Systematische, grootschalige synthetische genetische (gen-gen of epistase) interactie schermen kunnen worden gebruikt om genetische redundantie en route overspraak verkennen. Hier hebben we een high-throughput kwantitatieve synthetische genetische scala screening technologie te beschrijven, genoemd eSGA door ons ontwikkelde voor het ophelderen van epistatisch relaties en het verkennen van genetische interactie netwerken in<em> Escherichia coli</em>.
Fenotypen bepaald door een complexe reeks fysieke (bv. eiwit-eiwit) en functionele (bijv. gen-gen of genetische) interacties (GI) 1. Terwijl fysieke interacties kunnen aangeven welke bacteriële eiwitten worden geassocieerd als complexen, doen ze niet per se onthullen pad-level functionele relationships1. GI schermen, waarbij de groei van dubbele mutanten voorzien van twee genen verwijderd of geïnactiveerd wordt gemeten en vergeleken met de overeenkomstige enkelvoudige mutanten kunnen verlichten epistatisch afhankelijkheden tussen loci en dus een middel op te vragen en te ontdekken nieuwe functionele relaties 2. Grootschalige GI maps gemeld voor eukaryote organismen zoals gisten 3-7, maar GI informatie blijft dun voor prokaryoten 8, dat de functionele annotatie van bacteriële genomen belemmert. Hiertoe hebben wij en anderen ontwikkeld high-throughput kwantitatieve bacteriële GI screeningsmethoden 9, 10 </sup>.
Hier presenteren we de belangrijkste stappen die nodig zijn om kwantitatieve E. uit te voeren coli Genetic Synthetic Array (eSGA) screening procedure op genoom-schaal 9, met natuurlijke bacteriële conjugatie en homologe recombinatie systemisch genereren en de geschiktheid van grote aantallen dubbele mutanten in een array formaat kolonie te meten. kort wordt een robot gebruikt voor het doorschakelen , door middel van conjugatie, chlooramfenicol (Cm) – gemarkeerde mutante allelen van engineering HFR (hoge frequentie van recombinatie) "donor stammen 'in een geordende reeks van kanamycine (Kan) – gemarkeerde F-ontvanger stammen. Typische toepassingsgebieden loss-of-function enkele mutanten richting niet-essentieel gen deleties (bijvoorbeeld de 'Keio' collectie 11) en essentiële gen hypomorphic mutaties (bijvoorbeeld allelen verleent verminderde eiwitexpressie stabiliteit of activiteit 9, 12, 13) te bevragen de functionele verenigingen van niet-essentiële en essentiële genen, respectively. Na conjugatie en daaropvolgende genetische uitwisseling gemedieerd door homologe recombinatie worden de resulterende dubbele mutanten geselecteerd op vast medium dat beide antibiotica. Na uitgroei worden de platen digitaal belicht en kolonie maten kwantitatief gescoord op een eigen geautomatiseerde beeldverwerkingsysteem 14. GI's worden onthuld wanneer de groeisnelheid van een dubbele mutant is ofwel significant beter of slechter dan verwachte 9. Verzwarende (of negatieve) GA vaak resulteren tussen loss-of-function mutaties in genen paren van compenserende pathways die van invloed zijn op dezelfde essentiële proces 2. Hier wordt het verlies van een gen gebufferd, zodat zowel enkelvoudige mutant levensvatbaar is. Het verlies van beide routes schadelijk is en resulteert in synthetische letaliteit of ziekte (langzame groei). Omgekeerd kunnen verlichten (of positief) interacties optreden tussen genen in dezelfde route of eiwit complex 2 alsdeletie van beide genen alleen is vaak voldoende om de normale functie van de signalisatieweg of complex zodanig dat aanvullende verstoringen niet activiteit te verminderen, waardoor groei verder verstoren. Overall kan systematisch identificeren en analyseren GI netwerken onpartijdige, wereldkaarten van de functionele samenhang tussen grote aantallen genen, waarvan pathway belangrijke informatie gemist andere benaderingen kunnen worden afgeleid 9.
We hebben geschetst een stapsgewijze protocol voor het gebruik van robotica eSGA screening voor bacteriële gen functies te onderzoeken op een pad niveau door ondervragen GI. Deze benadering kan worden gebruikt om individuele genen alsmede gehele biologische systemen te bestuderen in E. coli. Voorzichtig uitvoeren van de experimentele hierboven beschreven stappen, inclusief alle passende controles en grondig analyseren en onafhankelijk valideren van de gegevens GI belangrijke aspecten voor het succes van eSGA h…
The authors have nothing to disclose.
Dit werk werd ondersteund door de middelen van Genome Canada, de Ontario Genomics Institute, en de Canadese Institutes of Health Research subsidies aan JG en AE AG is een ontvanger van Vanier Canada Graduate Scholarship.
I. Antibiotics | 2 | 36471 Remove |
||||
Chloramphenicol | Bioshop | #CLR201 | 3 | 36472 Remove |
||
Kanamycin | #KAN201 | 4 | 36480 Remove |
|||
Ampicillin | # AMP201 | 5 | 36473 Remove |
|||
2. Luria-Bertani medium | 6 | 36474 Remove |
||||
LB powder | Bioshop | #LBL405 | 7 | 36478 Remove |
||
Agar | Bioshop | #AGR003 | 8 | 36481 Remove |
||
3. Bacterial Strains and Plasmids | 9 | 36475 Remove |
||||
Hfr Cavalli strain λred system (JL238) | Babu et al.14. | 10 | 36476 Remove |
|||
pKD3 | E. coli Genetic Stock Centre, Yale | 11 | 36477 Remove |
|||
Keio E. coli F- recipient collection | National BioResource Project (NBRP) of Japan11 | 12 | 36479 Remove |
|||
Hypomorphic E. coli F- SPA-tag strains | Open biosystems; Babu et al.14 | 13 | 36491 Remove |
|||
4. Primers | 14 | 36486 Remove |
||||
pKD3-based desalted constant primers | F1: 5′-GGCTGACATGGGAATTAGC-3′ R1: 5′-AGATTGCAGCATTACACGTCTT-3′ |
15 | 36482 Remove |
|||
Desalted custom primers | Cm-R: 5′-TTATACGCAAGGCGACAAGG-3′ Cm-F: 5′- GATCTTCCGTCACAGGTAGG-3′ |
16 | 36483 Remove |
|||
Desalted custom primers | F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions F2 constant region: 5′-CATATGAATATCCTCCTTA-3′ R2 constant region: 5′-TGTGTAGGCTGGAGCTGCTTC-3’S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions S1 constant region: 5’AGCTGGAGGATCCATGGAAAAGAGAAG -3′ S2 constant region: 5′- GGCCCCATATGAATATCCTCCTTAGTT -3′ KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential gene SPA-tag insertion site |
17 | 36484 Remove |
|||
5. PCR and Electrophoresis Reagents | 18 | 36485 Remove |
||||
Taq DNA polymerase | Fermentas | # EP0281 | 19 | 36487 Remove |
||
10X PCR buffer | Fermentas | # EP0281 | 20 | 36488 Remove |
||
10 mM dNTPs | Fermentas | # EP0281 | 21 | 36489 Remove |
||
25 mM MgCl2 | Fermentas | # EP0281 | 22 | 36490 Remove |
||
Agarose | Bioshop | # AGA002 | 23 | 36492 Remove |
||
Loading dye | NEB | #B7021S | 24 | 36493 Remove |
||
Ethidium bromide | Bioshop | # ETB444 | 25 | 36497 Remove |
||
10X TBE buffer | Bioshop | # ETB444.10 | 26 | 36494 Remove |
||
Tris Base | Bioshop | # TRS001 | 27 | 36495 Remove |
||
Boric acid | Sigma | # T1503-1KG | 28 | 36496 Remove |
||
0.5 M EDTA (pH 8.0) | Sigma | # B6768-500G | 29 | 36498 Remove |
||
DNA ladder | NEB | #N3232L | 30 | 36499 Remove |
||
6. DNA isolation and Clean-up Kits | 31 | 36500 Remove |
||||
Genomic DNA isolation and purification kit | Promega | #A1120 | 32 | 36501 Remove |
||
Plasmid Midi kit | Qiagen | # 12143 | 33 | 36502 Remove |
||
QIAquick PCR purification kit | Qiagen | #28104 | 34 | 36512 Remove |
||
7. Equipment for PCR, Transformation and Replica-pinning | 35 | 36503 Remove |
||||
Thermal cycler | BioRad, iCycler | 36 | 36504 Remove |
|||
Agarose gel electrophoresis | BioRad | 37 | 36505 Remove |
|||
Electroporator | Bio-Rad GenePulser II | 38 | 36506 Remove |
|||
0.2 cm electroporation cuvette | Bio-Rad | 39 | 36507 Remove |
|||
42 °C water bath shaker | Innova 3100 | 40 | 36508 Remove |
|||
Beckman Coulter TJ-25 centrifuge | Beckman Coulter | 41 | 36519 Remove |
|||
32 °C shaker | New Brunswick Scientific, USA | 42 | 36509 Remove |
|||
32 °C plate incubator | Fisher Scientific | 43 | 36510 Remove |
|||
RoToR-HDA benchtop robot | Singer Instruments | 44 | 36511 Remove |
|||
96, 384 and 1,536 pin density pads | Singer Instruments | 45 | 36513 Remove |
|||
96 or 384 long pins | Singer Instruments | 46 | 36514 Remove |
|||
8. Imaging Equipments | 47 | 36515 Remove |
||||
Camera stand | Kaiser | 48 | 36516 Remove |
|||
Digital camera, 10 megapixel | Any Vendor | 49 | 36517 Remove |
|||
Light boxes, Testrite 16″ x 24″ units | Testrite | 50 | 36527 Remove |
|||
9. Pads or Plates Recycling | 51 | 36518 Remove |
||||
10% bleach | Any Vendor | 52 | 36520 Remove |
|||
70% ethanol | Any Vendor | 53 | 36521 Remove |
|||
Sterile distilled water | Any Vendor | 54 | 36522 Remove |
|||
Flow hood | Any Vendor | 55 | 36523 Remove |
|||
Ultraviolet lamp | Any Vendor | 56 | 36524 Remove |
|||
10. Labware | 57 | 36525 Remove |
||||
50 ml polypropylene tubes | Any Vendor | 58 | 36526 Remove |
|||
1.5 ml micro-centrifuge tubes | Any Vendor | 59 | 36528 Remove |
|||
250 ml conical flaks | VWR | # 29140-045 | 60 | 36529 Remove |
||
15 ml sterile culture tubes | Thermo Scientific | # 366052 | 61 | 36530 Remove |
||
Cryogenic vials | VWR | # 479-3221 | 62 | 36531 Remove |
||
Rectangular Plates | Singer Instruments | 63 | 36532 Remove |
|||
96-well and 384-well microtitre plates | Singer Instruments | Nunc | 64 | 36533 Remove |
||
Plate roller for sealing multi-well | Sigma | #R1275 | 65 | 36535 Remove |
||
plates | ABgene | # AB-0580 | 66 | 36534 Remove |
||
Adhesive plate seals | Fisher Scientific | # 13-990-14 | 67 | 36537 Remove |
||
-80 °C freezer | Any Vendor | 68 | 36536 Remove |