A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

46.3K views

DOI:

10.3791/4056

November 12th, 2012

* These authors contributed equally

In This Article

Summary

Systematic, large-scale synthetic genetic (gene-gene or epistasis) interaction screens can be used to explore genetic redundancy and pathway cross-talk. Here, we describe a high-throughput quantitative synthetic genetic array screening technology, termed eSGA that we developed for elucidating epistatic relationships and exploring genetic interaction networks in Escherichia coli.

Abstract

Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10.

Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) - marked mutant alleles from engineered Hfr (High frequency of recombination) 'donor strains' into an ordered array of kanamycin (Kan) - marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the 'Keio' collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.

Protocol

1. Constructing Hfr Cavalli Donor Mutant Strains by Recombineering15, 16

The steps for constructing the eSGA donor stains are described below. Briefly, we use targeted λ- Red mediated homologous recombination16 of amplified selectable DNA marker cassette fragments generated by PCR to create non-essential gene deletion mutants (section 1.1) or essential gene hypomorphic mutant donor strains (section 1.2) that are then used as 'queries' to define GI networks.

Note: During the technology development process, we assessed the effectiveness of using Hfr-mediated....

Access restricted. Please log in or start a trial to view this content.

Results

GIs reveal functional relationships between genes. Similarly, since genes in the same pathway display similar GI patterns and the GI profile similarity represents the congruency of phenotypes, we can group functionally related genes into pathways by clustering their GI profiles. Integrating GI and GI correlation networks with physical interaction information or other association data, such as genomic context (GC) relationships can also reveal the organization of higher-order functional modules that define core bio.......

Access restricted. Please log in or start a trial to view this content.

Discussion

We have outlined a step-wise protocol for using robotic eSGA screening to investigate bacterial gene functions at a pathway level by interrogating GI. This approach can be used to study individual genes as well as entire biological systems in E. coli. Carefully executing the experimental steps described above, including all appropriate controls, and rigorously analyzing and independently validating the GI data are key aspects for the success of eSGA in making new functional discoveries. In addition to eS.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

No conflicts of interest declared.

Acknowledgements

This work was supported by funds from Genome Canada, the Ontario Genomics Institute, and the Canadian Institutes of Health Research grants to J.G. and A.E. AG is a recipient of Vanier Canada Graduate Scholarship.

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
I. Antibiotics
ChloramphenicolBioshop#CLR201
Kanamycin#KAN201
Ampicillin# AMP201
2. Luria-Bertani medium
LB powderBioshop#LBL405
AgarBioshop#AGR003
3. Bacterial Strains and Plasmids
Hfr Cavalli strain λred system (JL238)Babu et al.14.
pKD3E. coli Genetic Stock Centre, Yale
Keio E. coli F- recipient collectionNational BioResource Project (NBRP) of Japan11
Hypomorphic E. coli F- SPA-tag strainsOpen biosystems; Babu et al.14
4. Primers
pKD3-based desalted constant primersF1: 5'-GGCTGACATGGGAATTAGC-3'
R1: 5'-AGATTGCAGCATTACACGTCTT-3'
Desalted custom primersCm-R: 5'-TTATACGCAAGGCGACAAGG-3'
Cm-F: 5'- GATCTTCCGTCACAGGTAGG-3'
Desalted custom primersF2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions
F2 constant region:
5'-CATATGAATATCCTCCTTA-3'
R2 constant region:
5'-TGTGTAGGCTGGAGCTGCTTC-3'S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions
S1 constant region:
5'AGCTGGAGGATCCATGGAAAAGAGAAG -3'
S2 constant region:
5'- GGCCCCATATGAATATCCTCCTTAGTT -3'

KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential
gene SPA-tag insertion site
5. PCR and Electrophoresis Reagents
Taq DNA polymeraseFermentas# EP0281
10X PCR bufferFermentas# EP0281
10 mM dNTPsFermentas# EP0281
25 mM MgCl2Fermentas# EP0281
AgaroseBioshop# AGA002
Loading dyeNEB#B7021S
Ethidium bromideBioshop# ETB444
10X TBE bufferBioshop# ETB444.10
Tris BaseBioshop# TRS001
Boric acidSigma# T1503-1KG
0.5 M EDTA (pH 8.0)Sigma# B6768-500G
DNA ladderNEB#N3232L
6. DNA isolation and Clean-up Kits
Genomic DNA isolation and purification kitPromega#A1120
Plasmid Midi kitQiagen# 12143
QIAquick PCR purification kitQiagen#28104
7. Equipment for PCR, Transformation and Replica-pinning
Thermal cyclerBioRad, iCycler
Agarose gel electrophoresisBioRad
ElectroporatorBio-Rad GenePulser II
0.2 cm electroporation cuvetteBio-Rad
42 °C water bath shakerInnova 3100
Beckman Coulter TJ-25 centrifugeBeckman Coulter
32 °C shakerNew Brunswick Scientific, USA
32 °C plate incubatorFisher Scientific
RoToR-HDA benchtop robotSinger Instruments
96, 384 and 1,536 pin density padsSinger Instruments
96 or 384 long pinsSinger Instruments
8. Imaging Equipments
Camera standKaiser
Digital camera, 10 megapixelAny Vendor
Light boxes, Testrite 16" x 24" unitsTestrite
9. Pads or Plates Recycling
10% bleachAny Vendor
70% ethanolAny Vendor
Sterile distilled waterAny Vendor
Flow hoodAny Vendor
Ultraviolet lampAny Vendor
10. Labware
50 ml polypropylene tubesAny Vendor
1.5 ml micro-centrifuge tubesAny Vendor
250 ml conical flaksVWR# 29140-045
15 ml sterile culture tubesThermo Scientific# 366052
Cryogenic vialsVWR# 479-3221
Rectangular PlatesSinger Instruments
96-well and 384-well microtitre platesSinger InstrumentsNunc
Plate roller for sealing multi-wellSigma#R1275
platesABgene# AB-0580
Adhesive plate sealsFisher Scientific# 13-990-14
-80 °C freezerAny Vendor

References

  1. Bandyopadhyay, S., Kelley, R., Krogan, N. J., Ideker, T. Functional maps of protein complexes from quantitative genetic interaction data. PLoS Comput. Biol. 4, e1000065(2008).
  2. Costanzo, M., Baryshnikova, A., Myers, C. L., Andrews, B., Boone, C. Charting the genetic interaction....

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Synthetic Genetic ArrayGenetic Interaction ScreeningColony Array FormatDouble Mutant AnalysisAutomated Image ProcessingChloramphenicol SelectionKanamycin SelectionHomologous RecombinationFitness Quantification