Name: Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR (Video) | JoVE Journal
Uploaded: 2012-11-23T13:00:00.000+00:00
Duration: 14 min 7 s
Description: Learn genome-wide gene deletion in Streptococcus sanguinis using high throughput PCR and recombinant transformation. This efficient method enables rapid bacterial genetic studies and functional gene analysis.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This work was supported by grants R01DE018138 from the National Institutes of Health (PX) and in part, by Virginia Commonwealth University Presidential Research Incentive Program (PRIP) 144602-3 (PX). We thank Drs. Lei Chen, Yuetan Dou and Xiaojing Wang for assisting with the construction of genome wide mutants. We also thank the DNA Core Facility at Virginia Commonwealth University for DNA sequencing.

1. Primer Design
<ol>
	<li>Primers are designed using in house scripts based on the S. sanguinis SK36 genome sequence. Three sets of primers, F1/R1, F2/R2, and F3/R3 are designed for amplification of the 1-kb upstream sequence of the target gene, the aphA-3 gene encoding kanamycin resistance (Kmr) protein3 and the 1-kb downstream sequence of the target gene, respectively (Figure 1). Among these primers, F1 and R3 are designed using ePrimer3 in the EMBOSS suite of programs (<a href="http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html" target="_blank">http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html</a>) to amplify flanking regions upstream or downstream of the target gene. Gene specific primers, R1 and F3, are designed based upon the 5' and 3' sequences of the target gene. R1 and F3 primers contain 25-bp adaptor sequences at their 5' end that are complementary to the aphA-3 gene. The melting temperatures of each primer were designed to be as close as possible to 60 &deg;C to enable use of a uniform annealing temperature for all PCR reactions in 96-well format.</li>
	<li>F1, R1, F3 and R3 primers are synthesized in 96-well plates based on a gene order. Each plate contains one type of primers in the same gene order. Dilute the primers in 96-well working primer plate to a final concentration of 10 &mu;M for PCR amplification using a multichannel pipette.</li>
</ol>
2. High-throughput PCR Amplification and Purification
<ol>
	<li>To high-throughput amplify 1-kb upstream or downstream of the target S. sanguinis genes, assemble a PCR cocktail mixture on ice in a 15-ml conical tube containing 1640 &mu;l ddH2O, 250 &mu;l 10xHigh Fidelity PCR Buffer, 200 &mu;l of 10 mM dNTP mixture, 100 &mu;l of 50 mM MgSO4, 100 &mu;l of 10 ng/ &mu;l S. sanguinis SK36 genomic DNA and 10 &mu;l Platinum Taq DNA polymerase high fidelity and transfer 23 &mu;l of the mixture into each well on 96-well PCR plate using a multichannel pipette. Transfer 1 &mu;l of each F1 and R1 (or F3 and R3) from the 10 &mu;M working primer plates to the PCR plate using multichannel pipette. Seal the PCR plate and perform amplification at 94 &deg;C for 1 min, and 30 cycles of 94 &deg;C for 30 sec, 54 &deg;C for 30 sec and 68 &deg;C for 1.5 min.</li>
	<li>Prepare 1% agarose gel containing ethidium bromide with 48 wells fitting multichannel pipette loading. Mix 4 &mu;l PCR product with 1 &mu;l of 5xDNA loading buffer on 96-well plate and load the samples on agarose gel using a 10-&mu;l multichannel pipette. Run electrophoresis at 135 V for 30 min. Examine the band on gel under UVP documentation and analysis system.</li>
	<li>Purify the PCR products by PureLink 96 PCR purification kit using centrifugation according to the manufacturer's instruction. For eluting DNA, add 40 &mu;l sterile ddH2O to the well of the binding plate.</li>
	<li>Randomly pick several purified amplicons on the plate to examine the DNA concentrations using NanoDrop spectrophotometer. Adjust the concentration of amplicons on plate to ~10 ng/&mu;l.</li>
	<li>A plasmid containing Kmr cassette is digested using EcoRI as PCR template. The digested plasmid is purified by QIAquick PCR purification kit and the linear plasmid DNA is adjusted to final DNA concentration 10 ng/&mu;l. Assemble 25 &mu;l mixture for Kmr cassette amplicon including 16.4 &mu;l ddH2O, 2.5 &mu;l 10xHigh Fidelity PCR Buffer, 2 &mu;l of 10 mM dNTP mixture, 1 &mu;l of 50 mM Mg SO4, 1 &mu;l of 10 &mu;M F2, 1 &mu;l of 10 &mu;M R2, 1 &mu;l linear plasmid DNA and 0.1 &mu;l Platinum Taq DNA polymerase high fidelity. Perform PCR amplification at 94 &deg;C for 1 min, and 30 cycles of 94 &deg;C for 30 sec, 55 &deg;C for 30 sec and 68 &deg;C for 1 min. Examine the PCR product by gel electrophoresis on 1% agarose. Pool a bulk of the Kmr cassette amplicon from 10 individual PCR purified by QIAquick PCR purification kit. Adjust the amplicon concentration to 10 ng/&mu;l.</li>
	<li>To obtain the final linear recombinant PCR amplicon, three PCR amplicons are combined with each 1 &mu;l (in nearly equal-molar amounts) in one PCR plate well as the PCR template. Other PCR components is added including 14.4 &mu;l ddH2O, 2.5 &mu;l 10xHigh Fidelity PCR Buffer, 2 &mu;l of 10 mM dNTP mixture, 1 &mu;l of 50 mM Mg SO4, 1 &mu;l of 10 &mu;M F1, 1 &mu;l of 10 &mu;M R3, 0.1 &mu;l Platinum Taq DNA polymerase high fidelity. PCR amplification is performed at 94 &deg;C for 2 min, 30 cycles of 94 &deg;C for 30 sec 55 &deg;C for 30 sec and 68 &deg;C for 3.5 min, and finally 68 &deg;C for 4 min.</li>
	<li>Examine the PCR amplicons on agarose gel. Purify and quantify the PCR amplicons as described above. Freeze the recombined PCR amplicons at -20 &deg;C.</li>
</ol>
3. Competent Cells Preparation
<ol>
	<li>Todd Hewitt broth is prepared, adjusted pH to 7.6 using 10 N NaOH, heated to boil and then cooled to room temperature and sterilized using 0.22 &mu;m polystyrene filter4. Add 300 &mu;l heat-inactivated horse sera (final concentration to 2.5%) to 11.7 ml Todd Hewitt broth in 15-ml conical tube to make up TH+HS medium. Aliquot TH+HS medium into 2 ml and 10 ml in tubes.</li>
	<li>Inoculate 5 &mu;l of stock S. sanguinis SK36 frozen at -80 &deg;C into 2 ml TH+HS medium and incubate the culture overnight with capping tightly at 37 &deg;C, accompanied by pre-incubating the 10 ml-TH+HS tube.</li>
	<li>After overnight, transfer 50 &mu;l culture into 10 ml TH+HS and incubate the tube at 37 &deg;C for 3 hr (corresponding to OD660 of 0.07-0.08), immediately using for transformation.</li>
</ol>
4. Cell Transformation and Antibiotic Selection
<ol>
	<li>Add 2 &mu;l of 70 ng S. sanguinis SK36 competence stimulating peptide (CSP) and 2 &mu;l linear recombinant PCR amplicon (~50 ng) to Eppendorf tubes on 96-well block and pre-warm them at 37 &deg;C. Transfer 330 &mu;l of 3 hr-incubated SK36 culture into each tube. Incubate at 37 &deg;C for 1 hr. Replace DNA with sterile ddH2O as control.</li>
	<li>Place the block on ice and spread 100 &mu;l of each transformation on brain heart infusion (BHI) agar plate with 500 &mu;g/ml kanamycin. Incubate the plates at 37 &deg;C for 2 d under microaerobic conditions.</li>
</ol>
5. Mutant Confirmation and Storage
<ol>
	<li>For each replacement mutant, randomly pick up 2 individual colonies, inoculate the colony into 5 ml BHI containing 500 &mu;g/ml kanamycin and incubate the inoculum microaerobically overnight at 37 &deg;C. Cryopreserve each culture in 30% glycerol at -80 &deg;C</li>
	<li>To examine whether the mutant containing the expected gene replacement, perform colony PCR for each mutant using F1 and R3 primers in 96-well PCR plate. About 1-&mu;l overnight culture from individual colony is used as the DNA template in 25-&mu;l PCR-amplification reaction. PCR is performed at 94 &deg;C for 5 min, 35 cycles of 94 &deg;C for 30 sec, 55 &deg;C for 30 sec and 68 &deg;C for 3.5 min, and finally 68 &deg;C for 4 min.</li>
	<li>To precisely identify double-band mutants or contaminant PCR amplicon, examine the PCR amplicon by electrophoresis for 4 hr on &gt;12 cm long 2% agarose gel with ethidium bromide staining. Under this agarose gel electrophoresis condition, any amplicons with &ge; 100 bp difference were clearly identified. When bands resulting from amplification of the Kmr cassette and the wild-type gene are anticipated to differ by &lt; 100 bp, an internal T1 primer is used to determine whether a wild-type gene can be detected by PCR.</li>
	<li>To further confirm the deletion, the amplicons are purified by PureLink 96 PCR purification kit and sequenced using the P1 primer which binds to the Kmr cassette. Keep only correct mutants confirmed by sequencing.</li>
</ol>

<ol><li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis%5BTitle%5D)+AND+%22Mol.+Microbiol%22%5BJournal%5D)">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li>
<li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Essential+Bacillus+subtilis+genes%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+U.S.A%22%5BJournal%5D)">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li>
<li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3%275%22-aminoglycoside+phosphotransferase+type+III%5BTitle%5D)+AND+%22Gene%22%5BJournal%5D)">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li>
<li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis%5BTitle%5D)+AND+%22Infect.+Immun%22%5BJournal%5D)">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li>
<li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+%28sic%29+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization%5BTitle%5D)+AND+%22Infect.+Immun%22%5BJournal%5D)">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li>
<li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Construction+of+Escherichia+coli+K-12+in-frame%2C+single-gene+knockout+mutants%3A+the+Keio+collection%5BTitle%5D)+AND+%22Mol.+Syst.+Biol%22%5BJournal%5D)">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li>
<li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1%5BTitle%5D)+AND+%22Mol.+Syst.+Biol%22%5BJournal%5D)">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174(2008).</li>
<li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis%5BTitle%5D)+AND+%22Mol.+Oral.+Microbiol%22%5BJournal%5D)">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li>
<li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genetic+transformation+of+Streptococcus+mutans+Infect%5BTitle%5D)+AND+%22Immun%22%5BJournal%5D)">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li>
<li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((On+the+nature+of+competence+of+transformable+streptococci%5BTitle%5D)+AND+%22J.+Gen.+Microbiol%22%5BJournal%5D)">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li>
<li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+U.S.A%22%5BJournal%5D)">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li>
<li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis%5BTitle%5D)+AND+%22Sci.+Rep%22%5BJournal%5D)">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li>
</ol>

No conflicts of interest declared.

To minimize the possible polar effects of the replacement of one targeted gene with exogenous antibiotics gene on neighboring genes, two steps are taken while initial primer designing. For most of deleted genes, the primers R1 and F3 are designed to delete the coding region from 6 bp following the start codon to 30 bp prior to the stop codon. The last 30 base pairs are retained to protect potential ribosomal binding site used by the adjacent downstream gene. The retained region between two neighboring genes is extended t...

<table><tbody><tr><td>Primer F2</td><td>Integrated DNA Technologies</td><td></td><td>TGACTAACTAGGAGGAATAAATG&lt;br/&gt;GCTAAAATGAGAATAT</td></tr><tr><td>Primer R2</td><td>ibid</td><td></td><td>CATTATTCCCTCCAGGTACTAAAA&lt;br/&gt;CAATTCATCCAGT</td></tr><tr><td>Primer F2p</td><td>ibid</td><td></td><td>GATAAACCCAGCGAACCATTTGA</td></tr><tr><td>Primer P1</td><td>ibid</td><td></td><td>GCTTATATACCTTAGCAGGAGACA</td></tr><tr><td>Primer P2</td><td>ibid</td><td></td><td>GTATGACATTGCCTTCTGCGTCC</td></tr><tr><td>Primer 5&#039; end_R1_seq</td><td>ibid</td><td></td><td>GCCATTTATTCCTCCTAGTTAGTCA</td></tr><tr><td>Primer 5&#039; end_F3_seq</td><td>ibid</td><td></td><td>GTTTTAGTACCTGGAGGGAATAATG</td></tr><tr><td>Primer 5&#039; end_R1p_seq</td><td>ibid</td><td></td><td>CCTCAAATGGTTCGCTGGGTTTATC</td></tr><tr><td>CSP</td><td>Synprep</td><td></td><td>Sequence:NH2-DLRGVPNPWGWIFGR-COOH</td></tr><tr><td>DNA Polymerase </td><td>Invitrogen</td><td>11304-102</td><td>Platinum Taq DNA Polymerase High Fidelity</td></tr><tr><td>EcoRI</td><td>New England Biolabs Inc</td><td>R0101S</td><td>Restriction enzyme</td></tr><tr><td>Agar</td><td>American Bioanalytical</td><td>AB01185</td><td></td></tr><tr><td>Agarose</td><td>Promega</td><td>V3125</td><td></td></tr><tr><td>BHI</td><td>BD Biosciences</td><td>237500</td><td>Brain Heart Infusion</td></tr><tr><td>Horse serum</td><td>Fisher Scientific</td><td>SH3007403</td><td>Horse serum</td></tr><tr><td>Km</td><td>Fisher Scientific</td><td>BP906-5</td><td>Kanamycin</td></tr><tr><td>TH broth</td><td>BD Biosciences</td><td>249240</td><td>Todd Hewitt broth</td></tr><tr><td>PureLink 96</td><td>Invitrogen</td><td>K310096</td><td>PureLink 96 PCR purification kit</td></tr><tr><td>QIAquick</td><td>Qiagen</td><td>28106</td><td>QIAquick PCR purification kit</td></tr><tr><td>Filter</td><td>Corning</td><td>431117</td><td>0.22 &amp;mu;m polystyrene filter</td></tr><tr><td>Anoxomat System</td><td>Mart Microbiology b.v.</td><td>Anoxomat Mark II</td><td></td></tr><tr><td>Benchtop centrifuge</td><td>Thermo Scientific</td><td>75004377</td><td>Sorvall Legend RT Plus microplate rotor</td></tr><tr><td>Gel Documentation</td><td>UVP LLC</td><td>BioDoc-It 210</td><td></td></tr><tr><td>Incubator</td><td>Fisher Scientific</td><td>11-690-625D</td><td>Isotemp </td></tr><tr><td>Labnet&#039;s Gel XL</td><td>Labnet</td><td>E0160</td><td>Labnet&#039;s Gel XL</td></tr><tr><td>Microcentrifuge</td><td>Eppendorf</td><td>22621408</td><td>Microcentrifuge 5415 R</td></tr><tr><td>Multichannel pipettes</td><td>Thermo Scientfic</td><td>4661040, 4661020</td><td>Finnpipette F1</td></tr><tr><td>Thermal Cycler</td><td>Applied Biosystems Inc.</td><td>N805-0200</td><td>GeneAmp PCR system 9700</td></tr></tbody></table>

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.

After PCR amplification using primers F1 and R1, and F3 and R3, approximately 1-kb upstream and downstream of each S. sanguinis gene were obtained in 96-well format, respectively (Figure 2A). Under our PCR conditions and using designed primers, a specific product was amplified from S. sanguinis genomic DNA in each PCR reaction. This result indicated the primers were highly specific to the targets of S. sanguinis. Through PCR re-amplification using primers F1 and R3 and t...

An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

The overall goal of this procedure is to make genome wide single gene deletions in streptococcus sanguine by high throughput PCR. This is accomplished by first obtaining three amplicons by high throughput PCR amplification, including the antibiotic resistance gene, as well as the upstream and the downstream DNA sequences of the target gene. The second step is to obtain the linear recombinant PCR amplicon using three PCR amplicons as templates.Next, the competent s sanguine cells are prepared. The final step is to transform the linear recombinant PCR amplicon into competent s sanguineous cells. Ultimately colon A PCR amplification and DNA sequencing are used to verify the correct mutants.The main advantage of this technique over exhausted other method like suicide plasmid knockout, is this method can create the genome wide deletion mutant directly use high throughput. PCR Primers can be designed and synthesized as described in the written protocol using in-house scripts based on the streptococcus sanguineous SK 36 genome sequence. Three sets of primers were designed for amplification of the one kilobase upstream sequence of the target gene, the A PHA three gene ENC coding, kanamycin resistance protein, and the one kilobase downstream sequence of the target gene.Gene specific primers. R one and F three are designed based upon the five prime and three prime sequences of the target gene to high throughput amplify the one kilobase upstream or downstream region of the target s sanguine genes. First assemble a PCR cocktail mixture on ice in a 15 milliliter conical tube.See the text for the components of the PCR mixture containing s sanguineous genomic DNA transfer 23 microliters of the mixture into each well of a 96 well PCR plate using a multi-channel pipette for the upstream sequence of the target gene transfer one microliter each of F1 and R one from 10 micromolar working primer plates to the PCR plate using the multi-channel pipette. Do the same with F three and R three primers to amplify the downstream sequence of the target gene. Seal the PCR plate and perform amplification at 94 degrees Celsius for one minute, followed by 30 cycles of 94 degrees Celsius for 30 seconds.54 degrees Celsius for 30 seconds and 68 degrees Celsius for 1.5 minutes. Following amplification, prepare a 1%aros gel containing a fitting bromide with 48 wells fitting multichannel pipette loading. Mix four microliters of the PCR product with one microliter of five XDNA loading buffer.On a 96 well plate load the samples on an aros gel using a 10 microliter multi-channel pipettes. Run electrophoresis at 135 volts for 30 minutes. Examine the band on gel under a UVP documentation and analysis system.Purify the PCR products by the pure link 96 PCR purification kit using centrifugation according to the manufacturer's instructions for eluding DNA. Add 40 microliters of sterile double distilled water to each well of the binding plate. Randomly pick several purified amplicons on the plate to examine the DNA concentrations.Using a NanoDrop spectrophotometer, adjust the concentration of amplicons on the plate to approximately 10 nanograms per microliter. Next, use eco R one to digest a plasmid containing the kanamycin resistance gisette so that it can serve as the PCR template. Purify the digested plasmid using the kayak quick PCR purification kit and adjust the linear plasmid DNA to final DNA concentration of 10 nanograms per microliter.Assemble a 25 microliter PCR mixture for the kanamycin resistance Cassette amplicon, including F two and R two primers as listed in the written procedure. Accompanying this video, proceed to perform PCR amplification as instructed here. To examine the PCR product, perform gel electrophoresis on a 1%aros gel.Then pool a bulk of the cany resistance cassette amplicons from 10 PCR purified individuals. Adjust the amplicon concentration to 10 nanograms per microliter. The single most difficult aspect of this procedure is obtaining the final linearly competent PCR applicant from its three PCR applicant t.To ensure success, the three PCR applicant ter are adjusted to near equal amount. Combine one microliter each of the three 10 nanogram per microliter PCR aons in one PCR plate, as well as the PCR template. Then prepare the PCR mixture, including F1 and R three primers as listed in the written procedure.Next, perform PCR amplification of the samples. Examine the PCR AMPLICONS on an aros gel following purification and quantification of the PCR amplicons. As before, freeze the recombined PCR Amplicons at negative 20 degrees Celsius.To begin, prepare Todd Hewitt and horse serum medium as instructed in the written procedure accompanying this video aliquot two milliliters of medium and 10 milliliters of medium into two 15 milliliter conical tubes. Inoculate five microliters of thawed stock s sanguine SK 36 that had been frozen at negative 80 degrees Celsius into two milliliters of medium. Incubate the tightly capped culture overnight at 37 degrees Celsius.Also pre incubate the 10 milliliter medium tube under the same conditions after overnight incubation. Transfer 50 microliters of the culture into the 10 milliliter medium tube. Incubate the tube at 37 degrees Celsius for three hours.Immediately following incubation, add two microliters of 70 nanogram s sanguineous, SK 36 competence stimulating peptide and two microliters of linear recombinant PCR amplicon to einor tubes on a 96 well block and prewar them at 37 degrees Celsius. Transfer 330 microliters of the three hour incubated SK 36 culture into each tube. Replace DNA with sterile double distilled water as a control.Incubate the tubes at 37 degrees Celsius for one hour following incubation. Place the block on ice spread 100 microliters of each transformation on brain heart infusion or BHI agar plates with 500 micrograms per milliliter of can mycin incubate the plates at 37 degrees Celsius for two days under micro aerobic conditions for each replacement mutant, randomly pick up two individual colonies and inoculate each colony into five milliliters of BHI containing 500 micrograms per milliliter of cany. Incubate each inoculum overnight at 37 degrees Celsius under micro anaerobic conditions.Cryopreserve each culture in 30%glycerol at minus 80 degrees Celsius. To examine whether the mutant contains the expected gene replacement. Perform colony PCR for each mutant using F1 and R three primers in a 96 well PCR plate.Use about one microliter of overnight culture from each individual colony as the DNA template in a 25 microliter PCR amplification reaction. Proceed to perform PCR amplification to confirm mutant gene replacement to precisely identify double band mutants or contaminant PCR amplicon. Examine the PCR amplicon by gel electrophoresis for four hours on a greater than 12 centimeter long.2%aros gel with a th bromide staining under this agros gel electrophoresis condition. Any amplicons with greater than or equal to 100 base pair difference can be clearly identified. Alternatively, when bands resulting from amplification of the kanamycin resistance cassette and the wild type gene are anticipated to differ by less than 100 base pairs, use an internal T one primer of the target gene to determine whether a wild type gene can be detected by PCR.To further confirm the deletion, purify the amplicons by pure link 96 PCR purification kit and sequence using the P one primer, which binds to the kanamycin resistance cassette, keep only the correct mutants confirmed by sequencing after PCR amplification using primers F1 and R one for the upstream sequence and F three and R three for the downstream sequence. Approximately one kilobase upstream and downstream of each s sanguineous gene were obtained in 96. Well format under the PCR conditions and using the designed primers.A specific product was amplified from s sanguineous genomic DNA in each PCR reaction, which indicated the primers were highly specific to the targets of s sanguine through PCR re amplification using primers F1 and R three and three amplicons as DNA templates. Linear recombinant PCR constructs were created with high throughput. On a 96 well plate composed of a region upstream of each target gene, a cany cassette, and a region downstream of each target gene in that order, the recombinant PCR constructs were then transformed into s sanguine SK 36 and selected by cany on BHI agar plates.For the majority of transformations, over 1000 colonies were obtained on each plate following a micro aerobic two day incubation. When these colonies were PCR amplified using F1 and R three, a single DNA band corresponding to the expected mutant size was observed by gel electrophoresis when attempting to delete potential essential genes. No colonies should be obtained in the majority of transformations for deletion of some essential genes.However, colonies were still obtained following transformation after PCR amplification of these colonies using F1 and R three 2D NA bands corresponding to the expected mutant size and the wild type size appeared as revealed by gel electrophoresis. For some mutants, the expected mutant size and the wild type size of PCR amplicon were too close to be separated by long agros gel. In this case, an internal T one primer of the target gene was designed based upon the wild type gene sequence.PCR was performed using the internal T one primer and F1 primer. The wild type SK 36 was used as a positive control strain for this PCR. If a band with the expected size was amplified from the mutant using the internal primer, the gene was identified as an essential gene.Since the presence of can mycin cassette in the mutant was confirmed previously by DNA sequencing using the P one primer. Based on this protocol, 2048 non-essential S sanguineous gene mutants were collected. Excluding those four open reading frames contained entirely within other open reading frames.218 genes, which are essential for s sanguine survival were identified under the experimental conditions. After watching these videos, I think you should have a good understanding how to make the genome wide. Gene ions use high throughput PCR.

genome-wide-gene-deletions-streptococcus-sanguinis-high-throughput

Research

JoVE Journal

Biology

Systematic, large-scale synthetic genetic (gene-gene or epistasis) interaction screens can be used to explore genetic redundancy and pathway cross-talk. Here, we describe a high-throughput quantitative synthetic genetic array screening technology, termed eSGA that we developed for elucidating epistatic relationships and exploring genetic interaction networks in Escherichia coli.

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Source: Tomás, J. M., et al. Generation of Null Mutants to Elucidate the Role of Bacterial Glycosyltransferases in Bacterial Motility. J. Vis. Exp. (2022).This video demonstrates the initiator-dependent amplification of a suicide plasmid in E. coli. The plasmid, which carries an antibiotic resistance gene, replicates only in the presence of an initiator protein encoded by the host. After electroporation and incubation in recovery medium, the mixture is plated on antibiotic-containing agar.

Amplification of a Suicide Plasmid in a Bacterial Host

CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

Experimental validation of enhancer activity is best approached by loss-of-function analysis. Presented here is an efficient protocol that uses CRISPR/Cas9 mediated deletion to study allele-specific regulation of gene transcription in F1 ES cells which contain a hybrid genome (Mus musculus129 x Mus castaneus).

Generating CRISPR/Cas9 Mediated Monoallelic Deletions to Study Enhancer Function in Mouse Embryonic Stem Cells

This manuscript describes a duplex digital PCR assay that can be used to simultaneously quantify Enterococcus spp. and the HF183 genetic markers as indicators of general and human-associated fecal contamination in recreational waters.

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

We describe a facile, rapid, and relatively inexpensive method for the generation of gene-disrupted Streptococcus mutans strains; this technique may be adapted for the generation of gene-disrupted strains of various species.

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Here we present a protocol for the use of pre-existing antibiotic resistance-cassette deletion constructs as a basis for making deletion mutants in other E. coli strains. Such deletion mutations can be mobilized and inserted into the corresponding locus of a recipient strain using P1 bacteriophage transduction.

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

Described here is a simple method for the purification of a gene product in Streptococcus mutans. This technique may be advantageous in the purification of proteins, especially membrane proteins and high molecular mass proteins, and can be used with various other bacterial species.

Purification of a High Molecular Mass Protein in Streptococcus mutans

Described here is a method for targeted, markerless gene deletion in Chlamydia trachomatis using floxed cassette allelic exchange mutagenesis, FLAEM.

Markerless Gene Deletion by Floxed Cassette Allelic Exchange Mutagenesis in Chlamydia trachomatis

Here, we describe the construction of null mutants of Aeromonas in specific glycosyltransferases or regions containing glycosyltransferases, the motility assays, and flagella purification performed to establish the involvement and function of their encoded enzymes in the biosynthesis of a glycan, as well as the role of this glycan in bacterial pathogenesis.

Generation of Null Mutants to Elucidate the Role of Bacterial Glycosyltransferases in Bacterial Motility

Learn genome-wide gene deletion in Streptococcus sanguinis using high throughput PCR and recombinant transformation. This efficient method enables rapid bacterial genetic studies and functional gene analysis.

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Explore More Videos