcam	ab6721	Used dilution: 2 μg/mL
Hematoxylin	BASO	517-28-2
Histogel (Embedding hydrogel)	Thermo	HG-400-012
30% H2O2	Guangzhou Chemistry	KD10
30% Hydrogen Peroxide Solution	Guangzhou Chemistry	7722-84-1
Methanol	Guangzhou Chemistry	67-56-1
Na3C6H5O7.2H2O	Sangon Biotech	A501293-0500
Neutral balsam	SHANGHAI YIYANG	YY-Neutral balsam
Non-immunized Goat Serum	BOSTER	AR0009
Paraffin	Sangon Biotech	A601891-0500
Paraformaldehyde	DAMAO	200-001-8
Saccharose	Guangzhou Chemistry	57-50-1
Sodium citrate tribasic dihydrate	Sangon Biotech	200-675-3
Sucrose	Guangzhou Chemistry	IB11-AR-500G
Tissue-Tek O.T.C. Compound	SAKURA	SAKURA.4583
Triton X-100	DINGGUO	9002-93-1
Xylene	Guangzhou Chemistry	128686-03-3
RT-PCR & qRT-PCR
Agarose	Sigma	9012-36-6
Alcohol	Guangzhou Chemistry	64-17-5
Chloroform	Guangzhou Chemistry	865-49-6
Ethidium Bromide	Sangon Biotech	214-984-6
Isopropyl Alcohol	Guangzhou Chemistry	67-63-0
LightCycler 480 SYBR Green I Master Mix	Roche	488735200H
ReverTra Ace qPCR RT Master Mix	TOYOBO	–
Taq DNA Polymerase	TAKARA	R10T1
Goldview (nucleic acid stain)	BioSharp	BS357A
TRIzol	Magen	R4801-02
Vector Construction & Cell Transfection
Agar	OXID	–
Ampicillin	Sigma	69-52-3
Chloramphenicol	Sigma	56-75-7
Endotoxin-free Plasmid Extraction Kit	Thermo	A36227
Kanamycin	Sigma	25389-94-0
Lipo3000 Plasmid Transfection Kit	Thermo	L3000015
LR Reaction Kit	Thermo	11791019
Plasmid Extraction Kit	TIANGEN	DP103
Trans5α Chemically Competent Cell	TRANSGEN	CD201-01
Trytone	OXID	–
Yeast Extract	OXID	–
Primers and Sequence	Company
Primer: AQP5 Sequence: F: CATGAACCCAGCCCGATCTT R: CTTCTGCTCCCATCCCATCC	Synbio Tech
Primer: β-actin Sequence: F: AGATCAAGATCATTGCTCCTCCT R: AGATCAAGATCATTGCTCCTCCT	Synbio Tech
Primer: Epcam Sequence: F: CATTTGCTCCAAACTGGCGT R: TGTCCTTGTCGGTTCTTCGG	Synbio Tech
Primer: Krt5 Sequence: F: AGCAATGGCGTTCTGGAGG R: GCTGAAGGTCAGGTAGAGCC	Synbio Tech
Primer: Krt14 Sequence: F: CGGACCAAGTTTGAGACGGA R: GCCACCTCCTCGTGGTTC	Synbio Tech
Primer: Krt19 Sequence: F: TCTTTGAAAAACACTGAACCCTG R: TGGCTCCTCAGGGCAGTAAT	Synbio Tech
Primer: Ltf Sequence: F: CACATGCTGTCGTATCCCGA R: CGATGCCCTGATGGACGA	Synbio Tech
Primer: Nestin Sequence: F: GGGGCTACAGGAGTGGAAAC R: GACCTCTAGGGTTCCCGTCT	Synbio Tech
Primer: P63 Sequence: F: TCCTATCACGGGAAGGCAGA R: GTACCATCGCCGTTCTTTGC	Synbio Tech
Vector
pLX302 lentivirus no-load vector	Addgene
pENRTY-mCherry	Xiaofeng Qin laboratory, Sun Yat-sen University