Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

3' eind Sequencing bibliotheek voorbereiding met A-seq2

doi: 10.3791/56129 Published: October 10, 2017

Summary

Dit protocol beschrijft een methode voor de toewijzing pre-mRNA 3' eind verwerking van sites.

Abstract

Studies in de afgelopen tien jaar is gebleken een complex en dynamisch scala aan pre-mRNA decollete en polyadenylatie reacties. mRNAs met lang 3' onvertaald regio's (UTRs) worden gegenereerd in gedifferentieerde cellen overwegende dat delende cellen bij voorkeur express chat-kopieën met korte 3' UTRs. We beschrijven het A-seq-protocol, nu bij de tweede versie, die werd ontwikkeld om de kaart van de polyadenylatie sites genoom-brede en bestuderen van de verordening van pre-mRNA 3' eind verwerking. Ook maakt dit huidige protocol gebruik van de polyadenylate (poly(A)) staart die tijdens de biogenese van meest zoogdieren mRNAs te verrijken voor volledig verwerkte mRNAs worden toegevoegd. Een DNA-adapter met deoxyuracil op de vierde positie kan de precieze verwerking van mRNA 3' eind fragmenten voor het rangschikken. Exclusief de celcultuur en de nachtelijke ligations, het protocol vereist ongeveer 8 h hands-on tijd. Samen met het vindt u een easy-to-use softwarepakket voor de analyse van de afgeleide sequencing-gegevens. A-seq2 en de bijbehorende analysesoftware zorgen voor een efficiënte en betrouwbare oplossing voor de toewijzing van pre-mRNA 3' eindigt in een brede waaier van voorwaarden, van 106 of minder cellen.

Introduction

De vangst en de sequencing van mRNA 3' einden maakt de studie van mRNA verwerking en de kwantificering van de genexpressie. Als gevolg van hun poly(A) staarten, kan eukaryote mRNAs gezuiverd worden efficiënt uit de cel Totaal lysates met kraal-geïmmobiliseerd oligo-deoxythymidine (oligo(dT)) moleculen, die kan ook prime cDNA synthese. Deze benadering heeft echter twee nadelen. Eerst, kunnen stukken van de A's die intern de uitgeschreven zijn ook prime cDNA synthese, resulterend in valse poly(A) sites. De rek van de tweede, homogene poly(A) vormen specifieke uitdagingen voor de sequencing, afgezien van niet informatief voor transcript identificatie. Verschillende benaderingen hebben voorgesteld te omzeilen deze beperkingen, zoals omgekeerde transcriptie via poly(A) staarten gevolgd door RNase H spijsvertering (3 P-seq 1), gebruik van een primer van de aangepaste volgorde die eindigt op 20 Ts (2 P-seq 2), preselectie van De fragmenten van RNA met de staart van de poly(A) van meer dan 50 nucleotiden met een CU5T45 primer gevolgd door RNase H spijsvertering (3' leest 3), en het gebruik van een primer oligo-dT, waarin de 3'-adapter in een haarspeld (A-seq 4).

De onlangs ontwikkelde methode A-seq2- 5 wil omzeilen sequencing via poly(A) en op hetzelfde moment te minimaliseren van het aantal Dimeren die worden gegenereerd door de zelf-Afbinding van adapters, met name die zich voordoen wanneer de molaire concentratie van adapters opweegt tegen de concentratie invoegen. Dit probleem kan worden geëlimineerd wanneer beide adapters als ligatuur zijn verbonden aan het zelfde type van polynucleotide eindigt zoals A-seq2, waar de 3'-adapters als ligatuur zijn verbonden aan het einde 5' van de fragmenten van RNA en de adapters 5' aan 5' einden van de cDNAs na omgekeerde transcriptie. De methode meer is handiger dan onze eerder voorgestelde A-seq - in die volgorde in de 5'-tot-3 was ' richting waardoor juist gecontroleerd RNA fragmentatie-, terwijl het handhaven van een hoge nauwkeurigheid van de identificatie poly(A). Ongeveer 80% van de gesequenceerd luidt in typische monsters kaart uniek aan het genoom en leiden tot identificatie van meer dan 20.000 poly(A) site clusters, meer dan 70% van die overlapping met geannoteerde 3' UTRs.

Kortom, begint het A-seq2-protocol met mRNA fragmentatie en Afbinding van omgekeerde-aanvulling 3' adapters aan de 5' einden van de fragmenten van RNA. Poly (A)-met RNAs worden vervolgens reverse transcriptie met een 25 nucleotide (nt) lange oligo(dT) primer waarin een nucleotide anker aan de 3'-eind, een dU op positie 4 en een Biotine eind 5', waardoor binding van cDNA aan magnetische daar kralen. Allermeest naar de primer, met inbegrip van de biotine, wordt verwijderd uit de cDNA door decollete in dU door de gebruiker enzym mix, met Uracil DNA glycosylase (UDG) en het DNA glycosylase-lyase Endonuclease VIII. Deze reactie laat intact uiteinden voor de afbinding van een 5'-adapter, en drie Ts links na splitsing blijven ter gelegenheid van de locatie van de poly(A) staart. Omdat zowel 5' en 3' adapters zijn aangesloten door afbinding aan geadresseerden 5' einden, worden geen adapter-Dimeren gegenereerd. Vier nucleotide willekeurige-mers geïntroduceerd aan het begin van leest cluster resolutie staat op volgorde van de state-of-the-art instrumenten en kan ook dienen als moleculaire eenduidig (UMI) voor het detecteren en verwijderen van PCR versterking artefacten. De grootte van het UMI kan verder worden verhoogd, zoals in andere studies 6gedaan. Het protocol genereert leest dat complementair is aan mRNA 3' einden, allemaal beginnen met een gerandomiseerde tetrameer gevolgd door 3 Ts. verwerking van luidt dat de 3 diagnostische Ts hebben op hun einde begint 5' met de correctie van PCR versterking artefacten door zijn afgewikkeld exploitatie van de UMIs, verwijdering van 3' adapter sequenties, en reverse complementatie. Leest dat hebben afkomstig van oligo(dT) priming op interne A-rijke sites is kunnen zijn ook rekenkundig geïdentificeerd en verwijderd. De valse sites ontbreken doorgaans een van de 18 goed gekarakteriseerd en geconserveerde poly(A) signalen die moeten gelegen ~ 21 nucleotiden stroomopwaarts van de schijnbare decollete site 7.

Het protocol vereist ongeveer 8 h hands-on tijd, niet tellen celkweek en de nachtelijke ligations. De bijbehorende Lees analyse software een zeer nauwkeurige poly(A) site identificatie mogelijk maakt. Vanaf de site van poly(A) clusters gemaakt op basis van 4 monsters verder benadrukt in dit manuscript (twee biologische replicatieonderzoeken van controle siRNA en si-HNRNPC-testgroep cellen) 84% overlapping met een geannoteerde gen, en daarvan 75% overlappen met een 3-' UTR, en 86% met ofwel een 3' UTR of een terminal exon. De Pearson-correlatiecoëfficiënt van expressie van 3' einden in de analysemonsters is 0.92 en waarden van meer dan 0,9 worden meestal verkregen met de methode. A-seq2 is dus een handige methode die zeer reproduceerbare resultaten geeft.

Protocol

1. celgroei en mRNA isolatie

  1. groeien van cellen volgens uw proefopzet in 6-Wells-platen op ~ 1 x 10 6 cellen per putje aan 80% samenvloeiing.
  2. Verwijder het groeimedium en wassen de cellen eenmaal met fosfaat gebufferde zoutoplossing. Lyse de cellen op de plaat direct door toevoeging van 1 mL lysisbuffermengsel uit de mRNA-isolatie kit. Overdracht van de viskeuze lysate in een buis 15 mL kunststof met een 1 mL pipet tip. Gebruik van een rubberspatel om volledig los van het materiaal van de cel van het oppervlak van de plaat te.
  3. Shear lysate met viskeuze DNA met een spuit van 1 mL gekoppeld aan een 23 G hypodermische naald door verschillende krachtig op en neer bewegingen van de zuiger totdat de lysate niet langer viskeus is. Punt van de naald van de spuit naar het midden van de bodem om te voorkomen dat de lysate uit de buis uitwerpen.
  4. Breng de lysate in een tube van 1,5 mL met behulp van de spuit. Spin 5 min op 20.000 x g en 4 ° C tot het verwijderen van het puin. Gebruik van DNA lage bind 1,5 mL flesjes in het gehele protocol.
  5. Terwijl de centrifuge draait, wassen 300 µL van de geresuspendeerde oligo (dT) 25 magnetische kralen op een magnetische rek met 500 µL van lysis buffer. Meng de buizen 2 - 3 keer op het rek. Verwijder de buffer nadat de oplossing duidelijk is. Verzamelen van het supernatans dat duidelijk uit stap 1.4 en toevoegen aan de kralen. Resuspendeer en plaats van buizen op een roterend wiel voor 10 min.
  6. Plaats de buizen op een magnetische rek. De duidelijke vloeistof afzuigen na 2 min. toevoegen 0.8 mL buffer A uit de mRNA-isolatie kit. Draai de buis 180° graden op het rek, 2 - 3 keer. Herhaal deze stap wassen nogmaals met buffer A.
  7. Wassen van de kralen 2 keer met 0,8 mL buffer B zoals beschreven in stap 1.6.
  8. Naar elueer de afhankelijke mRNA van de kralen, voeg 33 µL H 2 O en resuspendeer de kralen. Verwarm tot 75 ° C gedurende 5 minuten op een verwarmd blok. Onmiddellijk spin de buizen voor 1 s en plaats ze op de magnetische rek. Het supernatant overbrengen in een nieuwe buis. Monsters kunnen worden opgeslagen bij-80 ° C tot verder gebruik.
  9. Toevoegen 66 µL alkalische hydrolyse buffer tot en met de 33 µL mRNA (stap 1.8), meng en warmte voor precies 5 min bij 95 ° C op een blok van de verwarming. Onmiddellijk chill buizen op ice.
  10. Isoleren met een RNA opruimen kit RNA.
    Opmerking: Bevestigen het volume; het moet 100 µL.
    1. Toevoegen 350 µL RLT buffer van de kit en 250 µL ethanol. Belasting op de kolom en de spin voor 30 s bij 8.000 x g bij kamertemperatuur (RT). Wassen met 500 µL RPE buffer uit de kit. Wassen met 500 µL 80% ethanol. Spin voor 5 min op 20.000 x g te drogen van de kolom. 36 µL H 2 O aan kolom toevoegen en spin voor 1 min op 20.000 x g. de kolom verwijderen en opslaan van het eluaat.

2. 5 ' einde fosforylatie en DNase behandeling

  1. toevoegen 5 µL polynucleotide kinase buffer, 5 µL 10 mM ATP, 1 µL ribonuclease remmer, 1 µL DNase en 2 µL polynucleotide kinase aan monsters en Incubeer bij 37 ° C voor 30 min. bereid eventueel master reactie mixen in het gehele protocol door het mengen van 1.1 volumes x n (n = aantal monsters) van elke component.
  2. Buffer wijzigen en verwijderen van ATP in een spin-kolom om te voorkomen dat poly(A) toevoeging in de volgende stap.
    1. Prespin spin-kolommen bij 735 x g gedurende 1 min. overbrengen van de kolommen naar de nieuwe 1,5 mL flesjes en laden de kinase reacties op de kolommen. Draai de kolommen 2 min op 735 x g. de kolommen verwijderen en plaatsen van de buizen met verzamelde reacties op ijs of bewaren bij -80 ° C.

3. Blokkeren van 3 ' eindigt met Cordycepin trifosfaat

Opmerking: het is essentieel voor het blokkeren van de 3 ' uiteinden van RNA fragmenten om te voorkomen dat hun concatemerization in het daaropvolgende afbinding reacties. 3 ' uiteinden die niet reeds zijn geblokkeerd door een () cyclische) fosfaat na hydrolyse worden behandeld door toevoeging van een 3 ' dATP (cordycepin-trifosfaat) keten terminator nucleotide met behulp van poly(A) polymerase. Hier, werd gist poly(A) polymerase (yPAP), die werd uitgedrukt en gezuiverd zoals beschreven in 8 gebruikt in een concentratie van 0,5 mg/mL. Gist of E. coli PAP, beide hebben bijna dezelfde activiteit voor toevoeging van 3 ' dATP en commercieel kunnen worden gekocht (Zie de tabel van materialen).

  1. Toevoegen 13,5 µL 5 x geconcentreerd poly(A) polymerase reactie buffer, 2 µL van 10 mM 3 ' dATP, 1 µL RNase remmer en 1 µL poly(A) polymerase naar de reactie van stap 2.2.1. Mix en spin voor 1 s. Incubate bij 37 ° C gedurende 30 min. toevoegen 32,5 µL H 2 O naar elke reactie. Het RNA als in stap 1.10.1 zuiveren. Elueer de RNA met 14 µL H 2 O.

4. Afbinding van Reverse 3 ' Adapters aan de 5 ' einde van de fragmenten van RNA

  1. de reacties plaats in een vacuüm concentrator gedurende 10 minuten om het volume tot 6 µL. Voeg 3 µL 10 x T4 RNA afbinding buffer, 3 µL 10 mM ATP , 15 µL PEG­-8000, 1 µL RNase remmer, 1 µL van 0.1 mM omgekeerde aanvulling 3 ' adapter " revRA3 " (Zie de tabel van materialen) en 1 µL hoge concentratie RNA ligase 1, meng.
  2. Broeden de reacties bij 24 ° C voor 16 h op een verwarmde mixer met intermitterende mengen bij 1000 omwentelingen per minuut. Voeg 70 µL H 2 O naar elke reactie en meng. Het RNA als in stap 1.10.1 zuiveren. Het RNA met 14 µL H 2 O. monsters kunnen worden opgeslagen bij-80 ° C op dit punt Elueer.

5. Reverse transcriptie (RT)

  1. plaats de eluaten in een vacuüm concentrator gedurende 3 minuten om het volume tot 11 µL. overdracht reacties op 200 µL PCR buizen. Voeg 1 µL 0.05 mM RT primer " Bio-dU-dT25 ". Verwarm gedurende 5 minuten bij 70 ° C in een PCR-cycler en laat op RT voor 5 min.
  2. Voeg 1 µL 10 mM dNTPs, 4 µL 5 x reverse-transcriptase buffer 1 µL 0,1 M DTT, 1 µL RNase Inhibitor van de omwenteling en 1 µL reverse-transcriptase. Meng en verwarm de reacties voor 10 min tot 55 ° C en 10 min op 80 ° C in een PCR-cycler. Houd op ijs of bij-80 ° C voor langere opslag.

6. Spijsvertering met Uracil DNA Glycosylase enzym Mix

  1. Pipetteer 100 µL streptavidine-kralen in een 1,5 mL flacon, resuspendeer in 800 µL Biotine bindende buffer en plaats op een magnetische rek. Omkeren buizen 2 - 3 keer. Verwijder de buffer wanneer duidelijk. Herhaal de stap wassen. Resuspendeer de kralen in 200 µL Biotine bindende buffer.
  2. Toevoegen van omgekeerde transcriptie reactie op de oplossing van kralen en 20 min bij 4 ° C op een roterend wiel uit te broeden. Wassen de kralen 2 x met biotine binding buffer zoals in stap 6.1 en 2 x met tien buffer op een magnetische rek. Resuspendeer de kralen in 50 µL tien buffer, 2 µL Uracil DNA glycosylase enzym mix toevoegen en Incubeer 1 uur bij 37 ° C in een mixer met het mengen van intermitterende.
  3. Toevoegen 50 µL H 2 O, 11 µL van RNase H buffer en 1 µL RNase H met de reacties. Incubeer bij 37 ° C gedurende 20 min. plaats buizen op een magnetische rek en overbrengen van de vloeistof met de gekloofd cDNA tot een nieuwe koker
  4. zuiveren gekloofd cDNA.
    1. Toevoegen 550 µL van buffer PB van de PCR zuivering kit met de reacties van de splitsing. Voeg 10 µL van 3 M Natriumacetaat, pH 5.2 te verlagen de pH. Laden van de reacties op minimale elutie spin kolommen en spin op 17.000 x g voor 1 min.
    2. Toevoegen 750 µL buffer PE naar kolommen en spin op 17.000 x g voor 1 min. negeren de doorstroming. Draai de kolommen bij 17.000 x g gedurende 1 minuut drogen. De kolommen naar een 1,5 mL flacon overbrengen, Voeg 16 µL H 2 O en spin op 17.000 x g voor 1 min. de reacties plaats in een vacuüm concentrator gedurende 8 minuten om zich te concentreren op een volume van 7 µL.

7. Afbinding van 5 ' Adapters tot en met 5 ' uiteinden van cDNA

  1. aan de geïsoleerde cDNA, voeg 3 µL 10 x T4 RNA ligase 1 buffer, 3 µL 10 mM ATP, 15 µL PEG­-8000, 1 µL 50 µM " revDA5 " oligo , en 1 µL hoge concentratie T4 RNA ligase 1. Incubeer bij 24 ° C gedurende 20 h. toevoegen 70 µL H 2 O naar elke reactie. Monsters kunnen worden opgeslagen bij-20 ° C op dit punt.

8. PCR versterking van bibliotheken en maat keuze piloot

  1. In een pilot reactie, bepalen het optimale aantal PCR cycli te bereiken bibliotheek versterking binnen de exponentiële fase.
    1. Pipetteer 25 µL polymerase van DNA mix, 20 µL afbinding reactie, 2 µL H 2 O, 1.5 µL 10 µM voorwaartse PCR primers (RP1) en 1,5 µL 10 µM omgekeerde PCR index primer in 200 µL PCR buis.
    2. Lopen de cycler met het volgende programma: 3 min 95 ° C, gevolgd door 20 cycli van 20 s 98 ° C, 20 s 67 ° C en 30 s 72 ° C. verzamelen 7 µL aliquots na 6, 8, 10, 12, 14, 16 en 18 cycli rechtstreeks vanuit de cycler. Voeg 1 µL 10 x het laden van de buffer (50% glycerol, 0.05% xyleen cyanol). Opmerking: Volg de aanbevelingen van de leverancier als gebruikt bij het combineren van barcodes multiplexing.
    3. Afzonderlijke producten in kleine "slots" op een 2% agarose gel in 1 x TBE buffer met een 1:10, 00 verdunning van fluorescente groene kleurstof.
      1. Load aliquots op een 2% agarose gel en draaien van de gel op 100 volt voor 15 min. visualiseren migratie van PCR producten op een gel documentatiesysteem.
  2. Het aantal cycli te gebruiken aan het begin van de exponentiële versterking in de pilot reactie voor een grootschalige PCR reactie met tweemaal de volumes zoals gebruikt voor de pilot reactie ( Figuur 2).
    1. Voor grootschalige PCR reacties, concentreren en desalt de reacties eerst met een PCR zuivering kit en scheiden van de producten op brede sleuven op 2% agarose gel in 1 x TBE buffer.
  3. Uitgesneden gel segmenten met 200-350 nt DNA producten. Smelt de gel in de buffer van de chaotropic op RT voor maximaal 30 min. Het uittreksel van DNA van de segmenten van de gel met een gel extractie kit. Doen niet verhit tot 50 ° C om te voorkomen dat vooringenomenheid in de binding van A-rijke DNA 9.
  4. Indienen voor het rangschikken.
    Opmerking: 50 cycli enkel-lezen (SR50) zijn meestal voldoende (zie, voor bijvoorbeeld, https://www.illumina.com/technology/next-generation-sequencing.html).

9. Gegevensverwerking

Opmerking: de resulterende gegevens rangschikken (in fastq formaat) worden verwerkt met software die beschikbaar zijn in de gitlab-repository (https://git.scicore.unibas.ch/zavolan_public/A-seq2-processing). De analyse omvat vier hoofdstappen: (1) Download de git repository, (2) installatie van een virtuele omgeving, specifieke parameters van de (3) instellen in het configuratiebestand en (4) de lancering van de analyse via ‘ snakemake ’ 10. de volledige analyse gedaan in stap 4 slechts één opdracht vereist. Een gedetailleerde stapsgewijze beschrijving van de analyse kan worden gevonden in het README-dossier in de bewaarplaats van de gitlab en een korte beschrijving is hieronder beschikbaar. Alle individuele verwerking stappen zijn bereikt door de uitvoering van algemeen beschikbare hulpmiddelen, hetzij uit externe bronnen of in eigen huis bereid. De computationele pijpleiding is afhankelijk van een anaconda gebaseerde 11 python 3 virtuele omgeving met de snakemake pakket beschikbaar 10. Het draait op machines met Unix-achtig besturingssysteem en werd getest in een Linux-omgeving met het CentOS 6.5-besturingssysteem geïnstalleerd en 40 GB RAM beschikbaar. Software-afhankelijkheden worden automatisch beheerd binnen de virtuele omgeving. De volgende openbaar softwarehulpmiddelen zijn vereist en daarmee geïnstalleerd samen met het milieu: snakemake (v3.9.1) 10, fastx toolkit (v0.0.14) 12, STAR (v2.5.2a) 13 , cutadapt (v1.12) 14, samtools (v1.3.1) 14 , 15, bedtools (v2.26.0) 16 , 17.

  1. Gegevens voorbehandeling van leest te cDNAs
    Opmerking: de sequencing diepte kan variëren tussen runs en, afhankelijk van het instrument, kunnen gegevens uit één monster worden verdeeld over meerdere bestanden met reeksen. Als dit het geval, samenvoegen de bestanden die corresponderen met één monster in een enkele invoerbestand op dat wordt gebruikt in de volgende stappen.
    1. Het bestand converteren van fastq naar fasta formaat.
    2. Extract leest met een juiste structuur (3 thymidines op positie 5, 6 en 7 van het lezen).
      Opmerking: Een lezen dat correct is bereid volgens de experimentele protocol hierboven beschreven moeten de structuur (van de 5 ' einde): 4-nucleotide barcode - 3 thymidines - reverse aanvulling van transcript 3 ' einde.
    3. De informatie over de startende tetrameer opslaan in de Beschrijvingsregel van de volgorde.
      Opmerking: De tetrameer fungeert als een unieke moleculaire identificatie (UMI) dat de correctie van versterking artefacten verderop in de analyse vergemakkelijkt.
    4. Verwijderen van de eerste zeven nucleotiden van het Lees ' s 5 ' einde.
    5. Corrigeren voor amplificatie artefacten doordat slechts één exemplaar van de luidt met dezelfde volgorde en UMI invoegen.
    6. Verwijder het deel van de 3 ' einde dat overeenkomt met de volgorde van de adapter en vervolgens omgekeerde aanvulling de volgorde. Alleen doorgaan met leest die een minimale lengte hebben (standaard: 15 nt).
      Opmerking: afhankelijk van de lengte van het oorspronkelijke fragment van mRNA en het aantal sequencing cycli, de 3 ' einde van het lezen kan deel bevatten van de 3 ' adapter, die in deze stap wordt verwijderd.
  2. Extract alle leest die voldoen aan de volgende criteria: maximaal 2 onbekende nucleotiden (' N '), maximaal 80% als en laatste nucleotide van het lezen niet A. Deze leest worden geacht te zijn van voldoende kwaliteit om te worden gebruikt bij de analyse.
  3. Kaart van de leest aan het genoom met een werktuig dat behandelt afgesplitste leest en produceert een uitvoerbestand in BAM formaat.
    1. Als STAR wordt gebruikt, maakt u een bestand met de index van het genoom waarnaar de leest moeten worden toegewezen. Voor het menselijk genoom, deze stap vereist 35 GB van geheugen (RAM).
    2. Kaart de leest aan het genoom.
      Opmerking: (STAR-specifieke notities) Soft knippen is uitgeschakeld om te dwingen de toewijzing van de 3 ' eind van elk gelezen aangezien dit de nucleotide onmiddellijk voorafgaand aan de breukzijde.
  4. De BAM omzetten in een BED-bestand. Als een boek naar meerdere locaties kaarten, houden alleen degenen met de laagste afstand bewerken.
    Opmerking: De exemplaaraantal van het lezen toegewezen op een specifieke locatie wordt gebruikt als score. Leest die worden toegewezen aan meerdere locaties zijn Fractioneel geteld op elke locatie met een gewicht gelijk is aan 1/aantal locaties waaraan een lezen is toegewezen.
  5. Instorting leest die door een fout van waarschijnlijk sequencing variëren. Als twee afzonderlijke leest aan dezelfde locatie toewijst (de positie van de begin- en einddatum van de toewijzingen zijn identiek) en ze delen de zelfde UMI, beschouwen ze als PCR duplicaten en slechts één.
  6. Afleiden alle individuele pre-mRNA 3 ' einde verwerking sites.
    Opmerking: Een individuele lezen levert het bewijs voor een 3 ' eindigt wanneer de laatste vier nucleotiden worden toegewezen aan het genoom foutloos. De positie waarnaar de 3 ' einde van de Lees kaarten wordt opgeslagen als breukzijde.
  7. Analyse 3 ' einde van sites die interne priming vandaan kon hebben. De site definiëren als interne priming artefact wanneer de 10 nt stroomafwaarts van de breukzijde in het genoom voldoen aan een van de volgende criteria: meer dan zes als bevat, bevat zes opeenvolgende als of begint met een van de volgende tetramers: AAAA, AGAA, AAGA, AAAG .
  8. Genereren van een lijst met afzonderlijke 3 ' processing sites in BED formaat beëindigen.
  9. Bepalen dat u onafhankelijk van elkaar geregeld poly(A) site clusters.
    Opmerking: De hier beschreven stappen volgt u de procedure die in een voorafgaande bekendmaking 5 werd geïntroduceerd.
    1. Start door het verzamelen van individuele 3 ' processing sites die werden verkregen in alle monsters van de studie eind.
    2. Aantekeningen van bekende poly(A) signalen 7 in de regio van -60 tot + 10 nucleotiden rond elke individuele 3 ' einde verwerking site.
    3. Identificeren poly(A) sites als volgt uitgedrukt boven de achtergrond in elk monster.
      1. De sites sorteren op hun ruwe uitdrukking binnen de huidige steekproef. De lijst met sites doorkruisen van boven naar beneden, lager gerangschikte sites koppelen met een hoger gerangschikt site, als zij zich bevinden binnen een vooraf gedefinieerde afstand in het genoom (standaard: 25 nt up - of stroomafwaarts) van de hooggeplaatste site.
        Opmerking: Alle lage-ranking sites die zijn gekoppeld aan een hooggeplaatste site definiëren een cluster waarvan de expressie is het nummer van het documenteren van al deze sites leest.
      2. Deze clusters sorteren op expressie en doorkruisen van de lijst met clusters van hoogste naar laagste expressie, bepalen de expressie drempel c waartegen het percentage van de clusters met een geannoteerde poly(A) signaal daling onder een vooraf gedefinieerde drempel ( standaard: 90%).
      3. Verwijderen van sites uit een cluster onder de cutoff.
    4. Cluster nauw verdeeld 3 ' einde sites verkregen in verschillende steekproeven.
      Opmerking: Sorteren 3 ' einde sites eerste verwerking door het aantal monsters ondersteunen en vervolgens door de som van de genormaliseerde lezen graaf (leest miljoen (RPM)) in verschillende steekproeven. De lijst doorlopen van boven naar beneden, lagere-ranked sites koppelen aan hogere-ranked sites als hun afstand tot de hogere-rank-site niet groter dan een vooraf gedefinieerde limiet is (standaard: 12 nt). Wanneer een van de samenstellende 3 ' einde site overlapt met een geannoteerde poly(A) signaal of een poly(A)-signaal heeft rechtstreeks stroomafwaarts, het bijbehorende cluster is gemarkeerd voor een verdere inspectie te detecteren interne priming.
    5. Samenvoegen poly(A) site clusters.
      Opmerking: Wanneer een cluster wordt aangemerkt als een vermeende interne priming kandidaat, het is samengevoegd met een stroomafwaartse cluster als de twee clusters hun poly(A) signalen delen of behouden als de meest downstream site in het cluster een signaal van de poly(A) gelegen op minimaal heeft afstand stroomopwaarts (standaard: 15 nt). Ten slotte nauw verdeelde clusters worden samengevoegd als: (i) zij delen de zelfde poly(A) signal(s), of (ii) de overspanning van het resulterende cluster een maximum niet overschrijdt (standaard: 25 nt).
    6. Opslaan van clusters in BED-bestandsindeling met de totale genormaliseerd graaf van alle 3 leest ' sites in elke cluster als score eindigen.

Representative Results

Poly (A)-bevattende RNA werd geïsoleerd uit gekweekte cellen, gefragmenteerd door alkalische hydrolyse en cDNAs werden gemaakt door reverse transcriptie met oligo(dT) inleidingen. De resulterende cDNA werd geïmmobiliseerd op daar kralen, gekloofd dU was in de reactie van de specifieke excisie uracil, adapters werden afgebonden aan 5' en 3' einden van het fragment gekloofd en de inserts waren gesequentieerd. Figuur 1 toont een grafische schets van het experiment.

Voor HeLa en HEK293 cellen waren 106 cellen voldoende om het identificeren van de poly(A) sites voor de overgrote meerderheid van de eiwit-codeert genen aan het einde van de procedure. Echter, voor andere soorten cellen of weefsels die kan het nodig zijn om te testen de verzadiging in het aantal sites van de geïdentificeerde poly(A) als het aantal cellen die worden gebruikt in het experiment zijn verhoogt. Representatieve resultaten van de pilot PCR stap en van het fragment van DNA analyse van het monster vóór sequencing zijn afgebeeld in Figuur 2.

Figuur 3 toont de voorbewerkend stappen van de computationele analyse, vanaf het fastq bestand verkregen van de sequencer en eindigend met de kwaliteit-gecontroleerd, adapter-bijgesneden leest die zijn klaar om te worden toegewezen aan het genoom. Figuur 4 toont de stappen van de analyse die beginnen met de toewijzing van de luidt als volgt aan de overeenkomstige genoom en einde waarbij de catalogus met mRNA 3' eind verwerking van sites die worden geïdentificeerd in een bepaalde monster. Wanneer meerdere monsters worden geanalyseerd, worden extra stappen uitgevoerd overeenkomen met de 3'-eind verwerking van sites die werden gevonden in individuele monsters en rapporteren hun overvloed in verschillende steekproeven. Deze stappen zijn afgebeeld in Figuur 5.

Dus, zodra monsters hebben zijn sequenced, de analyse van de resulterende sequencing lezen van bestanden (in fastq formaat) via de beschikbare processing pipeline is eenvoudig. Na het toevoegen van de informatie over de monsters naar de configuratie vijl, de uitvoering van de pijpleiding zal resulteren in twee hoofdtypen van uitvoerbestanden: 1) BED-bestanden met alle 3' eindigen verwerking sites geïdentificeerd in afzonderlijke monsters (b.v. " sample1.3pSites.noIP.bed.gz"), en 2) een BED-bestand met alle poly(A) site clusters (clusters.merged.bed) over alle monsters van de studie. De uitvoer bevat tevens de genoom coördinaten voor alle leesbewerkingen van elk individuele monster (bijvoorbeeld "sample1. STAR_out/aligned.sortedByCoord.out.BAM") die later kunnen worden bekeken in de browser van een genoom zoals IGV16. Visueel onderzoek van het Lees Profiel(en) geeft in het algemeen een eerste glimp van de verdeling van de poly(A)-locaties in het genoom en de veranderingen die zich voordoen bij de specifieke verstoringen die in de studie werden uitgevoerd. Bijvoorbeeld in Figuur 6 is het antwoord van een specifiek gen op de knock-down van het eiwit HNRNPC weergegeven.

Samenvattingen van deze genoom-brede distributies zijn ook beschikbaar (tabel 1). Specifiek, output-bestanden in de directory "graven/annotation_overlap" bevatten breuken van sites die met de specifieke kenmerken van de geannoteerde overlappen (uit het gtf-bestand opgenomen als invoer; geannoteerde zijn: 3' UTR, terminal exon, exon, intron, intergenic). Tot slot, voor elk monster, resultaten van individuele verwerking stappen worden ook opgeslagen (bijvoorbeeld "sample1.summary.tsv"). Dit omvat de aantallen: rauwe leest in elk monster, luidt dat de verwachte structuur voor de 5'-eind hebben, leest die achterblijven na het instorten van de volledige PCR duplicaten, kwalitatief hoogwaardige leest volgens de criteria die bij stap 9.2, leest die kaart uniek aan het genoom (na instorten die het gevolg is van sequencing fouten, zie stap 9.5), multi toewijzing leest (na instorten die het gevolg is van sequencing fouten, zie stap 9.5), rauwe (niet-geclusterde) 3' eind verwerking van sites in elk monster, raw 3' uiteinde verwerking sites zonder potentiële interne priming kandidaten, unieke 3' eind verwerking sites van alle monsters zonder interne priming kandidaten en laatste set poly(A) site clusters.

Figure 1
Figuur 1: voornaamste stappen van het protocol van de A-seq2. Afzonderlijke stappen worden aangegeven aan de linkerkant van de figuur. Invoegen RNA fragmenten worden afgeschilderd als groene lijnen die rood voor cDNA na omgekeerde transcriptie; adapters zijn gekleurd in licht blauw of oranje. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: Pilot PCR en eindproduct profiel. (een) Aliquots van de PCR reactie werden verzameld bij verschillende cycli en gescheiden op 2% agarose gel. Getallen aan de linkerkant geven grootte in de nucleotiden van de respectieve bands in de DNA-ladder. In dit experiment werden 12 cycli (*) gekozen voor de grootschalige PCR reactie. (b) voorbeeld van een monster na grootte selectie uitgevoerd op een fragment grootte analyzer onthullen een gemiddelde grootte van ongeveer 280 nucleotiden. Nummers aan de linkerzijde [FU] geven relatieve signaalsterkte. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: overzicht van de voorbehandeling van sequencing leest. De fastq bestanden met leest die worden gegenereerd door de sequencing instrument-geassocieerde software worden verwerkt om te identificeren van kwalitatief hoogwaardige leest dat wordt toegewezen aan het overeenkomstige genoom. De figuur toont de input/output-specificatie van de afzonderlijke stappen in de pijplijn, met koppelingen naar de afzonderlijke stappen van het protocol wordt beschreven in sectie "Data processing". Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: overzicht van sequentie Lees verwerking, vanaf de stap van de toewijzing aan het genoom aan de generatie van individuele 3' eind verwerking sites. De figuur toont de input/output-specificatie van de afzonderlijke stappen in de pijplijn, met links naar de ide stappen van de ndividual van het protocol wordt beschreven in sectie "Data processing". De belangrijkste output-bestand dat wordt geleverd aan de gebruiker is gemarkeerd in vet. Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5: overzicht van de stappen die worden genomen voor het genereren van clusters van mede gereglementeerde 3' eind sites sequencing. De figuur toont de input/output-specificatie van de afzonderlijke stappen in de pijplijn, met koppelingen naar de afzonderlijke stappen van het protocol wordt beschreven in sectie "Data processing". De belangrijkste output bestand is gemarkeerd in vet. Klik hier voor een grotere versie van dit cijfer.

Figure 6
Figuur 6: voorbeeld van de resultaten van het profiel van 3' eind verwerking leest langs de terminal exon van het NUP214 gen, getoond in de IGV 16 genome browser. A-seq2 leest waren bereid uit twee monsters van HEK 293 cellen, behandeld met een controle-siRNA of met een HNRNPC siRNA. Het luidt dat gedocumenteerd poly(A) sites die werden geannoteerd door middel van de analyse-pijpleidingen werden opgeslagen in BAM-indeling die werd gebruikt als invoer voor de IGV genome browser. De 3' einden van de Lees pieken toewijzen aan mRNA 3' einden die zijn geannoteerd in Ensembl. De profielen geven een intensiever gebruik van de lange 3' UTR isovorm op HNRNPC knock-down. Klik hier voor een grotere versie van dit cijfer.

si-Control repliceren 1 si-Control repliceren 2
id: 29765 id: 32682
aantal ruwe leest 44210258 68570640
aantal geldige leest na trimmen en filteren 14024538 21211793
aantal unieke mapping leest 6953674 13946436
aantal leest toewijzen aan meerdere loci 2040646 2925839
aantal individuele 3' eindigen verwerking sites 1107493 1710353

Tabel 1: voorbeeld van de uitvoer van de analyse-pijpleiding. Samenvattingen van leest die zijn verkregen bij afzonderlijke stappen.

Discussion

De veelheid van kern- en ondersteunende factoren die bij pre-mRNA 3' eind verwerking betrokken zijn wordt weerspiegeld in een dienovereenkomstig complexe polyadenylatie landschap. Polyadenylatie is bovendien ook inspelen op veranderingen in andere processen zoals transcriptie, egaliseren en lamineren. 3' eind decollete sites in pre-mRNAs worden normaal gesproken aangeduid op basis van de karakteristieke poly(A) staarten die worden toegevoegd aan de 5'-splitsingsproducten. De meeste methoden gebruiken oligo(dT) inleidingen van variabele lengte waarmee de specifieke omzetting van poly (A)-met mRNAs te cDNAs in een omgekeerde transcriptie reactie. Een gemeenschappelijk probleem van deze aanpak is interne priming aan A-rijke sequenties resulterend in artefactuele decollete sites. Twee methoden die gericht zijn op het omzeilen van dit artefact in de fase van de bereiding van de monsters zijn voorgesteld. In de 3P-seq methode 1, adapters ligatuur zijn specifiek verbonden aan de uiteinden van poly(A) staarten met hulp van een splint oligo gevolgd door gedeeltelijke RNase T1 spijsvertering en omgekeerde transcriptie met TTP in de reactie als de enige deoxynucleotide. De resulterende poly(A)-poly(dT) heteroduplexes zijn dan verteerd met RNase H en zijn de overgebleven fragmenten van RNA sequenced, geïsoleerd en afgebonden aan adapters. Een eenvoudiger en elegante methode, 2P-seq, die gebruikmaakt van een aangepaste volgorde primer overslaan het resterende traject van het oligo(dT) in de sequencing-reactie werd gemeld door de dezelfde auteurs 2. In een verwante methode, 3' leest 3, een ongewoon lange primer van 5 ons en 45 Ts, ook met een Biotine is gegloeid te gefragmenteerde RNA, gevolgd door strenge wast om te selecteren voor de molecules van RNA met de staart van de poly(A) van meer dan 50 nucleotiden. Hoewel 3' leest drastisch de frequentie van interne priming vermindert, doet het niet volledig elimineren het 3. Protocollen voor directe RNA sequencing hebben ook voorgesteld, maar de resulterende leest zijn kort en hebben een hoge foutenpercentage en deze aanpak is niet verder ontwikkelde 18,19,20. De PolyA-Seq en de gecommercialiseerd Quant Seq protocollen combineren oligo(dT) gebaseerd priming met een willekeurige priming stap voor de cDNA tweede onderdeel synthese 20. Het gebruik van de sjabloon switch omgekeerde transcriptie reactie met de reverse-transcriptase Moloney lymfkliertest Leukemie Virus (MMLV) leidt tot de generatie van cDNAs met de linkers in één stap en daardoor geen adapter-Dimeren kunnen worden weergegeven in de PAS-Seq en SAPAS methoden 21 , 22.

De A-seq2-methode gepresenteerd hier opvalt in het gebruik van een cleavable nucleotide (dU) binnen een biotinyleerd oligo(dT) primer. Deze wijziging combineert het nut van het verrijken van oligo(dT) gekruist, polyadenylated doelstellingen met de verwijdering van de meeste van de oligo (dT)25 sequentie van de geïsoleerde fragmenten voordat bibliotheken zijn bereid en het behoud van drie t's, die wijzen op de voorafgaande aanwezigheid van de staart van de poly(A). Daarentegen laat methoden die gebruikmaken van RNase H Schakel poly(A) uit de RNA-moleculen willekeurig als verschillende. Aangezien A-seq2, sequencing van 3' eind van de anti-zin-strengen gebeurt, wordt decollete sites voorspeld dat na het motief van de NNNNTTT aan het begin van ruwe volgorde leest bevinden. De gerandomiseerde tetramers dienen niet alleen om basis bellen maar ook in de eliminatie van PCR versterking artefacten. Langere UMIs kunnen ook worden ondergebracht. De mogelijkheid van interne priming blijft in A-seq2 en rekenkundig is gericht, eerst door teruggooi 3' eindigt met een genomically-gecodeerde, A-rijke downstream volgorde, en vervolgens door het teruggooien van 3' eind clusters die kon worden verklaard door interne priming op de A-rijke poly(A) signaal zelf. Een recente analyse van poly(A) sites uniek afgeleid door een groot aantal protocollen geeft aan dat de sites die uniek voor A-seq2 zijn de verwachte nucleotide distributie en locatie in de genen, vergelijkbaar met andere 3' eind rangschikken protocollen.

Een cruciale stap in de A-seq2 is de selectie van polyadenylated RNA en de verwijdering van ribosomaal RNAs en diverse kleine RNAs. Dit gebeurt meest gemakkelijk door een mRNA-isolatie kit met oligo (dT)25 magnetische kralen. In principe geeft totaal RNA geïsoleerd met fenol met oplossingen ook hoge kwaliteit RNA dat kan verder worden onderworpen aan selectie door de mRNA-isolatie kit of agarose oligo (dT). Een stap die kan worden gevarieerd in A-seq2 is de behandeling met alkalische hydrolyse, die kan worden ingekort of uitgebreid tot het verkrijgen van RNA fragmenten van verschillende grootte. Kritische is ook dat de toevoeging van 3' dATP aan 3' einden van RNA fragmenten door de polymerase van poly(A) efficiënt is. In het protocol beschreven hier, wordt deze behandeling toegepast op alle fragmenten van RNA, om te voorkomen dat concatemerization tijdens de afbinding reactie. Tot slot, wij stellen vast dat hoewel RNA ligase 1 gewoonlijk als een RNA-ligase gebruikt wordt, ligates het ook efficiënt één gestrande DNA, zoals wij hier hebben gedaan om een adapter aan het einde 5' van de moleculen van cDNA afbinden.

A-seq2 is dus een efficiënte en eenvoudig te implementeren protocol voor de identificatie van pre-mRNA 3' eind verwerking van sites. Toekomstige ontwikkelingen eventueel verdere vermindering van de complexiteit van het protocol en de hoeveelheid benodigde materiaal. De bijbehorende set voor computationele gegevensanalyse verder de homogene verwerking van 3' eind sequencing leest verkregen met een breed scala aan protocollen inschakelen.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

De auteurs bedanken mevrouw Béatrice Dimitriades voor hulp bij de cultuur van de cel. Dit werk werd gesteund door de Zwitserse National Science Foundation subsidies #31003A_170216 en 51NF40_141735 (NCCR RNA & ziekte).

Materials

Name Company Catalog Number Comments
Materials
Agarose, ultra pure Invitrogen 16500-500
2100 Bioanalyzer Agilent G2940CA
Cordycepin triphosphate (3’ dATP) SIGMA C9137
DNA low bind vials, 1.5 ml Eppendorf 22431021
Dulbecco’s Phosphate Buffered Saline SIGMA D8637
Dynabeads mRNA-DIRECT Kit Ambion AM61012
GR-Green dye Excellgen EG-1071 use 1:10,000 dillution
HiSeq 2500 or NextSeq 500 next generation sequencers Illumina inquire with supplier
KAPA HiFi Hotstart DNA polymerase mix KAPA/Roche KK2602
Nuclease free water Ambion AM9937
Poly(A) polymerase, yeast Thermo Fisher Scientific 74225Z25KU
Poly(A) polymerase, E.coli New England Biolabs M0276L
Polynucleotide kinase Thermo Fisher Scientific EK0032
QIAEX II Gel Extraction Kit Qiagen 20021
QIAquick PCR Purification Kit Qiagen 28104
QIAquick Gel Extraction Kit Qiagen 28704
RNA ligase 1, high concentration New England Biolabs M0437M includes PEG-8000
RNeasy MinElute RNA Cleanup kit Qiagen 74204
RNase H New England Biolabs M0279
RNasin Plus, ribonuclease inhibitor Promega N2618
Superscript IV reverse transcriptase Thermo Fisher Scientiific 18090050
Turbo DNase Ambion AM2238
USER enzyme mix New England Biolabs M5505
Dyna-Mag-2 magnetic rack Thermo Fisher Scientific 12321D
Thermomixer C Eppendorf 5382000015 Heated mixer with heated lid
MicroSpin columns GE-Healthcare 27-5325-01
Name Company Catalog Number Comments
Buffers
Alkaline hydrolysis buffer, 1.5 x Mix 1 part 0.1 M Na2CO3 and 9 parts 0.1 M NaHCO3. Add EDTA to 1 mM. Adjust pH to 9.2. Store aliquots at -20 °C.
5x poly(A) polymerase buffer Thermo Fisher Scientiific 100 mM Tris-HCl, pH 7.0, 3 mM MnCl2, 0.1 mM EDTA, 1 mM DTT, 0.5 mg/ml acetylated BSA, 50% glycerol
Biotin binding buffer 20 mM Tris­Cl pH 7.5, 2 M NaCl, 0.1% NP­40
TEN buffer 10 mM Tris­Cl, pH 7.5, 1 mM EDTA, 0.02% NP­40
Name Company Catalog Number Sequence
Oligonucleotides according to Illumina TruSeq Small RNA Sample Prep Kits, for GA-IIx and Hiseq2000/2500 sequencers Microsynth
revRA3 (RNA) Microsynth 5’ amino­ CCUUGGCACCCGAGAAUUCCA­ 3’
revDA5 Microsynth 5’ amino­ GTTCAGAGTTCTACAGTCCGAC GATCNNNN-3’
Bio-dU-dT25, RT primer Microsynth 5' Biotin-TTTTTTTTTTTTTTTTTTTTTTTTTT-dU-TTTVN 3' (V = G, A or C)
PCR primer forward, RP1 Microsynth 5' AATGATACGGCGACCACCGAGA TCTACACGTTCAGAGTTCTACAG
TCCGA 3'
PCR primer reverse, RPI1, barcode in bold Microsynth 5' CAAGCAGAAGACGGCATACGAG
ATCGTGATGTGACTGGAGTTCCT
TGGCACCCGAGAATTCCA 3'
Name Company Catalog Number Comments
Oligonucleotides according to Illumina TruSeq HT-Small RNA Sample Prep Kits, for HiSeq2000/2500 and NextSeq500 sequencers
HT-rev3A (DNA/RNA) Microsynth 5'-amino-GTGACTGGAGTTCAGACGTGTG
CTCTTCCrGrAUrC-3'
HT-rev5A Microsynth 5' amino-ACACTCTTTCCCTACACGACGCT
CTTCCGATCTNNNN 3'
Bio-dU-dT25, RT primer Microsynth 5' Biotin-TTTTTTTTTTTTTTTTTTTTTTTTTT-dU-TTTVN 3'
PCR primers forward (D501-506) Microsynth or Illumina 5'-AATGATACGGCGACCACCGAGAT
CTACAC[i5]ACACTCTTTCCCTACA
CGACGCTCTTCCGATCT -3'
PCR primers reverse (D701-D712) Microsynth or Illumina 5'-CAAGCAGAAGACGGCATACGAG A[i7]GTGACTGGAGTTCAGACGTG TGCTCTTCCGATC-3'
Documentation for Illumina multiplexing: Illumina https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/experiment-design/illumina-adapter-sequences_1000000002694-01.pdf

DOWNLOAD MATERIALS LIST

References

  1. Jan, C. H., Friedman, R. C., Ruby, J. G., Bartel, D. P. Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs. Nature. 469, (7328), 97-101 (2011).
  2. Spies, N., Burge, C. B., Bartel, D. P. 3' UTR-isoform choice has limited influence on the stability and translational efficiency of most mRNAs in mouse fibroblasts. Genome Res. 23, (12), 2078-2090 (2013).
  3. Hoque, M., Ji, Z., et al. Analysis of alternative cleavage and polyadenylation by 3' region extraction and deep sequencing. Nat. methods. 10, (2), 133-139 (2013).
  4. Martin, G., Gruber, A. R., Keller, W., Zavolan, M. Genome-wide analysis of pre-mRNA 3’ end processing reveals a decisive role of human cleavage factor I in the regulation of 3' UTR length. Cell Rep. 1, (6), 753-763 (2012).
  5. Gruber, A. R., Martin, G., et al. Global 3' UTR shortening has a limited effect on protein abundance in proliferating T cells. Nat. Commun. 5, 5465 (2014).
  6. Kivioja, T., Vähärautio, A., et al. Counting absolute numbers of molecules using unique molecular identifiers. Nat. methods. 9, (1), 72-74 (2011).
  7. Gruber, A. J., Schmidt, R., et al. A comprehensive analysis of 3' end sequencing data sets reveals novel polyadenylation signals and the repressive role of heterogeneous ribonucleoprotein C on cleavage and polyadenylation. Genome Res. 26, (8), 1145-1159 (2016).
  8. Lingner, J., Keller, W. 3'-end labeling of RNA with recombinant yeast poly(A) polymerase. Nucleic Acids Res. 21, (12), 2917-2920 (1993).
  9. Quail, M. A., Kozarewa, I., et al. A large genome center's improvements to the Illumina sequencing system. Nat. methods. 5, (12), 1005-1010 (2008).
  10. Rahmann, S. Snakemake--a scalable bioinformatics workflow engine. Bioinformatics. 28, (19), 2520-2522 (2012).
  11. Analytics, C. Anaconda Software Distribution. Available from: https://continuum.io (2016).
  12. Lab, H. FASTX-Toolkit - Hannon Lab. Available from: http://hannonlab.cshl.edu/fastx_toolkit/index.html (2017).
  13. Dobin, A., Davis, C. A., et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 29, (1), 15-21 (2013).
  14. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal. 17, (1), 10-12 (2011).
  15. Li, H., Handsaker, B., et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25, (16), 2078-2079 (2009).
  16. Robinson, J. T., Thorvaldsdóttir, H., et al. Integrative genomics viewer. Nat. Biotechnol. 29, (1), 24-26 (2011).
  17. Quinlan, A. R., Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 26, (6), 841-842 (2010).
  18. Ozsolak, F., Platt, A. R., et al. Direct RNA sequencing. Nature. 461, (7265), 814-818 (2009).
  19. Yao, C., Biesinger, J., et al. Transcriptome-wide analyses of CstF64-RNA interactions in global regulation of mRNA alternative polyadenylation. Proc. Natl. Acad. Sci. U. S. A. 109, (46), 18773-18778 (2012).
  20. Lin, Y., Li, Z., et al. An in-depth map of polyadenylation sites in cancer. Nucleic Acids Res. 40, (17), 8460-8471 (2012).
  21. Shepard, P. J., Choi, E. -A., Lu, J., Flanagan, L. A., Hertel, K. J., Shi, Y. Complex and dynamic landscape of RNA polyadenylation revealed by PAS-Seq. RNA. 17, (4), 761-772 (2011).
  22. Fu, Y., Sun, Y., et al. Differential genome-wide profiling of tandem 3' UTRs among human breast cancer and normal cells by high-throughput sequencing. Genome Res. 21, (5), 741-747 (2011).
3' eind Sequencing bibliotheek voorbereiding met A-seq2
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Martin, G., Schmidt, R., Gruber, A. J., Ghosh, S., Keller, W., Zavolan, M. 3' End Sequencing Library Preparation with A-seq2. J. Vis. Exp. (128), e56129, doi:10.3791/56129 (2017).More

Martin, G., Schmidt, R., Gruber, A. J., Ghosh, S., Keller, W., Zavolan, M. 3' End Sequencing Library Preparation with A-seq2. J. Vis. Exp. (128), e56129, doi:10.3791/56129 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter