Systematiske, store syntetiske genetiske (gen-gen eller epistasis) interaksjon skjermer kan brukes til å utforske genetisk redundans og sti krysstale. Her beskriver vi en high-throughput kvantitative syntetisk genetisk rekke screening teknologien, kalt eSGA som vi utviklet for å belyse epistatic relasjoner og utforske genetiske interaksjon nettverk i<em> Escherichia coli</em>.
Fenotyper bestemmes av en kompleks serie av fysiske (f.eks protein-protein) og funksjonell (f.eks gen-gen eller genetisk) interaksjoner (GI) en. Mens fysiske interaksjoner kan indikere hvilke bakterielle proteiner er assosiert som komplekser, har de ikke nødvendigvis avsløre sti-nivå funksjonelle relationships1. GI skjermer, der veksten av doble mutanter bærer to slettede eller inaktiverte gener måles og sammenlignet med de tilsvarende enkle mutanter, kan belyse epistatic avhengigheter mellom loci og dermed gi et middel for å søke og oppdage nye funksjonelle relasjoner 2. Storskala GI kartene har blitt rapportert for eukaryote organismer som gjær 3-7, men GI informasjon forblir sparsom for 8 prokaryoter, som hindrer funksjonell annotering av bakterielle genomer. Til dette formål har vi og andre utviklet høy gjennomstrømming kvantitative bakterielle GI rastreringsmetoder 9, 10 </sup>.
Her presenterer vi de viktigste trinnene som kreves for å utføre kvantitativ E. coli Syntetisk Genetisk Array (eSGA) screening prosedyren på en genom-skala 9, ved hjelp av naturlig bakteriell konjugering og homolog rekombinasjon til systemisk generere og måle egnethet av et stort antall doble mutanter i en koloni matrise format. korthet blir en robot som brukes til å overføre , gjennom konjugering, kloramfenikol (cm) – merket mutant alleler fra konstruerte Hfr (Høy frekvens av rekombinasjon) 'donor stammer' i en ordnet rekke av kanamycin (Kan) – merkede F-mottaker stammer. Vanligvis bruker vi tap av funksjon enkelt mutanter bærer ikke-essensielle genet slettinger (f.eks 'Keio' samling 11) og essensielle genet hypomorphic mutasjoner (dvs. alleler overdragelse redusert protein uttrykk, stabilitet eller aktivitet 9, 12, 13) til spørre de funksjonelle assosiasjoner til ikke-essensielle og viktige gener, respectively. Etter konjugering og påfølgende genetisk utveksling mediert ved homolog rekombinasjon, blir de resulterende doble mutanter valgt på fast medium som inneholder både antibiotika. Etter utvekst, platene digitalt fotografert og koloni størrelser er kvantitativt scoret ved hjelp av en in-house automatisert bildebehandlingssystem 14. Soldater blir avslørt da veksten av en dobbel mutant er enten vesentlig bedre eller verre enn forventet 9. Skjerpende (eller negative) soldater ofte resultere mellom tap av funksjon mutasjoner i par av gener fra kompenserende veier som har betydning for den samme viktig prosess 2. Her, er tapet av et enkelt gen bufret, slik at enten enkelt mutant er levedyktig. Imidlertid er tap av begge trasé deleterious og resulterer i syntetisk letalitet eller sykdom (dvs. langsom vekst). Omvendt kan lindre (eller positiv) interaksjoner forekomme mellom gener i den samme sti eller protein kompleks 2 somsletting av enten genet alene er ofte tilstrekkelig til å forurolige normal funksjon av veien eller komplekse, slik at ytterligere perturbasjoner ikke reduserer aktiviteten og dermed vekst, ytterligere. Samlet, kan systematisk å identifisere og analysere GI nettverk gir deg objektive, globale kart over de funksjonelle relasjoner mellom et stort antall gener, som sti-nivå informasjon savnet av andre tilnærminger kan utledes 9.
Vi har skissert en trinnvis protokoll for bruk av robot eSGA screening for å undersøke bakterielle genfunksjoner på en sti nivå ved avhør GI. Denne tilnærmingen kan brukes for å studere enkelte gener samt hele biologiske systemer i E. coli. Nøye gjennomføre de eksperimentelle trinnene beskrevet ovenfor, inkludert alle nødvendige kontroller, og strengt analysere og uavhengig validere GI data er viktige aspekter for å lykkes med eSGA i å gjøre nye funksjonelle funn. I tillegg til eSGA, en konseptuelt…
The authors have nothing to disclose.
Dette arbeidet ble støttet av midler fra Genome Canada, Ontario Genomics Institute, og den kanadiske Institutes of Health Research tilskudd til JG og AE AG er en mottaker av Vanier Canada Graduate Scholarship.
I. Antibiotics | 2 | 36471 Remove |
||||
Chloramphenicol | Bioshop | #CLR201 | 3 | 36472 Remove |
||
Kanamycin | #KAN201 | 4 | 36480 Remove |
|||
Ampicillin | # AMP201 | 5 | 36473 Remove |
|||
2. Luria-Bertani medium | 6 | 36474 Remove |
||||
LB powder | Bioshop | #LBL405 | 7 | 36478 Remove |
||
Agar | Bioshop | #AGR003 | 8 | 36481 Remove |
||
3. Bacterial Strains and Plasmids | 9 | 36475 Remove |
||||
Hfr Cavalli strain λred system (JL238) | Babu et al.14. | 10 | 36476 Remove |
|||
pKD3 | E. coli Genetic Stock Centre, Yale | 11 | 36477 Remove |
|||
Keio E. coli F- recipient collection | National BioResource Project (NBRP) of Japan11 | 12 | 36479 Remove |
|||
Hypomorphic E. coli F- SPA-tag strains | Open biosystems; Babu et al.14 | 13 | 36491 Remove |
|||
4. Primers | 14 | 36486 Remove |
||||
pKD3-based desalted constant primers | F1: 5′-GGCTGACATGGGAATTAGC-3′ R1: 5′-AGATTGCAGCATTACACGTCTT-3′ |
15 | 36482 Remove |
|||
Desalted custom primers | Cm-R: 5′-TTATACGCAAGGCGACAAGG-3′ Cm-F: 5′- GATCTTCCGTCACAGGTAGG-3′ |
16 | 36483 Remove |
|||
Desalted custom primers | F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions F2 constant region: 5′-CATATGAATATCCTCCTTA-3′ R2 constant region: 5′-TGTGTAGGCTGGAGCTGCTTC-3’S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions S1 constant region: 5’AGCTGGAGGATCCATGGAAAAGAGAAG -3′ S2 constant region: 5′- GGCCCCATATGAATATCCTCCTTAGTT -3′ KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential gene SPA-tag insertion site |
17 | 36484 Remove |
|||
5. PCR and Electrophoresis Reagents | 18 | 36485 Remove |
||||
Taq DNA polymerase | Fermentas | # EP0281 | 19 | 36487 Remove |
||
10X PCR buffer | Fermentas | # EP0281 | 20 | 36488 Remove |
||
10 mM dNTPs | Fermentas | # EP0281 | 21 | 36489 Remove |
||
25 mM MgCl2 | Fermentas | # EP0281 | 22 | 36490 Remove |
||
Agarose | Bioshop | # AGA002 | 23 | 36492 Remove |
||
Loading dye | NEB | #B7021S | 24 | 36493 Remove |
||
Ethidium bromide | Bioshop | # ETB444 | 25 | 36497 Remove |
||
10X TBE buffer | Bioshop | # ETB444.10 | 26 | 36494 Remove |
||
Tris Base | Bioshop | # TRS001 | 27 | 36495 Remove |
||
Boric acid | Sigma | # T1503-1KG | 28 | 36496 Remove |
||
0.5 M EDTA (pH 8.0) | Sigma | # B6768-500G | 29 | 36498 Remove |
||
DNA ladder | NEB | #N3232L | 30 | 36499 Remove |
||
6. DNA isolation and Clean-up Kits | 31 | 36500 Remove |
||||
Genomic DNA isolation and purification kit | Promega | #A1120 | 32 | 36501 Remove |
||
Plasmid Midi kit | Qiagen | # 12143 | 33 | 36502 Remove |
||
QIAquick PCR purification kit | Qiagen | #28104 | 34 | 36512 Remove |
||
7. Equipment for PCR, Transformation and Replica-pinning | 35 | 36503 Remove |
||||
Thermal cycler | BioRad, iCycler | 36 | 36504 Remove |
|||
Agarose gel electrophoresis | BioRad | 37 | 36505 Remove |
|||
Electroporator | Bio-Rad GenePulser II | 38 | 36506 Remove |
|||
0.2 cm electroporation cuvette | Bio-Rad | 39 | 36507 Remove |
|||
42 °C water bath shaker | Innova 3100 | 40 | 36508 Remove |
|||
Beckman Coulter TJ-25 centrifuge | Beckman Coulter | 41 | 36519 Remove |
|||
32 °C shaker | New Brunswick Scientific, USA | 42 | 36509 Remove |
|||
32 °C plate incubator | Fisher Scientific | 43 | 36510 Remove |
|||
RoToR-HDA benchtop robot | Singer Instruments | 44 | 36511 Remove |
|||
96, 384 and 1,536 pin density pads | Singer Instruments | 45 | 36513 Remove |
|||
96 or 384 long pins | Singer Instruments | 46 | 36514 Remove |
|||
8. Imaging Equipments | 47 | 36515 Remove |
||||
Camera stand | Kaiser | 48 | 36516 Remove |
|||
Digital camera, 10 megapixel | Any Vendor | 49 | 36517 Remove |
|||
Light boxes, Testrite 16″ x 24″ units | Testrite | 50 | 36527 Remove |
|||
9. Pads or Plates Recycling | 51 | 36518 Remove |
||||
10% bleach | Any Vendor | 52 | 36520 Remove |
|||
70% ethanol | Any Vendor | 53 | 36521 Remove |
|||
Sterile distilled water | Any Vendor | 54 | 36522 Remove |
|||
Flow hood | Any Vendor | 55 | 36523 Remove |
|||
Ultraviolet lamp | Any Vendor | 56 | 36524 Remove |
|||
10. Labware | 57 | 36525 Remove |
||||
50 ml polypropylene tubes | Any Vendor | 58 | 36526 Remove |
|||
1.5 ml micro-centrifuge tubes | Any Vendor | 59 | 36528 Remove |
|||
250 ml conical flaks | VWR | # 29140-045 | 60 | 36529 Remove |
||
15 ml sterile culture tubes | Thermo Scientific | # 366052 | 61 | 36530 Remove |
||
Cryogenic vials | VWR | # 479-3221 | 62 | 36531 Remove |
||
Rectangular Plates | Singer Instruments | 63 | 36532 Remove |
|||
96-well and 384-well microtitre plates | Singer Instruments | Nunc | 64 | 36533 Remove |
||
Plate roller for sealing multi-well | Sigma | #R1275 | 65 | 36535 Remove |
||
plates | ABgene | # AB-0580 | 66 | 36534 Remove |
||
Adhesive plate seals | Fisher Scientific | # 13-990-14 | 67 | 36537 Remove |
||
-80 °C freezer | Any Vendor | 68 | 36536 Remove |