High-Speed Magnetic Tweezers for Nanomechanical Measurements on Force-Sensitive Elements

Summary

Here, we describe a high-speed magnetic tweezer setup that performs nanomechanical measurements on force-sensitive biomolecules at the maximum rate of 1.2 kHz. We introduce its application to DNA hairpins and SNARE complexes as model systems, but it will be also applicable to other molecules involved in mechanobiological events.

Abstract

Single-molecule magnetic tweezers (MTs) have served as powerful tools to forcefully interrogate biomolecules, such as nucleic acids and proteins, and are therefore poised to be useful in the field of mechanobiology. Since the method commonly relies on image-based tracking of magnetic beads, the speed limit in recording and analyzing images, as well as the thermal fluctuations of the beads, has long hampered its application in observing small and fast structural changes in target molecules. This article describes detailed methods for the construction and operation of a high-resolution MT setup that can resolve nanoscale, millisecond dynamics of biomolecules and their complexes. As application examples, experiments with DNA hairpins and SNARE complexes (membrane-fusion machinery) are demonstrated, focusing on how their transient states and transitions can be detected in the presence of piconewton-scale forces. We expect that high-speed MTs will continue to enable high-precision nanomechanical measurements on molecules that sense, transmit, and generate forces in cells, and thereby deepen our molecular-level understanding of mechanobiology.

Introduction

Cells actively sense and respond to mechanical stimuli. In doing so, many biomolecules display force-dependent properties that enable dynamic structural changes. Well-appreciated examples include mechanosensitive ion channels and cytoskeletal elements that provide the cells with key mechanical information from their surrounding environment.

In addition, molecules that show a unique force-bearing nature can also be considered mechanosensitive in a broader sense. For example, local formation and melting of nucleic acid duplexes, as well as higher-order structures such as G-quadruplexes, play crucial roles in replication, transcription, recombination, and more recently, genome editing. Moreover, some neuronal proteins involved in synaptic communications perform their functions by generating physical forces that exceed the levels of typical intermolecular interactions. No matter which example one studies, investigating nanomechanics of the involved biomolecules with high spatiotemporal precision will prove highly useful in revealing molecular mechanisms of the associated mechanobiological processes^1,2,3.

Single-molecule force spectroscopy methods have served as powerful tools to examine the mechanical properties of biomolecules^2,4,5,6. They can monitor structural changes in nucleic acids and proteins concurrently with the application of force, thereby examining force-dependent properties. Two well-known setups are optical tweezers and magnetic tweezers (MTs), which employ micron-sized beads to manipulate molecules^5,6,7,8. In these platforms, polystyrene (for optical tweezers) or magnetic beads (for MTs) are tethered to target molecules (e.g., nucleic acids and proteins) via molecular "handles", typically made of short fragments of double-stranded DNA (dsDNA). The beads are then moved to exert force and imaged to track their locations that report on structural changes in target molecules. Optical and magnetic tweezers are largely interchangeable in their applications, but there exist important differences in their approaches to controlling force. Optical tweezers are intrinsically position-clamp instruments that trap beads in position, because of which the applied force fluctuates when a target construct undergoes shape changes; extension increase, such as from unfolding, loosens the tether and reduces tension, and vice versa. Although active feedback can be implemented to control the force in optical tweezers, MTs in contrast naturally operate as a force-clamp device, taking advantage of stable, far-field magnetic forces by permanent magnets, which can also withstand environmental perturbation.

Despite their long history and simple design, MTs have lagged behind optical tweezers in their applications to high-precision measurements, largely because of technical challenges in fast bead tracking. Recently, however, several groups have jointly led a multi-faceted improvement of both hardware and software for MT instruments^{2,9,10,11,12,13,14,15,16,17,18,19}. In this work, we introduce an example of such a setup running at 1.2 kHz and describe how to use it to perform nanomechanical measurements on force-sensitive biomolecules. As model systems, we employ DNA hairpins and neuronal SNARE complexes and examine their fast, structural changes in the piconewton regime. DNA hairpins exhibit simple two-state transitions in a well-defined force range^20,21, and therefore serve as toy models to verify the performance of a tweezer setup. As the SNARE proteins assemble into a force-sensitive complex that drives membrane fusion²², they have also been extensively studied by single-molecule force spectroscopy^14,23,24,25. Standard approaches to analyzing data and extracting useful information on thermodynamics and kinetics are presented. We hope this article can facilitate the adoption of high-precision MTs in mechanobiological studies and motivate readers to explore their own force-sensitive systems of interest.

Protocol

All materials and equipment described in this protocol are listed in the Table of Materials. LabVIEW software to operate the high-speed MT setup described below, as well as the MATLAB scripts to analyze sample data, are deposited on GitHub (https://github.com/ShonLab/Magnetic-Tweezers) and publicly available.

1. Construction of apparatus

NOTE: The general principle of the high-speed MT construction is similar to standard, conventional MT systems, except for the use of a high-speed complementary metal oxide semiconductor (CMOS) camera and a high-power, coherent light source (Figure 1). Refer to other sources for more descriptions of standard MT instruments^5,26,27.

1. Set up an inverted microscope on an anti-vibration optical table. Install a high-speed CMOS camera and a frame grabber.
2. Build a translation stage for manipulating magnets in 3D. Mount a motorized linear stage (>20 mm travel) vertically on top of a manual XY stage.
   NOTE: The vertical movement controls force, whereas the XY stage is for the manual alignment of magnets to the optical axis for the initial construction of the setup.
3. Install a rotary stepper motor and a belt and pulley system for rotating magnets.
   NOTE: The belt transmits the rotary motion between the motor shaft and magnets that are a few centimeters apart. The rotation of magnets is internal to the translational manipulation.
4. Mount the magnets. Use an acrylic holder (ordered from a manufacturing company; see Supplemental Figure S1) that can tightly house two identical magnets in parallel, with a well-defined 1 mm gap between the magnets (Figure 1B). To utilize the maximum force obtainable with a given pair of magnets, adjust the vertical position of the translation stage so that the bottom surface of the magnets aligns with the sample plane when it is moved to the lowest position.
   NOTE: Refer to Lipfert et al. for more information on the holder design and configuration of magnets²⁸. The height and orientation of magnets are controlled by the LabVIEW software in conjunction with data acquisition.
5. Viewing with a low-magnification objective lens, align the magnets to the center of the field of view. Check that rotating the magnets does not cause a large displacement of the center of the magnet pair.
   NOTE: If the midpoint between the magnets rotates about the axis of rotation, it is likely that the magnets are off-centered due to an imperfect holder. A small level of misalignment relative to the gap size is tolerable, as the magnet rotation is only for checking tethers and applying torques in specific applications.
6. Install a superluminescent diode (SLD) for the illumination of beads. Pass the beam through the 1 mm gap between the two magnets. Make sure that the beam is properly collimated to fit in the gap and the illumination is not shadowed by the magnets.
7. Install a piezo lens scanner on the nosepiece and mount a 100x oil-immersion objective lens (numerical aperture [NA]: 1.45) for bead tracking. To avoid potential artifacts in tracking results, make sure that the illumination is maintained uniformly when the magnets are moved. Finally, adjust the light level to the maximum brightness without saturating pixels.
   ​NOTE: For the comparison of different light sources for the high-speed tracking of beads, refer to Dulin et al.²⁹.

2. Calibration of magnetic force

1. Using polymerase chain reaction (PCR; see Table 1), prepare 5 kbp dsDNA fragments (using Primer B, Primer Z_5k, and λ-DNA) that are labeled with biotin on one end (for surface attachment) and azide on the other end (for bead attachment).
2. Following section 6, prepare a flow cell with the 5 kbp molecules.
3. Following section 7, identify a good bead-tether construct by verifying its extension and rotation. In particular, make sure to choose a bead with a minimal rotational trajectory (i.e., with a radius <200 nm) to minimize the bead height offset due to off-centered attachment^30,31. Once a good tether is identified, start bead tracking, referring to section 9.
4. If the setup is new, characterize its noise and stability for reliable high-resolution measurements. Place the magnet ~3 mm from the flow cell surface (to apply >10 pN and suppress the Brownian motion of a bead), track the z-position of the bead at 1.2 kHz, and compute the Allan deviation (AD) from the z-coordinate time series^32,33 (Figure 2C). Check that AD values of a few nanometers are achievable in the high-speed regime (<0.1 s), and that differential tracking (magnetic bead position relative to a reference bead) reduces AD in the longer timescale.
   NOTE: We typically obtain an AD of <3 nm at the maximum rate (1.2 kHz or 0.83 ms resolution), and the AD keeps decreasing at least up to 10 s, implying a minimal drift. Others have reported similar values on similar setups^{9,10,11,12,34}.
5. With magnets in the resting position (F ~ 0 pN), record the x- and y-coordinates of the tethered bead at 1.2 kHz. Record the position for a sufficiently long period (that is, sufficiently longer than the characteristic relaxation time of fluctuation³⁵) so that the Brownian motion is sufficiently sampled.
   NOTE: Here, the x-direction is along the direction of the magnetic field, whereas the movement in y represents the transverse motion perpendicular to the field.
6. Move the magnets closer to the flow cell and repeat the bead-position measurements until the magnets gently touch the top of the flow cell. Move in large steps (e.g., 1-2 mm) when the magnets are more than 7 mm away from the sample plane (since the applied force increases slowly in the far field of magnets), but reduce the step size gradually (e.g., 0.1-0.5 mm) as they approach closer for finer calibration at higher force levels (Figure 2B).
7. Calculate the force at each magnet position, d, using either of the two alternative methods (a MATLAB script "force calibration.m" including both methods is provided; see Supplemental File 1).
   1. Measure the variance of the bead's y-coordinates, (Figure 2D) and the mean z-position of the bead relative to the lowest position (Figure 2B, bottom). Then, use equation (1)^7,27,36 to estimate the force (with a fixed bead radius R = 1,400 nm and thermal energy k_RT = 4.11 pN∙nm):
          (1)
   2. Alternatively, calculate the power spectral density (PSD) of the y-coordinates, S_y (Figure 2E). Determine the applied force F by fitting a double-Lorentzian model³⁷ to the measured S_y using equation (2).
          (2)
      Here, , R is bead radius, γ_y and γ_φ are the translational and rotational drag coefficients, respectively (estimated from the Stokes-Einstein equation), k_RT is the thermal energy, f₊ and f_- are two characteristic frequencies obtained using equation (3).
      (3)
      NOTE: Since the tether extension L is a function of force that follows the well-established worm-like chain (WLC) model, the above expressions leave F as the only fitting parameter (we fix R to be 1,400 nm for simplicity because it is shared across all force levels and the exact value does not influence the results appreciably). When necessary, motion blur and aliasing from camera-based image acquisition must be considered^38,39, but this effect is negligible in our high-speed measurements above 1 kHz with 5 kbp tethers.
8. Repeat steps 2.4-2.7 for a few more constructs. Probe three to five different beads to average out the force variability among the magnetic beads.
   NOTE: Force variation among the magnetic beads in use should be considered to determine the proper number of constructs for averaging. This variability is small but can lead to more than 1 pN of error in the measured force, even for commercial products³¹. For most applications, where the absolute determination of the forces involved is not crucial, averaging the calibration results of three to five beads is generally sufficient. An alternative approach to account for this variation is to measure the force with individual tethers at the beginning of the experiment, which can be time-consuming. Another option is to embed hairpin structures that unzip at known force levels in each construct³¹.
9. Plot the measured force as a function of magnet distance and fit a double exponential function to the data (Figure 2F) using equation (4).
       (4)
   Here, F₀ (baseline), A₁ and A₂ (amplitudes), and d₁ and d₂ (decay constants) are fitting parameters. Make sure that the force values from the two methods, as well as the resulting double-exponential fits, largely agree (Figure 2F,G).
   NOTE: To confirm that force calibration is conducted properly, verify the force-extension relationship of the probed constructs by plotting the extension versus the measured force.
10. To correct for the bead height offset z_off resulting from force-dependent tilting of the magnetic beads^30,31, estimate z_off from the lateral offset x_off, considering the geometry of an off-centered tether with a bead radius using equation (5), and apply the values to the measured extension values. This step is implemented in the MATLAB script "force calibration.m" (lines 252-254).
        (5)
    NOTE: Although this correction makes small changes to extension, especially for the beads with a small radius of rotation (<200 nm), this offset often critically affects the elastic response, as seen in the change from Figure 2H to Figure 2I^30,31.
11. Check the persistence length L_p by fitting an extensible WLC model to the data using equation (6).
        (6)
    Here, L₀ is the contour length (1.7 µm for 5 kbp) and K₀ is the modulus for enthalpic stretching.
    NOTE: Although the L_p of dsDNA is well-accepted to be 40-50 nm in a typical buffer such as phosphate-buffered saline (PBS), the WLC formula applied to short molecules (<5 kbp) systematically underestimates L_p as L₀ decreases^31,40. This is because the classical WLC model presumes a polymer whose chain length is sufficiently longer than its persistence length. Here, we obtained L_p = 40 ± 3 nm for the 5 kbp construct (Figure 2H), and the extension correction further yielded a homogeneous K₀ of 1,100 ± 200 pN (Figure 2I). Applying a finite WLC model^31,40, as well as a correction for non-Gaussianity in extension distribution⁴¹, will slightly increase L_p.
12. Once the force calibration is verified, apply the obtained fitting parameters of the double-exponential model to the provided LabVIEW software (Supplemental File 2) and wait for the software to compute the current force in real time from motor readings (i.e., magnet position). Since an analytic expression for the inverse function d(F) is not available, prepare a lookup table of d versus F in 0.1 pN steps by numerical estimation of for the d target force levels. Store this table in the software as well to command the force control.

3. Synthesis of DNA hairpins

NOTE: DNA hairpin constructs for MT experiments are prepared by PCR amplification of a 510 bp region in λ-DNA with two custom primers, one of which contains a hairpin structure on its 5′-end (Figure 3A). In this way, a hairpin motif is placed at one end of the PCR product.

1. Prepare the primers.
   1. Forward primer: Primer B_hp that is 5′-biotin-labeled for glass surface attachment and binds to λ-DNA. This primer contains a hairpin motif with an 8 bp stem and a 6 nt loop, 5′ to the λ-binding region.
   2. Reverse primer: Primer Z_hp that is 5′-azide-labeled for magnetic bead attachment and binds to λ-DNA 1 kbp away from the forward primer.
2. Set up and run the PCR with λ-DNA (template), nTaq polymerase, and standard PCR conditions (see Table 1). Clean up the product with a commercial purification kit.
3. Measure the DNA concentration by UV absorption at 260 nm (A260) and perform agarose gel electrophoresis (2% gel) (see Table 2) to verify the product size. A typical yield is ~35 µL of ~600 nM solution.

4. Preparation of SNARE proteins

NOTE: Neuronal SNARE complexes are assembled by combining three purified rat proteins expressed from E. coli: VAMP2/synaptobrevin-2, syntaxin-1A, and SNAP-25 (Figure 3B). To facilitate their assembly, syntaxin and SNAP-25 are co-expressed with a VAMP2 fragment (lacking the N-terminal region; termed "ΔN-VAMP2") into a structure called the "ΔN-complex", and then mixed with full-length VAMP2 after DNA handle attachment to form full complexes.

1. Prepare plasmids containing cDNA for the expression of SNARE proteins (DNA sequences for all plasmids are given in the Table of Materials).
   1. Prepare 6×His-tagged VAMP2 lacking the transmembrane domain (2-97; L32C/I97C for disulfide linkages) cloned into a pET28a vector.
   2. Prepare syntaxin-1A lacking the Habc and the transmembrane domain (191-267, I202C/I266C substitutions for disulfide linkages) cloned together with 6×His-tagged ΔN-VAMP2 (49-96) into a pETDuet-1 vector.
   3. Prepare the full-length SNAP-25 isoform b (2-206, all C to A) cloned into a pET28a vector. This will be used for preparing ΔN complexes.
   4. Prepare the 6×His-tagged full-length SNAP-25 isoform b (1-206, all C to A) cloned into a pET28a vector for direct addition to the MT assay buffer to reassemble the SNARE complexes after unfolding.
2. Prepare two tubes of Rosetta (DE3) E. coli cells. Transform one group with VAMP2 plasmids (from step 4.1.1), one with both syntaxin-1A/ΔN-VAMP2 and untagged SNAP-25 plasmids (from steps 4.1.2 and 4.1.3) for expressing the ΔN-complex, and the other with His-tagged SNAP-25 plasmids (from step 4.1.4).
3. Transfer the transformed cells into Luria-Bertani broth (LB) with appropriate antibiotics (here, kanamycin and chloramphenicol for VAMP2 and His-tagged SNAP-25; kanamycin, chloramphenicol, and ampicillin for ΔN-complex). Grow them at 37 °C in a shaking incubator (220 rpm) until the optical density (OD) of the broth reaches 0.7-0.9.
4. Add 1 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) to induce protein expression and incubate the cells for 3-4 h at 37 °C in a shaking incubator (220 rpm).
5. Pellet down the cells by centrifuging the culture at 4,500 × g for 15 min at 4 °C.
6. Prepare buffers for protein purification (see Table 2).
7. Suspend SNARE-expressing cell pellets in 40 mL of ice-cold lysis buffer and lyse the cells by sonication on ice (15% amplitude, 5 s on and 5 s off, 30 min total).
8. Centrifuge the lysate at 15,000 × g for 30 min at 4 °C to remove insoluble materials.
9. Pass the supernatant through a gravity column filled with 1 mL of Ni-NTA resin. Wash the resin with wash buffer A, then with wash buffer B, and elute the proteins with 10 mL of elution buffer.
10. Remove tris(2-carboxyethyl)phosphine (TCEP) and imidazole from the eluent by using a desalting column (follow the manufacturer's instructions). Elute the sample with PBS.
11. Concentrate the proteins with centrifugal filters (10 kDa cutoff) to ~70 µM while maintaining the proteins in PBS (typically yielding 2 mL). Measure the protein concentration either by ultraviolet (UV) absorption at 280 nm (A280) or by the Bradford assay.
12. Prepare small aliquots, flash-freeze in liquid nitrogen, and store at -80 °C until use.
    ​NOTE: Full SNARE complexes will be assembled after conjugating ΔN-complex on a DNA handle (see below).

5. Attachment of DNA handles

NOTE: Two 510 bp dsDNA handles containing primary amine groups on one end are first prepared by PCR, and the amine groups are then converted to maleimide groups by using a bifunctional crosslinker, SM(PEG)₂. The two handles are then covalently linked to SNARE complexes via their cysteine groups for site-specific conjugation (Figure 3B).

1. Prepare primers.
   1. Prepare forward primers: Primer B (for amplifying Handle B) that is 5′-biotin-labeled for glass surface attachment and binds to λ-DNA; Primer Z (for amplifying Handle Z) that is 5′-azide-labeled for magnetic bead attachment and has the same sequence as Primer B.
   2. Prepare a reverse primer: Primer N (shared for Handle B and Handle Z) that is 5′-amine-labeled for protein conjugation and binds to λ-DNA 510 bp away from the forward primer.
2. Set up and run two sets of PCR reactions (18 tubes of 200 µL reaction for each handle) with λ-DNA (template), nTaq polymerase, and standard PCR conditions (see Table 1). Clean up the product with a PCR clean-up kit and elute each handle with 45 µL of ultrapure water. Use a minimal volume of water to obtain high concentrations of handles for an effective reaction in later steps.
3. Measure the DNA concentration by A260. The typical yield is ~650 µL of ~2 µM solution for each handle. Keep small samples apart for later verification in agarose gel electrophoresis.
4. React each handle (1 µM in PBS) with 5 mM SM(PEG)₂. Incubate at room temperature with gentle rotation. After 1 h, use a DNA purification kit to remove unreacted SM(PEG)₂. Elute each handle with 250 µL of PBS to obtain ~2 µM solutions.
5. Mix the solutions of Handle B and ΔN-complex at a molar ratio of 1:16 (e.g., 1 µM Handle B and 16 µM ΔN-complex) in PBS and incubate for 2 h at room temperature with agitation. Keep apart a small sample for agarose gel electrophoresis.
6. Add a solution of VAMP2 in a 2.5-fold molar excess over the ΔN-complex used in the previous step. Incubate the mixture for another 1 h at room temperature with agitation. Full SNARE complexes are assembled in this step.
7. Remove free proteins by buffer exchange with fresh PBS and a centrifugal filter (100 kDa cutoff): centrifuge at 14,000 × g for 5 min at 4 °C, repeat at least 6x, and run for 15 min for the last spin. Measure the increase in the A260/A280 ratio to monitor the removal of free proteins. Keep apart a small sample for agarose gel electrophoresis.
8. Add Handle Z to the solution in a 15-fold molar excess over Handle B. Keep the concentration of Handle Z at least above 1 µM to facilitate the reaction. Incubate the mixture overnight at 4 °C with agitation.
9. Verify the intermediates (Handle B and its protein conjugates) and the final product (SNARE complex with two handles) by agarose gel electrophoresis (Figure 3B, inset) (see Table 2).
   NOTE: If the proteins are successfully attached to Handle B, a mobility shift will be detected. In particular, the formation of full SNARE complexes on DNA handles can be confirmed by their resistance to sodium dodecyl sulfate (SDS), unlike ΔN-complexes, that are disassembled in SDS and leave only syntaxin bound to DNA (compare b and c in Figure 3B).
10. Prepare small aliquots, flash-freeze in liquid nitrogen, and store at -80 °C until use.
    ​NOTE: Although the final solution contains unreacted handles, only the wanted construct that is doubly labeled with biotin and azide will be selected during the sample assembly in a flow cell.

6. Fabrication of flow cells

NOTE: Flow cells for MT measurements are constructed from two glass coverslips bonded together by double-sided tape (Figure 3C). One coverslip is coated with a mixture of PEG and biotinylated polyethylene glycol (PEG) to avoid nonspecific binding and to enable specific tethering of target molecules via biotin-NeutrAvidin linkage (Figure 3D). Then, the solutions of materials for MT experiments are sequentially infused into a flow cell by using a syringe pump (Figure 3C,D).

1. Prepare two glass coverslips, one each for the top (24 mm × 50 mm, No. 1.5 thickness) and the bottom (24 mm × 60 mm, No. 1.5 thickness) surface. Clean the coverslips by sonication in 1 M KOH for 30 min. After sonication, rinse the coverslips with distilled water and keep in water until the following step.
2. PEGylate the bottom coverslip following published protocols^42,43. Use N-[3-(trimethoxysilyl)propyl]ethylenediamine for silanization and a 1:100 (ww) mixture of biotin-PEG-SVA and mPEG-SVA in 100 mM bicarbonate buffer. Keep the PEGylated coverslips dry at -20 °C and store them for a few weeks.
3. On the day of the experiments, take out the PEGylated coverslips and blow dry them with a nitrogen gun. Visually inspect them for dirt to make sure they are clean.
4. To make the sample channels, prepare ~2 mm wide strips of double-sided tape and lay down four strips on a bottom coverslip (PEGylated surface up), parallel to and separated from each other by ~5 mm (Figure 3C).
   NOTE: This way, three 5 mm wide sample channels can be created in a single flow cell.
5. Place a top coverslip in the center of the bottom coverslip, leaving ~5 mm of space on the short edges for channel inlets and outlets. Gently press the back of the top coverslip with tweezers to firmly seal the channels.
6. To make an inlet reservoir, trim the edge of a 200 µL pipette tip. Cut out ~10 mm from the wider opening to allow for holding ~200 µL of solution. Make three of them for the three flow channels. To configure the outlets, prepare three syringe needles that fit the tubing for the syringe pump.
7. Using 5 min epoxy, glue the reservoirs and needle hubs to the flow cell. Ensure a complete seal is formed to avoid leakage, and that the channels are not blocked with excess glue. Let it dry for at least 30 min.

7. Assembly of bead-tether constructs

NOTE: The solutions of materials for MT experiments, including the ones for bead-tether constructs, are sequentially introduced into flow cells by using a syringe pump (Figure 3C,D).

1. Prepare magnetic beads. Take 5 mg of M270-epoxy beads from a stock solution (~3.3 × 10⁸ beads in 167.5 µL of dimethylformamide) and replace the solvent with phosphate buffer (see Table 2) by magnetic separation of the beads.
2. Prepare the beads at ~1.1 × 10⁹ beads mL⁻¹ in a phosphate buffer with 1 M ammonium sulfate and react them with 2 mM dibenzocyclooctyne (DBCO)-NH₂. Incubate the mixture for 3 h on a rotating mixer at room temperature. After the reaction, wash the beads 3x with fresh phosphate buffer to remove unreacted molecules.
   NOTE: The washed beads can be stored without extra rotation at 4 °C for several weeks before use.
3. Connect a needle on the flow-cell channel exit to the syringe pump with polyethylene tubing. Equilibrate the channels with PBS.
4. Introduce the following solutions sequentially into the channel by suctioning with the pump: NeutrAvidin, target constructs (DNA hairpins or SNARE complexes with DNA handles), reference polystyrene beads, and DBCO-coated magnetic beads. Before use, vortex the bead solutions thoroughly to disperse potential bead aggregates.
5. Wash away unbound beads while applying 0.1 pN of force.
   NOTE: The application of a small upward force facilitates the removal of unbound beads and helps avoid the rupture of specifically bound bead-tether constructs.
6. For experiments with SNARE complexes, include 1.5 µM SNAP-25 in the final buffer.
   ​NOTE: The free SNAP-25 molecules can rebind SNARE complexes after unfolding and allow repeated measurements on a single complex.

8. Identification of target constructs

1. On the surface of a flow-cell channel, search for the magnetic beads that are tethered by single molecules of the target construct. Make sure a reference bead is located nearby.
2. Rotate a candidate bead and check that it swivels freely. If the bead is tethered by multiple molecules, it exhibits a constrained motion.
3. Rotate the bead for a few complete turns and find out the radius of rotation (this function is implemented in the provided software). Preferably, choose a bead with a small rotational radius.
   NOTE: This radius indicates how much the bead is off-centered from the tether axis, which is randomly determined during the bead-tether assembly^30,31. In all experiments, minimal off-centering of a bead alleviates many artifacts associated with the high bead radius to tether extension ratio we use.
4. Increase the force from 0 to 5 pN to identify good single-tethered beads. Look for a large change in the diffraction pattern of a bead resulting from the stretching of a 1 kbp tether (or the equivalent two 510 bp handles). If the diffraction pattern does not change significantly, lower the force to zero and scan for another candidate bead.
   ​NOTE: The ~300 nm lifting of a bead can be readily noticed from the raw images without actually starting the tracking process.

9. Bead tracking for extension measurements

NOTE: Tracking of beads is performed by analyzing bead images in real time in the LabVIEW software provided with this article. The tracking method and its variants have been used in most of the conventional MT systems and are explained in previous literature^2,5,7,26. By measuring the position of a magnetic bead relative to a fixed reference bead (i.e., differential tracking), the position measurements become extremely robust to an external perturbation.

1. Once a proper magnetic bead is located together with a reference bead, click on the Calibrate button to start preparing for bead tracking.
2. Click on the beads in the image to define the locations of the beads. The images will then be cropped to regions of interest (ROIs) (e.g., 150 x 150 pixels for a 3 µm bead) around the beads and then further analyzed to extract the precise bead coordinates.
3. Wait for the magnet rotation to complete. This process records the x- and y-coordinates of the bead (by computing 2D cross-correlation⁴⁴ or by using radial symmetry⁴⁵ of the bead images, with comparable performance) while rotating the magnets to document the off-centered attachment of the bead³¹.
4. For tracking in the z-direction, wait for the software to generate a lookup table of diffraction images of the beads at different distances from the focal plane. This is carried out by stepping the objective lens with a piezo scanner in equidistant steps and recording fluctuation-averaged bead images at each position. Then, the z-coordinates of the beads in actual experiments are determined by comparing the real-time bead images to the lookup table with interpolation⁷.
5. When the lookup table generation is finished, enable tracking and autofocusing (press the Track? and AF? Buttons) and click on the Acquire button to start recording bead positions.
   ​NOTE: Autofocusing is optional but recommended to correct for the stage drift in z during the acquisition.

10. Force application schemes

1. Force-ramp experiments: To verify the force-extension relationship of the construct, apply a force ramp up and down at a constant loading rate (± 1.0 pN s⁻¹) (Figure 4A). For example, apply three rounds of a 0-20-0 pN cycle to verify the overall length of the construct and the force-extension curve of the handles.
2. By specifying the tether parameters in the software, overlay a WLC force-extension curve on top of the measured data, and determine whether the target bead is tethered by a genuine sample construct with proper DNA handles. Use the known contour length (e.g., ~340 nm for 1 kbp dsDNA) and WLC persistence length (30-45 nm for short dsDNA³¹) of the construct as a starting point. Apply the extension correction method described in step 2.11 if necessary.
3. If the construct is verified, examine the force-extension response in detail to look for additional extension resulting from the target molecules-hairpins or SNARE complexes.
4. Constant-force experiments: Gradually vary the applied force in discrete steps to probe the force sensitivity of the target molecules (Figure 4B).
   NOTE: MTs enable simple and effective constant-force experiments because the applied force is maintained constant when the magnets are held still.
   1. For DNA hairpins, apply 4-8 pN of force with 0.2-0.5 pN steps, and measure the bead position for ~10 s at each force level.
   2. For SNARE complexes, apply 14-16 pN of force with 0.1-0.2 pN steps, and measure the bead position for ~10 s at each force level.
5. Force-jump experiments: Observe the transition events of SNARE complexes.
   NOTE: Force-jump experiments, like constant-force experiments, involve changes in force levels. However, force jumps employ more abrupt changes in the applied force, allowing for the monitoring of force-triggered events in the probed molecules, such as a sudden rupture of protein complexes. For example, since SNARE complexes exhibit structural hysteresis in force cycling²³, it is informative to perform force-jump experiments and measure the latency to transition (Figure 4C).
   1. Unzipping: Peeling off of a VAMP2 molecule from an intact, ternary SNARE complex, leaving a binary complex of syntaxin-1A and SNAP-25.
   2. Rezipping: Zipping of the unzipped VAMP2 molecule to regenerate an intact SNARE complex.
      1. Unfolding: Full disassembly of a SNARE complex accompanied by complete dissociation of SNAP-25. Only VAMP2 and syntaxin molecules remain in the construct after unfolding.
      2. Refolding: Regeneration of a SNARE complex upon binding of a free SNAP-25 molecule from the buffer.
6. At 2 pN, induce the assembly of an intact SNARE complex by waiting (~30 s) for the association of a free SNAP25 molecule. A sudden decrease in extension is observed upon the formation of a SNARE complex.
7. To observe unzipping events, wait for a few seconds at 10-12 pN, and then move to 14-15 pN abruptly with the maximum motor speed possible. Depending on the target force, the SNARE complex will exhibit either a reversible transition between partially unzipped intermediates (as in constant-force experiments) or a ~25 nm jump to a higher, unzipped state after a random waiting time (or latency).
8. To observe rezipping events, lower the force to 10-12 pN immediately after unzipping is observed. Again, the SNARE complex exhibits a stochastic transition to the lower, zippered state after some random latency. If unfolding has occurred after unzipping, the complex will fail to rezip, as a SNAP-25 molecule will be missing.
9. To observe unfolding events, wait for a longer period after unzipping is observed to detect a further increase in extension (~2 nm).

11. Data analysis

NOTE: The types of analysis one can conduct with MT data depend on the target system. However, there are common approaches to extracting useful information from the respective experiments described in Figure 4. All analyses are performed with MATLAB (R2021a) using the custom codes provided with this article. These codes generate plots by using the same data presented in this article. Note that while raw data from 100 Hz tracking was directly taken for analysis, data from 1.2 kHz tracking was typically median-filtered (with a five-point sliding window) prior to analysis to reduce noise (except for noise analysis).

1. Force-ramp experiments: Analyze the force-extension relationship (e.g., elasticity of polymers) and transition the force to extract information on nanomechanical properties.
2. Constant-force experiments: Analyze state populations and dwell time (or transition rate) as a function of force to extract structural (e.g., regions involved in transition), thermodynamic (e.g., free energy difference), and kinetic (e.g., energy barrier) parameters of the conformational changes.
3. Force-jump experiments: Analyze rupture kinetics (e.g., protein-protein interactions and receptor-ligand binding) or the lifetime of transient intermediates (e.g., unfolding of biomolecules) to extract the stability of target molecules and their states.
4. As representative applications, analyze the sample data for DNA hairpins and SNARE complexes:
   1. Two-state transitions of a DNA hairpin: unzipping force, opening distance, force dependence of population shift, and state assignment and transition rate measurements with a hidden Markov model (HMM) (MATLAB codes provided).
   2. Conformational changes of SNARE complexes: unzipping force, force dependence of intermediate states and unzipping latency, hysteresis in rezipping, and unfolding/refolding behavior.
      NOTE: Force-extension models for DNA handles, DNA hairpins, and SNARE complex conformations are given in previous references^14,31.

Representative Results

Force calibration
The results from the two force measurement methods (beads' lateral displacement variance and power spectrum analysis) differed by 0-2 pN (Figure 2G). According to the results in Figure 2F, we can reliably reach up to 30 pN with regular neodymium magnets.

Two-state transitions of an 8 bp DNA hairpin
We first investigated the nanomechanics of a short DNA hairpin (Figure 5). DNA hairpins have been extensively characterized by conventional single-molecule force spectroscopy, and therefore a vast source of references to compare with is available. Unzipping of a short hairpin is usually reversible, so its rezipping events are also observed in the same force range in which unzipping occurs (Figure 5A). By applying a force ramp between 0 pN and 20 pN (Figure 5B), the force-induced extension of the hairpin construct was verified to follow a WLC model, which can be solely attributed to the elasticity of DNA handles (Figure 5C, "closed"). At around 6 pN, the construct displayed additional fluctuations in extension, associated with reversible unzipping of the hairpin structure (Figure 5C, inset). Finally, at ~8 pN, the transition eventually disappeared and the extension settled on the upper state that was further extended by ~7 nm. Consequently, the measured force-extension profile above 8 pN snapped onto a new model curve (Figure 5C, "open") that includes the length of the single-stranded region of the unzipped hairpin.

We then performed constant-force experiments to examine the hairpin transition systematically. The bead position was measured in the force range of 4-8 pN with 0.5 pN steps for ~10 s at each level; then, the extension values were collected and analyzed to measure their equilibrium distribution as a function of force. The results from 100 Hz tracking suggested a gradual shift toward a more extended state in this force regime (Figure 5D), but the obtained histograms of the extension were not clear enough to resolve distinct populations (Figure 5E). In stark contrast, when the same experiments were carried out at 1.2 kHz (Figure 5F), the high-speed trajectories of extension changes after gentle filtering (five-point median filter) revealed two distinct populations that are well described by a mixture of two Gaussian distributions (Figure 5G). The separation between the two populations, indicating the opening distance of the hairpin, remained unchanged at ~7 nm in the unzipping force regime (Figure 5H). The deviation in the extremities (4 pN and 8 pN) was due to the inaccurate localization of one state because of its scarcity.

The data revealed that the mid-force for unzipping transition (the force at which the closed and open populations become equal) F_1/2 was ~6 pN, and the upper, open state became gradually dominant as we increased the force across 4-8 pN (Figure 5I). When fitted with a Boltzmann relation for the open probability, , the exact values of F_1/2 = 5.9 pN and Δz = 7.1 nm were obtained, consistent with the above observations. It should be noted, however, that the opening force obtained from a single construct may not be accurate because of the bead-to-bead variability in force generation, which was measured to be ~4% for the commercial M270 beads³¹. Further, since the stem length (8 bp) is short, the ground-truth opening force of other 8 bp hairpins with different nucleotide composition may vary a lot²⁰. Finally, we applied the HMM to the extension traces to map the state transition and thereby measured the transition rates (Figure 5F, red trace). Both unzipping and rezipping rates varied exponentially with applied force (Figure 5J), in such a way that the force promotes unzipping and inhibits rezipping. If necessary, one can further use the classic Bell expression to extract the parameters of the energy landscape (e.g., barrier height and distance)⁴⁶.

Characterization of thermal fluctuation in extension measurements
Using the hairpin construct, we profiled the force-dependent noise in extension measurements. First, the thermal fluctuations of a tethered bead were calculated from equations using the parameters (e.g., bead radius, tether length) appropriate for these experiments^2,5 (Figure 5K, solid curves). We also plotted the standard deviation of extension measured from the time trace of a hairpin construct at distinct force levels. Since this molecule had a hairpin motif, its response under 4 pN (closed state) was used for the measurement of intrinsic noise, whereas the hairpin dynamics were detected ~6 pN, as expected, and served as a check. The force-dependent suppression of fluctuation was also observed after the hairpin became mostly open (compare 8 pN vs. 4 pN). Comparison with the thermal limit indicates that there is a room for improvement, but this remaining noise is often associated with the rotational fluctuation of a magnetic bead³⁰, which is random and challenging to resolve. For more systematic analysis of the Brownian noise across observation time, calculation of the Allan deviation is frequently employed^32,33. We calculated the Allan variance for the hairpin data presented in Figure 5F, similarly to the 5 kbp measurements in Figure 2C. The results in Figure 5L show that, in the intermediate force range of 4-8 pN, we obtained 2-3 nm of Allan deviation at the maximum speed (1.2 kHz), and this value dropped to below 1 nm for the observation time (τ) longer than 0.1 s. Interestingly, the hairpin dynamics emerged around 5-7 pN for ~ 0.01 s (Figure 5L, inset), consistent with the measured transition force and rates in Figure 5I,J.

Conformational changes of neuronal SNARE complexes
We then employed neuronal SNARE complexes as a protein model and examined their force-dependent mechanical properties. Unlike the hairpin construct, single SNARE complexes were held between two 510 bp dsDNA handles (Figure 6A). It should be noted that the termini of syntaxin-1A and VAMP2, distal from the handles, were crosslinked by a disulfide bond between artificial cysteine residues to avoid rupture and enable multiple rounds of tweezing of a given construct.

We first applied a force ramp, both with increasing and decreasing force levels (± 1 pN s⁻¹) to stretch and relax the target construct, respectively. In the low- to mid-force regime (0-10 pN), the two handles independently behaved as WLC polymers, overall shaping the force-extension curve indistinguishable from that of 1 kbp dsDNA (Figure 6B, black). However, when the force was increased to above 10 pN, the extension values deviated appreciably from the WLC model, indicating that the embedded SNARE complex displayed an additional increase in extension. More specifically, the extension increase can be summarized in three distinct stages: (a) a slight, gradual increase in 11-13 pN, (b) rapid and larger (~10 nm) fluctuations in 14-16 pN, and (c) the final, irreversible unzipping of about ~20 nm. Additionally, when the force was lowered to relax the construct, the extension either snapped back to the original force-extension curve at a lower force (<15 pN) or followed a new model curve with a larger extension (Figure 6B, blue). The total extension was eventually restored to the lower values (from blue to black in Figure 6B) below 5 pN and the same force-ramp cycles could be applied, which showed a similar trend.

From the molecular model of SNARE complex conformation, we can precisely calculate the possible extension values of potential intermediates (Figure 6C). Moreover, assuming the WLC behavior for the uncoiled polypeptides, the extensions can be estimated as a function of force, thus generating the full force-extension models for the various conformations (Figure 6B, dotted lines). Taking these values as a reference, we interpreted the above transitions as follows^14,23: (a) a gradual shift from the fully zippered state (FZ) to the linker-open state (LO) in 11-13 pN, implying the opening of the linker regions of syntaxin-1A and VAMP2; (b) rapid transition between LO and the half-zippered state (HZ), implying the opening of a SNARE complex up to the zeroth ionic layer; and (c) the final transition to either the unzipped (UZ) or the unfolded state (UF), implying a complete unraveling of VAMP2 from the rest of the complex. The UZ state is different from UF in that the associated molecule of SNAP-25 is still bound to syntaxin-1A, maintaining a binary complex. In the case of UF (without SNAP-25), the full SNARE complex can be regenerated only after a free SNAP-25 molecule from the solution recombines, in which lowering the applied force to allow such rebinding is critical.

To verify the conformational changes of SNARE complexes in a more systematic way, we then performed force-jump experiments in the force regime, where conformational fluctuations were frequently observed at 14-15 pN (Figure 6D). Typically, we first started by measuring the bead position at 10 pN and checked for the stable extension, indicating the absence of SNARE-related changes. Then, the force level was abruptly increased to 14-15 pN, at which the extension was monitored until unzipping occurred, if any. Finally, the force was reduced back to 10 pN to check for any persistent increase in extension associated with unfolding. At 14 pN, the extension traces mostly stayed in the LO state, with occasional spikes to the HZ state. It should be noted that these brief excursions to the HZ state are likely to be missed in 100 Hz tracking, which averages and down-samples bead images by a factor of 12. Despite the clear and frequent visits to the HZ state, the complex failed to make a complete transition to the UZ state (Figure 6E), suggesting that the external force was not strong enough to overcome the energy barrier to unzipping. In contrast, even a small increase in force (to 14.3 pN) made the transition very efficient so that the UZ state was reached mostly within a few seconds (Figure 6F). Consistently, unzipping was finished mostly within 1 s when we applied 14.5 pN to the complex (Figure 6G,H). Notably, unzipping at higher forces frequently led to the complete unfolding of the whole complex (accompanied by the removal of SNAP-25), as evidenced by the small additional increase in extension above UZ (Figure 6H) and by the refolding signature observed at 2 pN (Figure 6I). Overall, these data show the classical slip-bond behavior⁴⁷ for the unfolding of SNARE complexes, consistent with previous reports^14,23,48.

Figure 1: Instrument setup. Schematic (A) and photograph (B) of a high-speed MT setup. Magnets controlled by a linear and a rotation motor are located above the sample stage of an inverted microscope equipped with a 100x oil-immersion lens and a high-speed CMOS camera. The light beam from a superluminescent diode passes through the magnets and illuminates the field. Inset: Representative diffraction images of beads located at different distances from the focal plane. Please click here to view a larger version of this figure.

Figure 2: Force calibration. (A) Schematic of a force calibration sample. The magnitudes of the force exerted by an antiparallel pair of magnets with 1 mm separation are measured as a function of magnet distance d from the displacements of a magnetic bead (M270) tethered by a 5 kbp dsDNA fragment. (B) Representative data from the force calibration procedure. Colored arrows indicate regions that are expanded in (D) (matching colors). (C) Allan deviation for the z-position of a 5 kbp tethered bead measured with 15-20 pN. Curves for the magnetic bead z-coordinates before (blue) and after (red) subtracting the reference bead position are shown. (D) Representative time series of the y-position measured at the indicated magnet distance d. The corresponding histogram of y-coordinate distribution is shown on right with a Gaussian fit (red). (E) Representative PSD from the data shown in (D). The force values obtained by fitting a model (red) to the respective PSDs are given on top. (F) Calibration of magnetic force as a function of magnet distance. Forces were measured either from the variance (left) or from the PSD method (right). The fit (red) indicates a double-exponential model with the annotated equation. (G) Difference in the measured force obtained from variance and PSD. A red curve is calculated for the fits shown in (F). (H,I) Verification of the force-extension relationship of the 5 kbp calibration construct. The mean extension values at distinct force levels (measured from variance) were used either directly (H) or after correcting for the bead-height offset (I) due to the tilting of an off-centered bead³¹. The force-extension data for n = 5 molecules were fitted by an extensible WLC model and the fitted parameters (persistence length L_p and stretch modulus K_o) are annotated on top (mean ± s.d.). Abbreviation: PSD = power spectral density. Please click here to view a larger version of this figure.

Figure 3: Sample preparation. (A) Preparation of 8 bp DNA hairpin constructs by PCR amplification of a 1 kbp region of λ-DNA. (B) Preparation of SNARE complex constructs with two 510 bp DNA handles. Inset: Verification of DNA handles and their attachment to proteins by agarose gel electrophoresis (2% gel). Arrows indicate the mobility shift (color-coded) of product species: free 510 bp handles (magenta); Handle B attached to syntaxin (red), to ΔN-complex (green), and to SNARE complex (blue); and the final two-handled SNARE complex (green). The addition of SDS disrupts the ΔN-complexes (present in b) but not the full SNARE complexes formed by the full-length VAMP2 (present in c). (C) Design and photograph of a flow cell for MT experiments. (D) Schematic of the sequential introduction of sample solutions into a flow-cell channel. Abbreviation: MT = magnetic tweezer. Please click here to view a larger version of this figure.

Figure 4: Types of representative experiments. (A-C) Schematics of force-ramp, force-clamp, and force-jump experiments (top) with representative time traces of extension from the corresponding measurements (middle). The types of analysis that can be conducted are shown on the bottom. Please click here to view a larger version of this figure.

Figure 5: Two-state transition of an 8 bp DNA hairpin. (A) Schematic of MT experiments on a DNA hairpin with the expected unzipping and rezipping transition. (B) Representative trace of construct extension from force-ramp experiments with increasing (~0.25 pN s⁻¹) force levels. (C) Representative force-extension curve reconstructed from the data in (B). Yellow curves indicate WLC models for the hairpin construct with the hairpin in the closed (solid) and open (dashed) conformation. (D) Representative extension trace from constant-force experiments with increasing force levels, measured at 100 Hz. (E) Histograms of extension data in (D). (F,G) Results for the same experiments in (D) and (E) but with 1.2 kHz tracking. The raw 1.2 kHz time series was smoothed by applying a five-point median filter. Red traces in the expanded view of (F) were obtained from an HMM. Red lines in (G) indicate the locations of Gaussian populations. (H) Distance between the two populations in (G). (I) Probability in the open state as a function of the applied force. The red curve is a fitted Boltzmann model ( ) with the mid force F_1/2 = 5.9 pN. (J) Unzipping and rezipping transition rates measured from the HMM results. Solid lines indicate exponential dependence on force. (K) Thermal fluctuation in extension measurements. Standard deviations of hairpin extension data (without filtering) are shown as a function of force. The thermal resolution limit that represents the theoretical magnitude of thermal fluctuations was estimated from Eq. 9 in the work by Choi et al.² for a 2.8 µm bead with a 1 kbp tether. (L) Allan deviations calculated from the 1.2 kHz hairpin data in (F) (without filtering). Inset shows the Allan deviation at 0.01 s as a function of force, which demonstrates a gradual increase and decrease of fluctuation due to the hairpin dynamics. Abbreviation: MT = magnetic tweezer. Please click here to view a larger version of this figure.

Figure 6: Conformational changes of neuronal SNARE complexes. (A) Schematic of MT experiments on SNARE complexes. (B) Representative force-extension curves for the SNARE construct. Black and blue traces (100 Hz) were obtained from stretching and relaxing periods in force-ramp experiments, respectively. Dashed lines indicate extension models, accounting for the various conformations of SNARE complexes shown in (C). (C) Molecular models of SNARE complex conformations with the corresponding calculated extensions. The values were estimated from the geometric parameters of helical bundles and a WLC model for the polypeptide region¹⁴. (D) Schematic of force-jump experiments to investigate SNARE complex conformations. (E-H) Representative extension traces from force-jump experiments performed at the indicated levels of force. In (E), unzipping was not observed. In (F) and (G), unzipping was observed followed by rezipping at 10 pN. In (H), unzipping was followed by a further unfolding event. (I) Refolding of a SNARE complex at 2 pN. A clear reduction in extension from UF to FZ state was observed at 5 pN. Abbreviation: MT = magnetic tweezer. Please click here to view a larger version of this figure.

PCR setting	Condition
Materials	1.25 μg/mL λ-DNA (template), 1 μM forward and reverse primers, 0.2 mM dNTP, 0.05 U/μL nTaq, 1x nTaq buffer
Denaturation	95 °C for 30 s
Annealing	Calibration construct: 55 °C for 30 s
	DNA hairpin: 57 °C for 30 s
	DNA handles: 50 °C for 30 s
Extension	DNA hairpin and handles: 72 °C for 1 min
	Calibration construct: 72 °C for 5 min
Cycle	30–34
Agarose gel electrophoresis
Gel	2% agarose in 0.5x tris-borate-EDTA (TBE, pH 8.3) containing 1x SYBR Safe
Running	Full power (108 V avg) on Mupid-2plus (Advance), 40-50 min

Table 1: Conditions for PCR reactions and agarose gel electrophoresis. Reaction parameters for PCR of DNA constructs, including 5 kbp dsDNA for force calibration, DNA hairpin construct, and DNA handles for attaching SNAREs. Primer sequences are given in the Table of Materials.

Protein purification buffer	Composition
Wash Buffer A	50 mM Tris-HCl (pH 8.0), 500 mM NaCl, 7 mM β-mercaptoethanol (BME), 10% glycerol, and 20 mM imidazole
Wash Buffer B	50 mM HEPES (pH 7.2), 150 mM NaCl, 1 mM TCEP, 10% glycerol, and 20 mM imidazole
Lysis Buffer	Wash Buffer A supplemented with 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 1x protease inhibitor cocktail
Elution Buffer	Wash Buffer B supplemented with 400 mM imidazole
Phosphate buffered saline (PBS)	81 mM sodium phosphate dibasic (Na2HPO4), 19 mM sodium phosphate monobasic (NaH2PO4) (pH 7.2), 150 mM NaCl
phosphate buffer	81 mM Na2HPO4, 19 mM NaH2PO4, pH 7.4

Table 2: Buffers and their composition. Composition of buffers used for protein purification.

Supplemental Figure S1: Drawing of a magnet holder. Dimensions of an acrylic holder for two 10 mm x 10 mm x 12 mm magnets with a 1 mm gap is shown. Please click here to download this File.

Supplemental File 1: A zipped file containing MATLAB codes. MATLAB scripts for analyzing data produced by the high-speed magnetic tweezer experiments, including force calibration, hairpin, and SNARE complex analysis. Please click here to download this File.

Supplemental File 2: LabVIEW software package zipped file. A full package of LabVIEW codes for operating a high-speed magnetic tweezer setup and acquiring data with it. Please click here to download this File.

Discussion

In this work, we introduced a single-molecule force spectroscopy setup that can observe structural changes of biomolecules at high spatiotemporal precision. The high-speed CMOS camera used acquires 1,200 frames s⁻¹ at 1,280 x 1,024 resolution, enabling 1.2 kHz bead tracking. However, the speed of measurements is currently limited by the bead tracking software, so the ROI is typically reduced to smaller areas in high-speed measurements. The high power of the SLD provides a bright illumination that is critical for fast bead imaging up to a few kHz bandwidth. Moreover, the spatial coherence of the beam generates high-contrast, concentric diffraction rings around the beads (Figure 1A, inset), which enable precise determination of the bead position based on symmetry.

The magnetic force exerted on a bead-tether construct can be determined by measuring the Brownian fluctuations of the tethered bead^35,37,38. Since real-time force analysis is computation-heavy, the applied force is typically measured beforehand using a reference construct. For example, the magnetic beads to be used are tethered by long (>5 kbp) dsDNA fragments, and the corresponding thermal fluctuations in bead position are measured as a function of magnet distance (Figure 2A). The force calibration is typically performed once after the setup is built, but it is not necessary to repeat it regularly unless the setup is modified, for example, by replacing the magnets. Since the characteristic frequency of bead fluctuation increases with the applied force², a high-speed setup is particularly useful to capture the fast dynamics in a high-force regime and measure the force accurately. Force estimation from variance is much simpler in its implementation than the spectral analysis in the frequency domain, but it is susceptible to artifacts from drift, camera-based acquisition, and the extension changes due to off-centered bead attachment^31,37,38. Yet, the results from the two methods differ by only 0-2 pN if properly obtained (Figure 2G); so, the variance method is reliable enough when the absolute determination of force is not critical.

For higher forces above 30 pN and at around 65 pN (at which dsDNA overstretching serves as a benchmark), either commercially available high-grade (N50-N52) magnets must be installed, the gap between the magnets must be reduced, or the magnetic field must be further engineered^28,49. In this setup, the fastest speed of the vertical motor is 30 mm/s, which allows a force jump from 0 pN to 20 pN in ~0.6 s. Some fast force-dependent structural changes can be missed if the motor motion limits the force loading rate. Depending on the application, changes to and further optimization of the way in which magnets are moved might be necessary. One example involves the creative use of a magnetic tape head¹⁵.

For high-resolution measurements with MTs, it is important to evaluate the level of noise from various sources. Once the optical components (a microscope with a high-magnification lens, bright light source, and fast camera) are properly configured, sub-nanometer precision in bead tracking can be achieved. Then, the major source of noise becomes the Brownian motion of a bead, which is utilized to measure the applied force. The thermal fluctuation of a tethered bead depends on its radius, tether length, and the applied force. Although the intrinsic fluctuation in z-direction (i.e., extension changes) depends solely on thermal energy and tether stiffness, the bead-tether dynamics and the rate of camera-based acquisition filters the bead's movement and thus the monitoring of target biomolecules in turn. Therefore, the bead size and sampling rate must be chosen strategically to achieve good spatiotemporal resolution. As an alternative to the 2.8 µm bead we employed, smaller 1 µm beads are also popular and can be advantageous for fast measurements because of their fast response. However, a critical weakness is the small magnetic content, which limits the maximum force that can be generated ( ). Since smaller beads can still exert force at least up to 10 pN, they may be suitable for studying weak-force phenomena, such as in DNA supercoiling. In contrast, investigations of molecular motors, protein folding (e.g., SNAREs, shown here), or cell mechanics⁵⁰ necessitate the application of higher forces, in which case one can consider modifying the magnet configuration (e.g., reduce the gap or distance) to extend the range of applicable force^28,51.

Because the technique probes the nanomechanical responses of target molecules while applying a force at the biophysically relevant scale, it is ideally suited to studying force-sensitive elements that play pivotal roles in mechanobiological processes. To illustrate the wide applicability of the high-precision MT assay, we employed both a nucleic acid and a protein model that exhibit dynamic and fast conformational changes upon the application of a piconewton-scale force. One limitation of the technique is the requirement of purified nucleic acids and proteins, which has particularly discouraged its wide extension to a broad range of proteins. The advancement of in vitro protein expression and conjugation technologies will continue to provide access to less-studied proteins. A related issue is that a priori knowledge on the target structure is often critical to design experiments (e.g., attachment of handles). We expect that the advent of single-particle cryo-EM⁵² and AlphaFold2⁵³ will strongly support the design and analysis of mechanical measurements on single protein molecules and unleash more powerful applications of high-resolution MT.

The unzipping force of DNA hairpins depends on many factors, including sequence, structure, and buffer composition, but most critically on stem length and guanine-cytosine (GC) content²⁰. To demonstrate the power of high-speed tracking, we intentionally designed an 8 bp stem (with three GC base pairs) that was expected to unfold at a low force with fast dynamics. Indeed, the results in Figure 5 show that such fast dynamics would have been difficult to resolve with standard techniques featuring a 10 ms resolution or lower. This aspect is further confirmed by the transition rates measured from HMM analysis, the high rates of which ranged between 100 and 200 s⁻¹ (Figure 5J).

Neuronal SNAREs are thought to drive synaptic vesicle exocytosis. In particular, the SNARE proteins catalyze membrane fusion by lowering the associated energy barrier, such as electrostatic repulsion between vesicle and plasma membranes. Accordingly, conformational fluctuations of the SNARE complexes are found to occur in a narrow force range of 12-15 pN, that corresponds to the expected level of repulsive forces^14,23. Using the high-speed MTs described here, we recapitulated the major findings on the force-dependent behavior of neuronal SNARE complexes. The force hysteresis in unzipping and rezipping (Figure 6B) indicates that rezipping occurs at a lower force than unzipping, and therefore work is done during this cycle. Such nonequilibrium transitions are better approached by force-jump experiments, in which the latency to transition under load (similar to a bond rupture event) or conformational fluctuations before unzipping can be measured. Both cases benefit from high-speed setups, as illustrated by recent studies on the transient states of biomolecules and their complexes^{15,17,54,55,56}.

Collectively, these results agree with the characteristic force-dependent changes of DNA hairpins and neuronal SNARE complexes reported with conventional single-molecule force spectroscopy. Simultaneously, they underscore the utility of high-precision mechanical measurements to reveal the force sensitivity of biomolecules and their assemblies. We hope this article can attract more people from the field of mechanobiology, motivating researchers to employ high-speed MTs in investigating their unique systems of interest.

Materials

Name	Company	Catalog Number	Comments
Materials for construct synthesis
Agarose gel electrophoresis system	Advance	Mupid-2plus
DNA ladder	Bioneer	D-1037
nTaq polymerase	Enzynomics	P050A
PCR purification kit	LaboPass	CMR0112
PEGylated SMCC crosslinker / SM(PEG)2	ThermoFisher Scientific	22102	For SNARE–DNA coupling
Primer B	Bioneer	5'-Biotin/TCGCCACCATCATTTCCA-3'	For 5-kbp force calibration construct and DNA handles
Primer B_hp	IDT	5'-Biotin/TTTTTTTTTTGTTCTCTATTT TTTTAGAGAAC /AP site/ /AP site/ TCGCCACCATCATTTCCA-3'	For hairpin construct
Primer N	Bioneer	5'-C6Amine/CATGTGGGTGACGCGAAA-3'	For DNA handles
Primer Z	Bioneer	5'-Azide/TCGCCACCATCATTTCCA-3'	For DNA handles
Primer Z_5k	Bioneer	5'-Azide/TTAGAGAGTATGGGTATATGACA TCG-3'	For 5-kbp force calibration construct
Primer Z_hp	Bioneer	5'-Azide/GTGGCAGCATGACACC-3'	For hairpin construct
SYBR Safe DNA Gel Stain	ThermoFisher Scientific	S33102
λ-DNA	Bioneer	D-2510	Template strand for PCR
DNA sequences for SNARE proteins
6×His-tagged SNAP-25b (2-206; capitalized) in pET28a	homemade	tggcgaatgggacgcgccctgtagcggcgca ttaagcgcggcgggtgtggtggttacgcgca gcgtgaccgctacacttgccagcgccctagc gcccgctcctttcgctttcttcccttccttt ctcgccacgttcgccggctttccccgtcaag ctctaaatcgggggctccctttagggttccg atttagtgctttacggcacctcgaccccaaa aaacttgattagggtgatggttcacgtagtg ggccatcgccctgatagacggtttttcgccc tttgacgttggagtccacgttctttaatagt ggactcttgttccaaactggaacaacactca accctatctcggtctattcttttgatttata agggattttgccgatttcggcctattggtta aaaaatgagctgatttaacaaaaatttaacg cgaattttaacaaaatattaacgtttacaat ttcaggtggcacttttcggggaaatgtgcgc ggaacccctatttgtttatttttctaaatac attcaaatatgtatccgctcatgaattaatt cttagaaaaactcatcgagcatcaaatgaaa ctgcaatttattcatatcaggattatcaata ccatatttttgaaaaagccgtttctgtaatg aaggagaaaactcaccgaggcagttccatag gatggcaagatcctggtatcggtctgcgatt ccgactcgtccaacatcaatacaacctatta atttcccctcgtcaaaaataaggttatcaag tgagaaatcaccatgagtgacgactgaatcc ggtgagaatggcaaaagtttatgcatttctt tccagacttgttcaacaggccagccattacg ctcgtcatcaaaatcactcgcatcaaccaaa ccgttattcattcgtgattgcgcctgagcga gacgaaatacgcgatcgctgttaaaaggaca attacaaacaggaatcgaatgcaaccggcgc aggaacactgccagcgcatcaacaatatttt cacctgaatcaggatattcttctaatacctg gaatgctgttttcccggggatcgcagtggtg agtaaccatgcatcatcaggagtacggataa aatgcttgatggtcggaagaggcataaattc cgtcagccagtttagtctgaccatctcatct gtaacatcattggcaacgctacctttgccat gtttcagaaacaactctggcgcatcgggctt cccatacaatcgatagattgtcgcacctgat tgcccgacattatcgcgagcccatttatacc catataaatcagcatccatgttggaatttaa tcgcggcctagagcaagacgtttcccgttga atatggctcataacaccccttgtattactgt ttatgtaagcagacagttttattgttcatga ccaaaatcccttaacgtgagttttcgttcca ctgagcgtcagaccccgtagaaaagatcaaa ggatcttcttgagatcctttttttctgcgcg taatctgctgcttgcaaacaaaaaaaccacc gctaccagcggtggtttgtttgccggatcaa gagctaccaactctttttccgaaggtaactg gcttcagcagagcgcagataccaaatactgt ccttctagtgtagccgtagttaggccaccac ttcaagaactctgtagcaccgcctacatacc tcgctctgctaatcctgttaccagtggctgc tgccagtggcgataagtcgtgtcttaccggg ttggactcaagacgatagttaccggataagg cgcagcggtcgggctgaacggggggttcgtg cacacagcccagcttggagcgaacgacctac accgaactgagatacctacagcgtgagctat gagaaagcgccacgcttcccgaagggagaaa ggcggacaggtatccggtaagcggcagggtc ggaacaggagagcgcacgagggagcttcca gggggaaacgcctggtatctttatagtcctgt cgggtttcgccacctctgacttgagcgtcga tttttgtgatgctcgtcaggggggcggagcc tatggaaaaacgccagcaacgcggccttttt acggttcctggccttttgctggccttttgct cacatgttctttcctgcgttatcccctgatt ctgtggataaccgtattaccgcctttgagtg agctgataccgctcgccgcagccgaacgacc gagcgcagcgagtcagtgagcgaggaagcgg aagagcgcctgatgcggtattttctccttac gcatctgtgcggtatttcacaccgcatatat ggtgcactctcagtacaatctgctctgatgc cgcatagttaagccagtatacactccgctat cgctacgtgactgggtcatggctgcgccccg acacccgccaacacccgctgacgcgccctga cgggcttgtctgctcccggcatccgcttaca gacaagctgtgaccgtctccgggagctgcat gtgtcagaggttttcaccgtcatcaccgaaa cgcgcgaggcagctgcggtaaagctcatcag cgtggtcgtgaagcgattcacagatgtctgc ctgttcatccgcgtccagctcgttgagtttc tccagaagcgttaatgtctggcttctgataa agcgggccatgttaagggcggttttttcctg tttggtcactgatgcctccgtgtaaggggga tttctgttcatgggggtaatgataccgatga aacgagagaggatgctcacgatacgggttac tgatgatgaacatgcccggttactggaacgt tgtgagggtaaacaactggcggtatggatgc ggcgggaccagagaaaaatcactcagggtc aatgccagcgcttcgttaatacagatgtaggt gttccacagggtagccagcagcatcctgcga tgcagatccggaacataatggtgcagggcgc tgacttccgcgtttccagactttacgaaaca cggaaaccgaagaccattcatgttgttgctc aggtcgcagacgttttgcagcagcagtcgct tcacgttcgctcgcgtatcggtgattcattc tgctaaccagtaaggcaaccccgccagccta gccgggtcctcaacgacaggagcacgatcat gcgcacccgtggggccgccatgccggcgata atggcctgcttctcgccgaaacgtttggtgg cgggaccagtgacgaaggcttgagcgagggc gtgcaagattccgaataccgcaagcgacagg ccgatcatcgtcgcgctccagcgaaagcggt cctcgccgaaaatgacccagagcgctgccgg cacctgtcctacgagttgcatgataaagaag acagtcataagtgcggcgacgatagtcatgc cccgcgcccaccggaaggagctgactgggtt gaaggctctcaagggcatcggtcgagatccc ggtgcctaatgagtgagctaacttacattaa ttgcgttgcgctcactgcccgctttccagtc gggaaacctgtcgtgccagctgcattaatga atcggccaacgcgcggggagaggcggtttgc gtattgggcgccagggtggtttttcttttca ccagtgagacgggcaacagctgattgccctt caccgcctggccctgagagagttgcagcaag cggtccacgctggtttgccccagcaggcgaa aatcctgtttgatggtggttaacggcgggat ataacatgagctgtcttcggtatcgtcgtat cccactaccgagatatccgcaccaacgcgca gcccggactcggtaatggcgcgcattgcgcc cagcgccatctgatcgttggcaaccagcatc gcagtgggaacgatgccctcattcagcattt gcatggtttgttgaaaaccggacatggcact ccagtcgccttcccgttccgctatcggctga atttgattgcgagtgagatatttatgccagc cagccagacgcagacgcgccgagacagaa cttaatgggcccgctaacagcgcgatttgctgg tgacccaatgcgaccagatgctccacgccca gtcgcgtaccgtcttcatgggagaaaataat actgttgatgggtgtctggtcagagacatca agaaataacgccggaacattagtgcaggcag cttccacagcaatggcatcctggtcatccag cggatagttaatgatcagcccactgacgcgt tgcgcgagaagattgtgcaccgccgctttac aggcttcgacgccgcttcgttctaccatcga caccaccacgctggcacccagttgatcggcg cgagatttaatcgccgcgacaatttgcgacg gcgcgtgcagggccagactggaggtggcaac gccaatcagcaacgactgtttgcccgccagt tgttgtgccacgcggttgggaatgtaattca gctccgccatcgccgcttccactttttcccg cgttttcgcagaaacgtggctggcctggttc accacgcgggaaacggtctgataagagacac cggcatactctgcgacatcgtataacgttac tggtttcacattcaccaccctgaattgactc tcttccgggcgctatcatgccataccgcgaa aggttttgcgccattcgatggtgtccgggat ctcgacgctctcccttatgcgactcctgcat taggaagcagcccagtagtaggttgaggccg ttgagcaccgccgccgcaaggaatggtgcat gcaaggagatggcgcccaacagtcccccggc cacggggcctgccaccatacccacgccgaaa caagcgctcatgagcccgaagtggcgagccc gatcttccccatcggtgatgtcggcgatata ggcgccagcaaccgcacctgtggcgccggtg atgccggccacgatgcgtccggcgtagagga tcgagatctcgatcccgcgaaattaatacga ctcactataggggaattgtgagcggataaca attcccctctagaaataattttgtttaactt taagaaggagatataccATGGGCAGC AGCCATCATCATCATCATCACA GCAGCGGCCTGGTGCCGCGC GGCAGCCATACTAGCGGAGAT ATCGCCGAGGACGCAGACAT GCGCAATGAGCTGGAGGAGA TGCAGAGGAGGGCTGACCAG CTGGCTGATGAGTCCCTGGA AAGCACCCGTCGCATGCTGC AGCTGGTTGAAGAGAGTAAA GATGCTGGCATCAGGACTTT GGTTATGTTGGATGAGCAAG GCGAACAACTGGAACGCATT GAGGAAGGGATGGACCAAAT CAATAAGGACATGAAAGAAG CAGAAAAGAATTTGACGGAC CTAGGAAAATTCGCCGGCCT TGCCGTGGCCCCCGCCAAC AAGCTTAAATCCAGTGATGC TTACAAAAAAGCCTGGGGC AATAATCAGGATGGAGTAGT GGCCAGCCAGCCTGCCCG TGTGGTGGATGAACGGGAG CAGATGGCCATCAGTGGTG GCTTCATCCGCAGGGTAAC AAATGATGCCCGGGAAAAT GAGATGGATGAGAACCTG GAGCAGGTGAGCGGCATC ATCGGAAACCTCCGCCAC ATGGCTCTAGACATGGGCA ATGAGATTGACACCCAGA ATCGCCAGATCGACAGGA TCATGGAGAAGGCTGATT CCAACAAAACCAGAATTG ATGAAGCCAACCAACGTG CAACAAAGATGCTGGGAA GTGGTTAAggatccgaattcgag ctccgtcgacaagcttgcggccgcactc gagcaccaccaccaccaccactgagat ccggctgctaacaaagcccgaaagga agctgagttggctgctgccaccgctgag caataactagcataaccccttggggcct ctaaacgggtcttgaggggttttttgctga aaggaggaactatatccggat
6×His-tagged VAMP2 (2-97, L32C/I97C; capitalized) in pET28a	homemade	tggcgaatgggacgcgccctgtagcggcgca ttaagcgcggcgggtgtggtggttacgcgca gcgtgaccgctacacttgccagcgccctagc gcccgctcctttcgctttcttcccttccttt ctcgccacgttcgccggctttccccgtcaag ctctaaatcgggggctccctttagggttccg atttagtgctttacggcacctcgaccccaaa aaacttgattagggtgatggttcacgtagtg ggccatcgccctgatagacggtttttcgccc tttgacgttggagtccacgttctttaatagt ggactcttgttccaaactggaacaacactca accctatctcggtctattcttttgatttata agggattttgccgatttcggcctattggtta aaaaatgagctgatttaacaaaaatttaacg cgaattttaacaaaatattaacgtttacaat ttcaggtggcacttttcggggaaatgtgcgc ggaacccctatttgtttatttttctaaatac attcaaatatgtatccgctcatgaattaatt cttagaaaaactcatcgagcatcaaatgaaa ctgcaatttattcatatcaggattatcaata ccatatttttgaaaaagccgtttctgtaatg aaggagaaaactcaccgaggcagttccatag gatggcaagatcctggtatcggtctgcgatt ccgactcgtccaacatcaatacaacctatta atttcccctcgtcaaaaataaggttatcaag tgagaaatcaccatgagtgacgactgaatcc ggtgagaatggcaaaagtttatgcatttctt tccagacttgttcaacaggccagccattacg ctcgtcatcaaaatcactcgcatcaaccaaa ccgttattcattcgtgattgcgcctgagcga gacgaaatacgcgatcgctgttaaaaggaca attacaaacaggaatcgaatgcaaccggcgc aggaacactgccagcgcatcaacaatatttt cacctgaatcaggatattcttctaatacctg gaatgctgttttcccggggatcgcagtggtg agtaaccatgcatcatcaggagtacggataa aatgcttgatggtcggaagaggcataaattc cgtcagccagtttagtctgaccatctcatct gtaacatcattggcaacgctacctttgccat gtttcagaaacaactctggcgcatcgggctt cccatacaatcgatagattgtcgcacctgat tgcccgacattatcgcgagcccatttatacc catataaatcagcatccatgttggaatttaa tcgcggcctagagcaagacgtttcccgttga atatggctcataacaccccttgtattactgt ttatgtaagcagacagttttattgttcatga ccaaaatcccttaacgtgagttttcgttcca ctgagcgtcagaccccgtagaaaagatcaaa ggatcttcttgagatcctttttttctgcgcg taatctgctgcttgcaaacaaaaaaaccacc gctaccagcggtggtttgtttgccggatcaa gagctaccaactctttttccgaaggtaactg gcttcagcagagcgcagataccaaatactgt ccttctagtgtagccgtagttaggccaccac ttcaagaactctgtagcaccgcctacatacc tcgctctgctaatcctgttaccagtggctgc tgccagtggcgataagtcgtgtcttaccggg ttggactcaagacgatagttaccggataagg cgcagcggtcgggctgaacggggggttcgtg cacacagcccagcttggagcgaacgacctac accgaactgagatacctacagcgtgagctatg agaaagcgccacgcttcccgaagggagaaa ggcggacaggtatccggtaagcggcagggtc ggaacaggagagcgcacgagggagcttcca gggggaaacgcctggtatctttatagtcctgt cgggtttcgccacctctgacttgagcgtcga tttttgtgatgctcgtcaggggggcggagcc tatggaaaaacgccagcaacgcggccttttt acggttcctggccttttgctggccttttgct cacatgttctttcctgcgttatcccctgatt ctgtggataaccgtattaccgcctttgagtg agctgataccgctcgccgcagccgaacgacc gagcgcagcgagtcagtgagcgaggaagc ggaagagcgcctgatgcggtattttctccttac gcatctgtgcggtatttcacaccgcatatat ggtgcactctcagtacaatctgctctgatgc cgcatagttaagccagtatacactccgctat cgctacgtgactgggtcatggctgcgccccg acacccgccaacacccgctgacgcgccctga cgggcttgtctgctcccggcatccgcttaca gacaagctgtgaccgtctccgggagctgcat gtgtcagaggttttcaccgtcatcaccgaaa cgcgcgaggcagctgcggtaaagctcatcag cgtggtcgtgaagcgattcacagatgtctgc ctgttcatccgcgtccagctcgttgagtttc tccagaagcgttaatgtctggcttctgataa agcgggccatgttaagggcggttttttcctg tttggtcactgatgcctccgtgtaaggggga tttctgttcatgggggtaatgataccgatga aacgagagaggatgctcacgatacgggttac tgatgatgaacatgcccggttactggaacgt tgtgagggtaaacaactggcggtatggatgc ggcgggaccagagaaaaatcactcagggtc aatgccagcgcttcgttaatacagatgtaggt gttccacagggtagccagcagcatcctgcga tgcagatccggaacataatggtgcagggcgc tgacttccgcgtttccagactttacgaaaca cggaaaccgaagaccattcatgttgttgctc aggtcgcagacgttttgcagcagcagtcgct tcacgttcgctcgcgtatcggtgattcattc tgctaaccagtaaggcaaccccgccagccta gccgggtcctcaacgacaggagcacgatcat gcgcacccgtggggccgccatgccggcgata atggcctgcttctcgccgaaacgtttggtgg cgggaccagtgacgaaggcttgagcgagggc gtgcaagattccgaataccgcaagcgacagg ccgatcatcgtcgcgctccagcgaaagcggt cctcgccgaaaatgacccagagcgctgccgg cacctgtcctacgagttgcatgataaagaag acagtcataagtgcggcgacgatagtcatgc cccgcgcccaccggaaggagctgactgggtt gaaggctctcaagggcatcggtcgagatccc ggtgcctaatgagtgagctaacttacattaa ttgcgttgcgctcactgcccgctttccagtc gggaaacctgtcgtgccagctgcattaatga atcggccaacgcgcggggagaggcggtttgc gtattgggcgccagggtggtttttcttttca ccagtgagacgggcaacagctgattgccctt caccgcctggccctgagagagttgcagcaag cggtccacgctggtttgccccagcaggcgaa aatcctgtttgatggtggttaacggcgggat ataacatgagctgtcttcggtatcgtcgtat cccactaccgagatatccgcaccaacgcgca gcccggactcggtaatggcgcgcattgcgcc cagcgccatctgatcgttggcaaccagcatc gcagtgggaacgatgccctcattcagcattt gcatggtttgttgaaaaccggacatggcact ccagtcgccttcccgttccgctatcggctga atttgattgcgagtgagatatttatgccagc cagccagacgcagacgcgccgagacagaa cttaatgggcccgctaacagcgcgatttgctgg tgacccaatgcgaccagatgctccacgccca gtcgcgtaccgtcttcatgggagaaaataat actgttgatgggtgtctggtcagagacatca agaaataacgccggaacattagtgcaggcag cttccacagcaatggcatcctggtcatccag cggatagttaatgatcagcccactgacgcgt tgcgcgagaagattgtgcaccgccgctttac aggcttcgacgccgcttcgttctaccatcga caccaccacgctggcacccagttgatcggcg cgagatttaatcgccgcgacaatttgcgacg gcgcgtgcagggccagactggaggtggcaac gccaatcagcaacgactgtttgcccgccagt tgttgtgccacgcggttgggaatgtaattca gctccgccatcgccgcttccactttttcccg cgttttcgcagaaacgtggctggcctggttc accacgcgggaaacggtctgataagagacac cggcatactctgcgacatcgtataacgttac tggtttcacattcaccaccctgaattgactc tcttccgggcgctatcatgccataccgcgaa aggttttgcgccattcgatggtgtccgggat ctcgacgctctcccttatgcgactcctgcat taggaagcagcccagtagtaggttgaggccg ttgagcaccgccgccgcaaggaatggtgcat gcaaggagatggcgcccaacagtcccccggc cacggggcctgccaccatacccacgccgaaa caagcgctcatgagcccgaagtggcgagccc gatcttccccatcggtgatgtcggcgatata ggcgccagcaaccgcacctgtggcgccggtg atgccggccacgatgcgtccggcgtagagga tcgagatctcgatcccgcgaaattaatacga ctcactataggggaattgtgagcggataaca attcccctctagaaataattttgtttaactt taagaaggagatataccATGGGCAGC AGCCATCATCATCATCATCAC AGCAGCGGCCTGGTGCCGC GCGGCAGCCATATGGCAGAT CTCTCGGCTACCGCTGCCAC CGTCCCGCCTGCCGCCCCG GCCGGCGAGGGTGGCCCCC CTGCACCTCCTCCAAATCTTA CCAGTAACAGGAGATGCCAG CAGACCCAGGCCCAGGTGG ATGAGGTGGTGGACATCATG AGGGTGAATGTGGACAAGGT CCTGGAGCGAGACCAGAAG CTATCGGAACTGGATGATCG CGCAGATGCCCTCCAGGCA GGGGCCTCCCAGTTTGAAA CAAGTGCAGCCAAGCTCAA GCGCAAATACTGGTGGAAA AACCTCAAGATGATGTGCTA Aggatccgaattcgagctccgtcg acaagcttgcggccgcactcgagcaccacca ccaccaccactgagatccggctgctaacaaa gcccgaaaggaagctgagttggctgctgcca ccgctgagcaataactagcataaccccttgg ggcctctaaacgggtcttgaggggttttttg ctgaaaggaggaactatatccggat
6×His-tagged ΔN-VAMP2 (49–96; capitalized) and Syntaxin-1A (191–267, I202C/I266C; capitalized) in pETDuet-1	homemade	ggggaattgtgagcggataacaattcccctc tagaaataattttgtttaactttaagaagga gatataccATGGGCAGCAGCCATCA TCATCATCATCACAGCAGCGG CCTGGAAGTTCTGTTCCAGGG GCCCGGTAATGTGGACAAGGT CCTGGAGCGAGACCAGAAGCT ATCGGAACTGGATGATCGCGC AGATGCCCTCCAGGCAGGGGC CTCCCAGTTTGAAACAAGTGC AGCCAAGCTCAAGCGCAAATAC TGGTGGAAAAACCTCAAGATGAT GTAAgcggccgcataatgcttaagtcgaaca gaaagtaatcgtattgtacacggccgcataa tcgaaattaatacgactcactataggggaat tgtgagcggataacaattccccatcttagta tattagttaagtataagaaggagatatacat ATGGCCCTCAGTGAGATCGAGA CCAGGCACAGTGAGTGCATC AAGTTGGAGAACAGCATCCG GGAGCTACACGATATGTTCAT GGACATGGCCATGCTGGTGG AGAGCCAGGGGGAGATGATT GACAGGATCGAGTACAATGTG GAACACGCTGTGGACTACGTG GAGAGGGCCGTGTCTGACACC AAGAAGGCCGTCAAGTACCAG AGCAAGGCACGCAGGAAGAA GTGCATGATCTAActcgagtc tggtaaagaaaccgctgctgcgaaatttgaa cgccagcacatggactcgtctactagcgcag cttaattaacctaggctgctgccaccgctga gcaataactagcataaccccttggggcctct aaacgggtcttgaggggttttttgctgaaag gaggaactatatccggattggcgaatgggac gcgccctgtagcggcgcattaagcgcggcgg gtgtggtggttacgcgcagcgtgaccgctac acttgccagcgccctagcgcccgctcctttc gctttcttcccttcctttctcgccacgttcg ccggctttccccgtcaagctctaaatcgggg gctccctttagggttccgatttagtgcttta cggcacctcgaccccaaaaaacttgattagg gtgatggttcacgtagtgggccatcgccctg atagacggtttttcgccctttgacgttggag tccacgttctttaatagtggactcttgttcc aaactggaacaacactcaaccctatctcggt ctattcttttgatttataagggattttgccg atttcggcctattggttaaaaaatgagctga tttaacaaaaatttaacgcgaattttaacaa aatattaacgtttacaatttctggcggcacg atggcatgagattatcaaaaaggatcttcac ctagatccttttaaattaaaaatgaagtttt aaatcaatctaaagtatatatgagtaaactt ggtctgacagttaccaatgcttaatcagtga ggcacctatctcagcgatctgtctatttcgt tcatccatagttgcctgactccccgtcgtgt agataactacgatacgggagggcttaccatc tggccccagtgctgcaatgataccgcgagac ccacgctcaccggctccagatttatcagcaa taaaccagccagccggaagggccgagcgca gaagtggtcctgcaactttatccgcctccatc cagtctattaattgttgccgggaagctagag taagtagttcgccagttaatagtttgcgcaa cgttgttgccattgctacaggcatcgtggtg tcacgctcgtcgtttggtatggcttcattca gctccggttcccaacgatcaaggcgagttac atgatcccccatgttgtgcaaaaaagcggtt agctccttcggtcctccgatcgttgtcagaa gtaagttggccgcagtgttatcactcatggt tatggcagcactgcataattctcttactgtc atgccatccgtaagatgcttttctgtgactg gtgagtactcaaccaagtcattctgagaata gtgtatgcggcgaccgagttgctcttgcccg gcgtcaatacgggataataccgcgccacata gcagaactttaaaagtgctcatcattggaaa acgttcttcggggcgaaaactctcaaggatc ttaccgctgttgagatccagttcgatgtaac ccactcgtgcacccaactgatcttcagcatc ttttactttcaccagcgtttctgggtgagcaaa aacaggaaggcaaaatgccgcaaaaaagg gaataagggcgacacggaaatgttgaatact catactcttcctttttcaatcatgattgaag catttatcagggttattgtctcatgagcgga tacatatttgaatgtatttagaaaaataaac aaataggtcatgaccaaaatcccttaacgtg agttttcgttccactgagcgtcagaccccgt agaaaagatcaaaggatcttcttgagatcct ttttttctgcgcgtaatctgctgcttgcaaa caaaaaaaccaccgctaccagcggtggtttg tttgccggatcaagagctaccaactcttttt ccgaaggtaactggcttcagcagagcgcaga taccaaatactgtccttctagtgtagccgta gttaggccaccacttcaagaactctgtagca ccgcctacatacctcgctctgctaatcctgt taccagtggctgctgccagtggcgataagtc gtgtcttaccgggttggactcaagacgatag ttaccggataaggcgcagcggtcgggctgaa cggggggttcgtgcacacagcccagcttgga gcgaacgacctacaccgaactgagataccta cagcgtgagctatgagaaagcgccacgcttccc gaagggagaaaggcggacaggtatccggta agcggcagggtcggaacaggagagcgcac gagggagcttccagggggaaacgcctggtatc tttatagtcctgtcgggtttcgccacctctg acttgagcgtcgatttttgtgatgctcgtca ggggggcggagcctatggaaaaacgccagc aacgcggcctttttacggttcctggccttttg ctggccttttgctcacatgttctttcctgcg ttatcccctgattctgtggataaccgtatta ccgcctttgagtgagctgataccgctcgccgc agccgaacgaccgagcgcagcgagtcagtg agcgaggaagcggaagagcgcctgatgcgg tattttctccttacgcatctgtgcggtatttc acaccgcatatatggtgcactctcagtacaa tctgctctgatgccgcatagttaagccagta tacactccgctatcgctacgtgactgggtca tggctgcgccccgacacccgccaacacccgc tgacgcgccctgacgggcttgtctgctcccg gcatccgcttacagacaagctgtgaccgtct ccgggagctgcatgtgtcagaggttttcacc gtcatcaccgaaacgcgcgaggcagctgcgg taaagctcatcagcgtggtcgtgaagcgatt cacagatgtctgcctgttcatccgcgtccag ctcgttgagtttctccagaagcgttaatgtc tggcttctgataaagcgggccatgttaaggg cggttttttcctgtttggtcactgatgcctc cgtgtaagggggatttctgttcatgggggta atgataccgatgaaacgagagaggatgctca cgatacgggttactgatgatgaacatgcccg gttactggaacgttgtgagggtaaacaactg gcggtatggatgcggcgggaccagagaaaaa tcactcagggtcaatgccagcgcttcgttaa tacagatgtaggtgttccacagggtagccag cagcatcctgcgatgcagatccggaacataa tggtgcagggcgctgacttccgcgtttccag actttacgaaacacggaaaccgaagaccatt catgttgttgctcaggtcgcagacgttttgc agcagcagtcgcttcacgttcgctcgcgtat cggtgattcattctgctaaccagtaaggcaa ccccgccagcctagccgggtcctcaacgaca ggagcacgatcatgctagtcatgccccgcgc ccaccggaaggagctgactgggttgaaggct ctcaagggcatcggtcgagatcccggtgcct aatgagtgagctaacttacattaattgcgtt gcgctcactgcccgctttccagtcgggaaac ctgtcgtgccagctgcattaatgaatcggcc aacgcgcggggagaggcggtttgcgtattgg gcgccagggtggtttttcttttcaccagtga gacgggcaacagctgattgcccttcaccgcc tggccctgagagagttgcagcaagcggtcca cgctggtttgccccagcaggcgaaaatcctg tttgatggtggttaacggcgggatataacat gagctgtcttcggtatcgtcgtatcccacta ccgagatgtccgcaccaacgcgcagcccgga ctcggtaatggcgcgcattgcgcccagcgcc atctgatcgttggcaaccagcatcgcagtgg gaacgatgccctcattcagcatttgcatggt ttgttgaaaaccggacatggcactccagtcg ccttcccgttccgctatcggctgaatttgat tgcgagtgagatatttatgccagccagccag acgcagacgcgccgagacagaacttaatggg cccgctaacagcgcgatttgctggtgaccca atgcgaccagatgctccacgcccagtcgcgt accgtcttcatgggagaaaataatactgttg atgggtgtctggtcagagacatcaagaaata acgccggaacattagtgcaggcagcttccac agcaatggcatcctggtcatccagcggatag ttaatgatcagcccactgacgcgttgcgcga gaagattgtgcaccgccgctttacaggcttc gacgccgcttcgttctaccatcgacaccacc acgctggcacccagttgatcggcgcgagatt taatcgccgcgacaatttgcgacggcgcgtg cagggccagactggaggtggcaacgccaatc agcaacgactgtttgcccgccagttgttgtg ccacgcggttgggaatgtaattcagctccgc catcgccgcttccactttttcccgcgttttc gcagaaacgtggctggcctggttcaccacgc gggaaacggtctgataagagacaccggcata ctctgcgacatcgtataacgttactggtttc acattcaccaccctgaattgactctcttccg ggcgctatcatgccataccgcgaaaggtttt gcgccattcgatggtgtccgggatctcgacg ctctcccttatgcgactcctgcattaggaag cagcccagtagtaggttgaggccgttgagca ccgccgccgcaaggaatggtgcatgcaagga gatggcgcccaacagtcccccggccacgggg cctgccaccatacccacgccgaaacaagcgc tcatgagcccgaagtggcgagcccgatcttc cccatcggtgatgtcggcgatataggcgcca gcaaccgcacctgtggcgccggtgatgccgg ccacgatgcgtccggcgtagaggatcgagat cgatctcgatcccgcgaaattaatacgactc actata
SNAP-25b (1–206, all C to A; capitalized) in pET28a	homemade	tggcgaatgggacgcgccctgtagcggcgca ttaagcgcggcgggtgtggtggttacgcgca gcgtgaccgctacacttgccagcgccctagc gcccgctcctttcgctttcttcccttccttt ctcgccacgttcgccggctttccccgtcaag ctctaaatcgggggctccctttagggttccg atttagtgctttacggcacctcgaccccaaa aaacttgattagggtgatggttcacgtagtg ggccatcgccctgatagacggtttttcgccc tttgacgttggagtccacgttctttaatagt ggactcttgttccaaactggaacaacactca accctatctcggtctattcttttgatttata agggattttgccgatttcggcctattggtta aaaaatgagctgatttaacaaaaatttaacg cgaattttaacaaaatattaacgtttacaat ttcaggtggcacttttcggggaaatgtgcgc ggaacccctatttgtttatttttctaaatac attcaaatatgtatccgctcatgaattaatt cttagaaaaactcatcgagcatcaaatgaaa ctgcaatttattcatatcaggattatcaata ccatatttttgaaaaagccgtttctgtaatg aaggagaaaactcaccgaggcagttccatag gatggcaagatcctggtatcggtctgcgatt ccgactcgtccaacatcaatacaacctatta atttcccctcgtcaaaaataaggttatcaag tgagaaatcaccatgagtgacgactgaatcc ggtgagaatggcaaaagtttatgcatttctt tccagacttgttcaacaggccagccattacg ctcgtcatcaaaatcactcgcatcaaccaaa ccgttattcattcgtgattgcgcctgagcga gacgaaatacgcgatcgctgttaaaaggaca attacaaacaggaatcgaatgcaaccggcgc aggaacactgccagcgcatcaacaatatttt cacctgaatcaggatattcttctaatacctg gaatgctgttttcccggggatcgcagtggtg agtaaccatgcatcatcaggagtacggataa aatgcttgatggtcggaagaggcataaattc cgtcagccagtttagtctgaccatctcatct gtaacatcattggcaacgctacctttgccat gtttcagaaacaactctggcgcatcgggctt cccatacaatcgatagattgtcgcacctgat tgcccgacattatcgcgagcccatttatacc catataaatcagcatccatgttggaatttaa tcgcggcctagagcaagacgtttcccgttga atatggctcataacaccccttgtattactgt ttatgtaagcagacagttttattgttcatga ccaaaatcccttaacgtgagttttcgttcca ctgagcgtcagaccccgtagaaaagatcaaa ggatcttcttgagatcctttttttctgcgcg taatctgctgcttgcaaacaaaaaaaccacc gctaccagcggtggtttgtttgccggatcaa gagctaccaactctttttccgaaggtaactg gcttcagcagagcgcagataccaaatactgt ccttctagtgtagccgtagttaggccaccac ttcaagaactctgtagcaccgcctacatacc tcgctctgctaatcctgttaccagtggctgc tgccagtggcgataagtcgtgtcttaccggg ttggactcaagacgatagttaccggataagg cgcagcggtcgggctgaacggggggttcgtg cacacagcccagcttggagcgaacgacctac accgaactgagatacctacagcgtgagctatg agaaagcgccacgcttcccgaagggagaaa ggcggacaggtatccggtaagcggcagggtc ggaacaggagagcgcacgagggagcttcc agggggaaacgcctggtatctttatagtcctgt cgggtttcgccacctctgacttgagcgtcga tttttgtgatgctcgtcaggggggcggagcc tatggaaaaacgccagcaacgcggccttttt acggttcctggccttttgctggccttttgct cacatgttctttcctgcgttatcccctgatt ctgtggataaccgtattaccgcctttgagtg agctgataccgctcgccgcagccgaacgacc gagcgcagcgagtcagtgagcgaggaagc ggaagagcgcctgatgcggtattttctccttac gcatctgtgcggtatttcacaccgcatatat ggtgcactctcagtacaatctgctctgatgc cgcatagttaagccagtatacactccgctat cgctacgtgactgggtcatggctgcgccccg acacccgccaacacccgctgacgcgccctga cgggcttgtctgctcccggcatccgcttaca gacaagctgtgaccgtctccgggagctgcat gtgtcagaggttttcaccgtcatcaccgaaa cgcgcgaggcagctgcggtaaagctcatcag cgtggtcgtgaagcgattcacagatgtctgc ctgttcatccgcgtccagctcgttgagtttc tccagaagcgttaatgtctggcttctgataa agcgggccatgttaagggcggttttttcctg tttggtcactgatgcctccgtgtaaggggga tttctgttcatgggggtaatgataccgatga aacgagagaggatgctcacgatacgggttac tgatgatgaacatgcccggttactggaacgt tgtgagggtaaacaactggcggtatggatgc ggcgggaccagagaaaaatcactcagggtc aatgccagcgcttcgttaatacagatgtaggt gttccacagggtagccagcagcatcctgcga tgcagatccggaacataatggtgcagggcgc tgacttccgcgtttccagactttacgaaaca cggaaaccgaagaccattcatgttgttgctc aggtcgcagacgttttgcagcagcagtcgct tcacgttcgctcgcgtatcggtgattcattc tgctaaccagtaaggcaaccccgccagccta gccgggtcctcaacgacaggagcacgatcat gcgcacccgtggggccgccatgccggcgata atggcctgcttctcgccgaaacgtttggtgg cgggaccagtgacgaaggcttgagcgagggc gtgcaagattccgaataccgcaagcgacagg ccgatcatcgtcgcgctccagcgaaagcggt cctcgccgaaaatgacccagagcgctgccgg cacctgtcctacgagttgcatgataaagaag acagtcataagtgcggcgacgatagtcatgc cccgcgcccaccggaaggagctgactgggtt gaaggctctcaagggcatcggtcgagatccc ggtgcctaatgagtgagctaacttacattaa ttgcgttgcgctcactgcccgctttccagtc gggaaacctgtcgtgccagctgcattaatga atcggccaacgcgcggggagaggcggtttgc gtattgggcgccagggtggtttttcttttca ccagtgagacgggcaacagctgattgccctt caccgcctggccctgagagagttgcagcaag cggtccacgctggtttgccccagcaggcgaa aatcctgtttgatggtggttaacggcgggat ataacatgagctgtcttcggtatcgtcgtat cccactaccgagatatccgcaccaacgcgca gcccggactcggtaatggcgcgcattgcgcc cagcgccatctgatcgttggcaaccagcatc gcagtgggaacgatgccctcattcagcattt gcatggtttgttgaaaaccggacatggcact ccagtcgccttcccgttccgctatcggctga atttgattgcgagtgagatatttatgccagc cagccagacgcagacgcgccgagacagaa cttaatgggcccgctaacagcgcgatttgctgg tgacccaatgcgaccagatgctccacgccca gtcgcgtaccgtcttcatgggagaaaataat actgttgatgggtgtctggtcagagacatca agaaataacgccggaacattagtgcaggcag cttccacagcaatggcatcctggtcatccag cggatagttaatgatcagcccactgacgcgt tgcgcgagaagattgtgcaccgccgctttac aggcttcgacgccgcttcgttctaccatcga caccaccacgctggcacccagttgatcggcg cgagatttaatcgccgcgacaatttgcgacg gcgcgtgcagggccagactggaggtggcaac gccaatcagcaacgactgtttgcccgccagt tgttgtgccacgcggttgggaatgtaattca gctccgccatcgccgcttccactttttcccg cgttttcgcagaaacgtggctggcctggttc accacgcgggaaacggtctgataagagacac cggcatactctgcgacatcgtataacgttac tggtttcacattcaccaccctgaattgactc tcttccgggcgctatcatgccataccgcgaa aggttttgcgccattcgatggtgtccgggat ctcgacgctctcccttatgcgactcctgcat taggaagcagcccagtagtaggttgaggccg ttgagcaccgccgccgcaaggaatggtgcat gcaaggagatggcgcccaacagtcccccggc cacggggcctgccaccatacccacgccgaaa caagcgctcatgagcccgaagtggcgagccc gatcttccccatcggtgatgtcggcgatata ggcgccagcaaccgcacctgtggcgccggtg atgccggccacgatgcgtccggcgtagagga tcgagatctcgatcccgcgaaattaatacga ctcactataggggaattgtgagcggataaca attcccctctagaaataattttgtttaactt taagaaggagatataccATGGCCGA GGACGCAGACATGCGCAATG AGCTGGAGGAGATGCAGAGG AGGGCTGACCAGCTGGCTGA TGAGTCCCTGGAAAGCACCC GTCGCATGCTGCAGCTGGTT GAAGAGAGTAAAGATGCTGG CATCAGGACTTTGGTTATGTT GGATGAGCAAGGCGAACAAC TGGAACGCATTGAGGAAGGG ATGGACCAAATCAATAAGGAC ATGAAAGAAGCAGAAAAGAAT TTGACGGACCTAGGAAAATTC GCCGGCCTTGCCGTGGCCCC CGCCAACAAGCTTAAATCCAG TGATGCTTACAAAAAAGCCTG GGGCAATAATCAGGATGGAGT AGTGGCCAGCCAGCCTGCCC GTGTGGTGGATGAACGGGAG CAGATGGCCATCAGTGGTGGC TTCATCCGCAGGGTAACAAAT GATGCCCGGGAAAATGAGATG GATGAGAACCTGGAGCAGGT GAGCGGCATCATCGGAAACCT CCGCCACATGGCTCTAGACAT GGGCAATGAGATTGACACCCA GAATCGCCAGATCGACAGGAT CATGGAGAAGGCTGATTCCAA CAAAACCAGAATTGATGAAGC CAACCAACGTGCAACAAAGAT GCTGGGAAGTGGTTAA ctcgagcaccaccaccaccaccactgag atccggctgctaacaaagcccgaaagga agctgagttggctgctgccaccgctgagc aataactagcataaccccttggggcctc taaacgggtcttgaggggttttttgctgaa aggaggaactatatccggat
Materials for protein purificaiton
2-Mercaptoethanol	SIGMA	M3148-25ML
Agar	LPS Solution	AGA500
Ampicillin, Sodium salt	PLS	AC1043-005-00
Chloramphenicol	PLS	CR1023-050-00
Competent cells (E. coli)	Novagen	70956	Rosetta(DE3)pLysS
Glycerol	SIGMA	G5516-500ML
HEPES	SIGMA	H4034-100G
Hydrochloric acid / HCl	SIGMA	320331-500ML
Imidazole	SIGMA	I2399-100G
Isopropyl β-D-1-thiogalactopyranoside / IPTG	SIGMA	10724815001
Kanamycin Sulfate	PLS	KC1001-005-02
Luria-Bertani (LB) Broth	LPS Solution	LB-05
Ni-NTA resin	Qiagen	30210
PD MiniTrap G-25 (desalting column)	Cytiva	GE28-9180-07	For instructions, see: https://www.cytivalifesciences.com/en/us/shop/chromatography/prepacked-columns/desalting-and-buffer-exchange/pd-minitrap-desalting-columns-with-sephadex-g-25-resin-p-06174
Phenylmethylsulfonyl fluoride / PMSF	ThermoFisher Scientific	36978
Plasmids for SNARE proteins	cloned in house	N/A	Available upon request
Protease inhibitor cocktail	genDEPOT	P3100
Sodium chloride	SIGMA	S5886-500G
Sodium phosphate dibasic / Na2HPO4	SIGMA	S7907-100G
Sodium phosphate monobasic / NaH2PO4	SIGMA	S3139-250G
Tris(2-carboxyethyl)phosphine / TCEP	SIGMA	C4706-2G
Trizma base	SIGMA	T1503-250G
Materials for sample assembly
Biotin-PEG-SVA	LAYSAN BIO	BIO-PEG-SVA-5K-100MG & MPEG-SVA-5K-1g	For PEGylation
Dibenzocyclooctyne-amine / DBCO-NH2	SIGMA	761540-10MG	For bead coating
Double-sided tape	3M	136	For flow cell assembly
Epoxy glue	DEVCON	S-208	For flow cell assembly
Glass coverslip for bottom surface	VWR	48393-251	Rectangular, 60×24 mm, #1.5
Glass coverslip for top surface	VWR	48393-241	Rectangular, 50×24 mm, #1.5
Magnetic bead	ThermoFisher Scientific	14301	Dynabeads M-270 Epoxy, 2.8 μm
mPEG-SVA	LAYSAN BIO	mPEG-SVA 1g	For PEGylation
N,N-Dimethylformamide / DMF	SIGMA	D4551-250ML	For bead coating
N-[3-(trimethoxysilyl)propyl]ethylenediamine	SIGMA	104884-100ML	For PEGylation
Neutravidin	ThermoFisher Scientific	31000	For sample tethering
Phosphate buffered saline / PBS, pH 7.2	PLS	PR2007-100-00
Plastic syringe	Norm-ject	A5	5 ml, luer tip
Polyethylene Tubing	SCI	BB31695-PE/4	PE-60
Reference bead	SPHEROTECH	SVP-30-5	Streptavidin-coated Polystyrene Particles; 3.0-3.4 µm
Syringe needle	Kovax	21G-1 1/4''	21 G
Syringe pump	KD SCIENTIFIC	788210
Equipment for magnetic tweezer instrument
1-axis motorized microtranslation stage	PI	M-126.PD1	For vertical positioning of magnets
2-axis manual translation stage	ST1	LEE400	For alignment of magnets to the optical axis
Acrylic holder for magnets	DaiKwang Precision	custum order	Drawing available upon request
Frame grabber	Active Silicon	AS-FBD-4XCXP6-2PE8
High-speed CMOS camera	Mikrotron	EoSens 3CXP
Inverted microscope	Olympus	IX73P2F-1-2
Neodymium magnets	LG magnet	ND 10x10x12t	Dimension: 10 mm × 10 mm × 12 mm; two needed
Objective lens	Olympus	UPLXAPO100XO	Oil-immersion, NA 1.45
Objective lens nanopositioner	Mad City Labs	Nano-F100S
Rotation stepper motor	AUTONICS	A3K-S545W	For rotating magnets
Superluminescent diode	QPHOTONICS	QSDM-680-2	680 nm
Software
LabVIEW	National Instruments	v20.0f1
MATLAB	MathWorks	v2021a