Name: Identification of Host Pathways Targeted by Bacterial Effector Proteins using Yeast Toxicity and Suppressor Screens (Video) | JoVE Journal
Uploaded: 2019-10-25T15:00:00.000+00:00
Duration: 7 min 40 s
Description: Learn yeast toxicity and suppressor screens to identify host pathways targeted by bacterial effector proteins. This method reveals molecular mechanisms of pathogenesis in intracellular pathogens like Chlamydia trachomatis.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

playerTrialDesktop

We thank Shelby Andersen, Abby McCullough, and Laurel Woods for their assistance with these techniques. This study was funded by startup funds from the University of Iowa Department of Microbiology and Immunology to Mary M. Weber.

1. Preparation of media and reagents
NOTE: Plates should be prepared before the day of the assay and are good for 1 month. Media and reagents can be made at any point and are good for 1 month.
<ol>
	<li>Prepare 1 L of the glucose solution (10% w/v) by dissolving 100 g of D-(+)-glucose in 800 mL of distilled water in a 1, 000 mL beaker. Adjust the volume to 1 L with distilled water. Filter through a 0.2 &#181;m sterile filter into a sterile 1 L media storage bottle.</li>
	<li>Prepare 1 L of the galactose solution (10% w/v) by dissolving 100 g of D-(+)- galactose in 800 mL of distilled water in a 1 L beaker. Adjust the volume to 1 mL using distilled water and filter through a 0.2 &#181;m sterile filter into a sterile 1,000 mL media storage bottle.</li>
	<li>Prepare 1 L of yeast extract peptone dextrose (YPD) agar by dissolving 10 g of yeast extract, 20 g of peptone, 20 g of glucose, and 20 g of agar in 1,000 mL of distilled water. Autoclave for 20 min and cool in 56 &#730;C water bath until cooled. Pour into 100 mm plates using ~20 mL of media per plate.</li>
	<li>Prepare 1 L of YPD broth by dissolving 10 g of yeast extract, 20 g of peptone, and 20 g of glucose in 1,000 mL of distilled water. Autoclave for 20 min.</li>
	<li>Prepare the synthetic dropout (SD) uracil (Ura-) glucose agar. For 1 L, dissolve 6.7 g of yeast nitrogen base without amino acids, 1.9 g of dropout supplement without uracil, and 15 g of agar in 800 mL of distilled water. Autoclave for 20 min and cool in a 56 &#730;C water bath until the temperature is ~50&#8722;60 &#730;C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 mL of the glucose solution prepared in step 1.1. Mix well by gently swirling or place on stir plate. Pour into 100 mm plates using ~20 mL of media per plate.</li>
	<li>Prepare the synthetic dropout (SD) uracil (Ura-) galactose agar. For 1 L, dissolve 6.7 g of yeast nitrogen base without amino acids, 1.9 g of dropout supplement without uracil, and 15 g of agar in 800 mL of distilled water. Autoclave for 20 min and cool in a 56 &#730;C water bath until the temperature is ~50&#8722;60 &#730;C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 mL of the galactose solution prepared in step 1.2. Mix well by gently swirling or place on the stir plate. Pour into 100 mm plates using ~20 mL of media per plate.</li>
	<li>Prepare the synthetic dropout (SD) uracil (Ura-) glucose broth. For 1 L, dissolve 6.7 g of yeast nitrogen base without amino acids and 1.9 g of dropout supplement without uracil in 800 mL of distilled water. Autoclave for 20 min and cool in a 56 &#730;C water bath until the temperature is ~50&#8722;60 &#730;C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 ml of the glucose solution prepared in step 1.1.</li>
	<li>Prepare the synthetic dropout (SD) uracil (Ura-) leucine (Leu-) glucose agar. For 1 L, dissolve 6.7 g of the yeast nitrogen base without amino acids; 1.9 g of dropout supplement without uracil, leucine, and tryptophan; 15 g of agar; and 0.076 g of tryptophan in 800 mL of distilled water. Autoclave for 20 min and cool in a 56 &#730;C water bath until the temperature is ~50&#8722;60 &#730;C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 mL of the glucose solution prepared in step 1.1. Pour into 100 mm plates using ~20 mL of media per plate.</li>
	<li>Prepare synthetic dropout (SD) uracil (Ura-) leucine (Leu-) galactose agar. For 1 L, dissolve 6.7 g of yeast nitrogen base without amino acids; 1.9 g of dropout supplement without uracil, leucine, and tryptophan; 15 g of agar; and 0.076 g of tryptophan in 800 mL of distilled water. Autoclave for 20 min and cool in a 56 &#730;C water bath until the temperature is ~50&#8722;60 &#730;C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 mL of the galactose solution prepared in step 1.2. Mix well by gently swirling or placing on a stir plate. Pour into 100 mm plates using ~20 mL of media per plate.</li>
	<li>Prepare synthetic dropout (SD) uracil (Ura-) leucine (Leu-) glucose broth. For 1 L, dissolve 6.7 g of yeast nitrogen base without amino acids; 1.9 g of dropout supplement without uracil, leucine, tryptophan; and 0.076 g of tryptophan in 800 mL of distilled water. Autoclave for 20 min and cool in a 56&#8722;60 &#730;C water bath until the temperature is ~50 &#730;C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 mL of the glucose solution prepared in step 1.1.</li>
	<li>Prepare polyethylene glycol (PEG) solution. Add 50% w/v of polyethylene glycol 3350 in distilled water. Sterilize by autoclaving.</li>
	<li>Prepare 1 M lithium acetate (LiAc) by dissolving 10.2 g of lithium acetate dehydrate in 200 mL of distilled water. Sterilize by autoclaving.</li>
	<li>Prepare herring sperm DNA. Dilute 10 mg/mL herring sperm DNA to 2 mg/mL using distilled water. Heat at 100 &#730;C for 5 min and immediately place on ice for 5 min.</li>
</ol>
2. Cloning the gene of interest into the yeast toxicity plasmid pYesNTA-Kan
NOTE: Currently, there are a variety yeast toxicity vectors available both commercially and academically. The yeast suppressor screen can be used in conjunction with many of these vectors provided the plasmid expressing the effector protein of interest uses a dropout selection other than uracil and an antibiotic marker other than BlaR. This work used a modified pYesNTA vector4,5 that includes a kanamycin resistance cassette for easier screening for potential suppressors. The cloning scheme must allow for the effector protein to be in-frame with the Gal promoter and His-Tag. The Chlamydia trachomatis inclusion membrane protein CT229 was used as a proof of principle for these assays.
<ol>
	<li>Use PCR to amplify CT229 from C. trachomatis genomic DNA following the manufacturer&#39;s instructions using CT229 +1 Kpn F (CCGGTACCAATGAGCTGTTCTAATGTTAATTCAGGT) and CT229 XhoI R (CCCTCGAGTTTTTTACGACGGGATGCC) primers. Use the following PCR conditions: (1) 98 &#176;C for 30 s; (2) 98 &#176;C for 10 s, 55 &#176;C for 30 s, 72 &#176;C for 2 min; (3) repeat step 2 for a total of 25x; (4) 72 &#176;C for 10 min; and (5) 4 &#176;C hold.</li>
	<li>Analyze 5 &#181;L of the PCR product on a 1% agarose gel (Figure 1).</li>
	<li>Purify the remaining 45 &#181;L of DNA using a PCR purification kit following the manufacturer&#39;s instructions.</li>
	<li>Digest the 50 &#181;L of purified PCR insert and pYesNTA-Kan (Figure 2) for 1 h at 37 &#176;C in a water bath using KpnI-HF and XhoI-HF. 
	NOTE: For pYesNTA-Kan, digest 5 &#181;g of plasmid using 5 &#181;L of KpnI-HF, 5 &#181;l of XhoI-HF, and 6 &#181;L of buffer in a total volume of 60 &#181;L. For the insert, digest the entire 50 &#181;L of purified PCR product using 2 &#181;L of KpnI-HF, 2 &#181;L of XhoI-HF, and 6 &#181;L of buffer.</li>
	<li>Run the entire plasmid digest on a 1% agarose gel. Perform purification of the digested plasmid using a gel extraction kit following the manufacturer&#39;s instructions.</li>
	<li>Purify the digested PCR insert using a PCR purification kit following the manufacturer&#39;s instructions.</li>
	<li>Clone the insert into pYesNTA-Kan using 2 &#181;L of pYesNTA-Kan (step 2.5), 2 &#181;L of DNA ligase buffer, 1 &#181;L of T4 ligase, and 15 &#181;L of insert (step 2.6). Incubate at room temperature for 1 h.</li>
	<li>Add the entire cloning reaction to 50 &#181;L of E. coli competent cells and perform the transformation reaction.</li>
	<li>Plate the entire transformation reaction on an LB plate containing 100 &#181;g/mL of carbenicillin.</li>
	<li>Inoculate 10 mL of the LB containing 100 &#181;g/mL of carbenicillin with three individual colonies. Incubate overnight at 37 &#730;C with shaking at 150 rpm.</li>
	<li>Isolate the plasmid using a plasmid miniprep kit following the manufacturer&#39;s instructions.</li>
	<li>Sequence the isolated plasmids using gene-specific primers (step 2.1).</li>
</ol>
3. Test the protein of interest for toxicity in yeast
<ol>
	<li>Streak Saccharomyces cerevisiae W303 on YPD agar (step 1.3) to obtain isolated colonies. Incubate at 30 &#176;C for 24 h.</li>
	<li>Inoculate 10 mL of YPD broth (step 1.4) with a single colony from the agar plate (step 3.1). Incubate at 30 &#176;C with shaking at 150 rpm overnight.</li>
	<li>Add 0.5 mL of the overnight culture to 10 mL of YPD broth (step 1.4) and incubate at 30 &#176;C with shaking at 150 rpm for 4 h.
	<ol>
		<li>Pellet the 10 mL of culture at 3,000 x g for 10 min at 4 &#176;C.</li>
		<li>Resuspend the pellet in 1 mL of sterile water, transfer to the microcentrifuge tube, and pellet at 3,000 x g for 1 min at room temperature.</li>
		<li>Resuspend the pellet in 1 mL of 1 mM lithium acetate (LiAc) and pellet at 3,000 x g for 1 min at room temperature.</li>
		<li>Repeat the LiAc wash 2x.</li>
		<li>Remove the wash. Resuspend the pellet in 2.4 mL of 50% PEG 3350. Add 360 &#181;L of 1M LiAc, 500 &#181;L of 2 mg/mL of herring sperm DNA, and 400 &#181;L of sterile water. 
		NOTE: This is sufficient for 20 transformations.</li>
		<li>Add 180 &#181;L of the transformation mix from step 3.3.5 to a microcentrifuge tube containing 5 &#181;L of pYesNTA-Kan CT229 plasmid DNA (100&#8722;500 ng) from step 2.12.</li>
		<li>Incubate in a water bath at 30 &#176;C for 30 min.</li>
		<li>Incubate in a water bath at 42 &#176;C for 30 min.</li>
		<li>Pellet at 3,000 x g for 1 min at room temperature.</li>
		<li>Remove the transformation mix with the pipette. Resuspend the pellet in 100 &#181;L of sterile water. Plate the transformation on SD Ura- agar with glucose (step 1.5).</li>
		<li>Incubate plates at 30 &#730;C for 48 h.</li>
	</ol>
	</li>
	<li>Inoculate 5 mL of SD Ura- broth containing glucose (step 1.7) with a single colony from the plate. Incubate overnight at 30 &#176;C with shaking at 150 rpm. Include yeast transformed with the vector alone as a negative control.
	<ol>
		<li>Add 180 &#181;L of sterile water to 5 wells of a 96 well plate (A2&#8722;A6).</li>
		<li>Vortex the overnight culture to mix.</li>
		<li>Add 180 &#181;L of yeast to the first well (A1). Serially dilute 1:10 (six samples in total including undiluted).</li>
		<li>Using a multichannel pipette, spot 5 &#181;L of each dilution on SD Ura- glucose (step 1.5) and Ura- galactose (step 1.6) agar plates. Incubate at 30 &#176;C for 48 h.</li>
	</ol>
	</li>
	<li>Assess the toxicity by comparing the growth of the yeast expressing the effector protein of interest grown on the galactose-containing media to the growth of yeast expressing the vector alone.</li>
	<li>Confirm the expression of the His-tag fusion protein by Western blotting.</li>
</ol>
4. Transform toxic yeast with the yeast genomic library
<ol>
	<li>Inoculate 100 mL of SD Ura- glucose broth (step 1.7) using 1 mL of the stock from step 3.4. Incubate for 16&#8722;24 h at 30 &#176;C with shaking at 150 rpm. Place 900 mL of SD Ura- glucose broth at 30 &#176;C overnight to prewarm the media.</li>
	<li>Add the entire 100 mL of the overnight culture to the prewarmed 1 L flask. Incubate for 4&#8722;5 h at 30 &#176;C with shaking at 150 rpm.
	<ol>
		<li>Pellet the culture at 6,000 x g for 10 min at 4 &#176;C.</li>
		<li>Discard the supernatant. Resuspend the pellet in 250 mL of sterile water. Pellet the culture at 6,000 x g for 5 min at 4 &#176;C.</li>
		<li>Discard the supernatant. Resuspend the pellet in 250 mL of 1 mM LiAc. Pellet the culture at 6,000 x g for 5 min at 4 &#176;C.</li>
		<li>Remove LiAc and resuspend the pellet in 9.6 mL of 50% PEG 3350. Add 1.44 mL of 1M LiAc, 2 mL of 2 mg/mL herring sperm DNA, 50 &#181;g of the pYep13 genomic library (ATCC 37323). Adjust the volume to 15 mL with sterile water. Mix gently by inversion.</li>
		<li>Incubate in a water bath at 30 &#176;C for 30 min.</li>
		<li>Add 750 &#181;L of dimethyl sulfoxide (DMSO) to enhance the transformation efficiency. Incubate in a water bath at 42 &#176;C for 30 min. Mix by gentle inversion every 10 min.</li>
		<li>Pellet the yeast at 3,000 x g for 5 min at room temperature.</li>
		<li>Discard the supernatant and resuspend the pellet in 10 mL of sterile water. Pellet at 3,000 x g for 5 min at room temperature.</li>
		<li>Resuspend the pellet in 8 mL of sterile water.</li>
		<li>To determine the transformation efficiency, dilute 1:10 and plate 100 &#181;L of each dilution on SD Ura- Leu- glucose agar (step 1.8).</li>
		<li>Plate 200 &#181;L of the sample on SD Ura- Leu- galactose agar (step 1.9) plates. Use 50 plates in total.</li>
		<li>Incubate at 30 &#176;C for 48&#8722;96 h or until colonies appear. 
		NOTE: Colonies generally appear on glucose agar plates at 48&#8722;72 h and galactose agar plates at 72&#8722;96 h.</li>
	</ol>
	</li>
	<li>Patch colonies (potential rescues) on SD Ura- Leu- galactose agar (step 1.9) to expand and make stock. Incubate at 30 &#176;C for 24&#8722;48h.</li>
	<li>Inoculate 5 mL of SD Ura- Leu- glucose broth (step 1.10) using the part of the patch. Incubate overnight at 26 &#176;C with shaking at 150 rpm.
	<ol>
		<li>Add 180 &#181;L of the sterile water to 5 wells of a 96 well plate (A2&#8722;A6).</li>
		<li>Vortex the overnight culture to mix.</li>
		<li>Add 180 &#181;L of yeast to the first well (A1). Serially dilute 1:10 (six samples in total including undiluted).</li>
		<li>Using a multichannel pipette, spot 5 &#181;L of each dilution on SD Ura- glucose and SD Ura- galactose agar plates. Include toxic effector alone as a control.</li>
		<li>Incubate at 30 &#176;C for 48 h.</li>
	</ol>
	</li>
	<li>Compare the growth of the yeast expressing the toxic effector alone to yeast containing the potential suppressors. Only proceed with potential suppressors that have diminished toxicity compared to the yeast expressing the effector alone.</li>
</ol>
5. Identify and confirm suppressors
<ol>
	<li>Inoculate 5 mL of SD Ura- Leu- glucose broth (step 1.10) with 100 &#181;L of yeast from step 4.4 and incubate overnight at 30 &#176;C with shaking at 150 rpm.
	<ol>
		<li>Pellet the yeast at 3,000 x g for 2 min at room temperature. Gently discard the supernatant using a pipette.</li>
		<li>Isolate the plasmid with a yeast plasmid miniprep kit following the manufacturer&#39;s instructions.</li>
	</ol>
	</li>
	<li>Transform the isolated plasmid into the E. coli competent cells and plate the entire transformation on LB agar with 100 &#181;g/mL of carbenicillin. Incubate at 37 &#176;C for 24 h.</li>
	<li>Inoculate 10 mL of LB broth containing 100 &#181;g/mL of carbenicillin, with three colonies from the plate and incubate at 37 &#176;C overnight with shaking at 150 rpm.
	<ol>
		<li>Pellet cultures at 3,000 x g for 10 min at room temperature. Isolate plasmid using a miniprep kit following the manufacturer&#39;s instructions.</li>
	</ol>
	</li>
	<li>Retransform the toxic yeast with the isolated plasmids from step 5.3.1 following the steps in part 3 of the protocol.
	<ol>
		<li>Inoculate 5 mL of SD Ura- Leu- glucose broth with a colony from the transformation plate. Incubate overnight at 30 &#176;C with shaking at 150 rpm.</li>
		<li>Spot on Ura- Leu- glucose and galactose agar to confirm suppression of toxicity.</li>
	</ol>
	</li>
	<li>Sequence using pYep13 F (ACTACGCGATCATGGCGA) and pYep13 R (TGATGCCGGCCACGATGC) primers to identify yeast ORFs. </li>
</ol>

<ol><li>Tan, Y., Luo, Z. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Legionella+pneumophila+SidD+is+a+deAMPylase+that+modifies+Rab1%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Legionella pneumophila SidD is a deAMPylase that modifies Rab1.</a> Nature. 475 (7357), 506-509 (2011).</li>
<li>Guo, Z., Stephenson, R., Qiu, J., Zheng, S., Luo, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+Legionella+effector+modulates+host+cytoskeletal+structure+by+inhibiting+actin+polymerization%5BTitle%5D)+AND+%22Microbes+and+Infection%22%5BJournal%5D)">A Legionella effector modulates host cytoskeletal structure by inhibiting actin polymerization.</a> Microbes and Infection. 16 (3), 225-236 (2014).</li>
<li>Tan, Y., Arnold, R. J., Luo, Z. -Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Legionella+pneumophila+regulates+the+small+GTPase+Rab1+activity+by+reversible+phosphorylcholination%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Legionella pneumophila regulates the small GTPase Rab1 activity by reversible phosphorylcholination.</a> Proceedings of the National Academy of Sciences of the United States of America. 108 (52), 21212-21217 (2011).</li>
<li>Weber, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+type+IV+secreted+effector+protein+CirA+stimulates+the+GTPase+activity+of+RhoA+and+is+required+for+virulence+in+a+mouse+model+of+Coxiella+burnetii+infection%5BTitle%5D)+AND+%22Infection+and+Immunity%22%5BJournal%5D)">The type IV secreted effector protein CirA stimulates the GTPase activity of RhoA and is required for virulence in a mouse model of Coxiella burnetii infection.</a> Infection and Immunity. 84, (2016).</li>
<li>Faris, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Chlamydia+trachomatis+CT229+subverts+Rab+GTPase-dependent+CCV+trafficking+pathways+to+promote+chlamydial+infection%5BTitle%5D)+AND+%22Cell+Reports%22%5BJournal%5D)">Chlamydia trachomatis CT229 subverts Rab GTPase-dependent CCV trafficking pathways to promote chlamydial infection.</a> Cell Reports. 26, 3380-3390 (2019).</li>
<li>Mumberg, D., Müller, R., Funk, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Yeast+vectors+for+the+controlled+expression+of+heterologous+proteins+in+different+genetic+backgrounds%5BTitle%5D)+AND+%22Gene%22%5BJournal%5D)">Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds.</a> Gene. 156, 119(1995).</li>
<li>Hill, J., Donald, K. A. G., Griffiths, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DMSO-enhanced+whole+cell+yeast+transformation%5BTitle%5D)+AND+%22Nucleic+Acids+Research%22%5BJournal%5D)">DMSO-enhanced whole cell yeast transformation.</a> Nucleic Acids Research. 19 (20), 41070(1991).</li>
<li>Kramer, R. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Yeast+Functional+Genomic+Screens+Lead+to+Identification+of+a+Role+for+a+Bacterial+Effector+in+Innate+Immunity+Regulation%5BTitle%5D)+AND+%22PLoS+Pathogens%22%5BJournal%5D)">Yeast Functional Genomic Screens Lead to Identification of a Role for a Bacterial Effector in Innate Immunity Regulation.</a> PLoS Pathogens. 3 (2), 21(2007).</li>
<li>Häuser, R. T. S., Rajagopala, S. V., Uetz, P. Array-Based Yeast Two-Hybrid Screens: A Practical Guide. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aH%C3%A4user%2C+RTS+%22Two+Hybrid+Technologies%3A+Methods+and+Protocols%2C+Methods+in+Molecular+Biology%22">Two Hybrid Technologies: Methods and Protocols, Methods in Molecular Biology</a>. , 21-38 (2012).</li>
<li>Mirrashidi, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Global+mapping+of+the+inc-human+interactome+reveals+that+retromer+restricts+chlamydia+infection%5BTitle%5D)+AND+%22Cell+Host+and+Microbe%22%5BJournal%5D)">Global mapping of the inc-human interactome reveals that retromer restricts chlamydia infection.</a> Cell Host and Microbe. 18 (1), 109-121 (2015).</li>
<li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Development+of+a+transformation+system+for+chlamydia+trachomatis%3A+Restoration+of+glycogen+biosynthesis+by+acquisition+of+a+plasmid+shuttle+vector%5BTitle%5D)+AND+%22PLoS+Pathogens%22%5BJournal%5D)">Development of a transformation system for chlamydia trachomatis: Restoration of glycogen biosynthesis by acquisition of a plasmid shuttle vector.</a> PLoS Pathogens. 7 (9), 1002258(2011).</li>
<li>Mueller, K. E., Wolf, K., Fields, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gene+deletion+by+fluorescence-reported+allelic+exchange+mutagenesis+in+Chlamydia+trachomatis%5BTitle%5D)+AND+%22mBio%22%5BJournal%5D)">Gene deletion by fluorescence-reported allelic exchange mutagenesis in Chlamydia trachomatis.</a> mBio. 7 (1), 1-9 (2016).</li>
<li>Johnson, C. M., Specific Fisher, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Site-Specific%2C+Insertional+Inactivation+of+incA+in+Chlamydia+trachomatis+Using+a+Group+II+Intron%5BTitle%5D)+AND+%22PLoS+ONE%22%5BJournal%5D)">Site-Specific, Insertional Inactivation of incA in Chlamydia trachomatis Using a Group II Intron.</a> PLoS ONE. 8 (12), 83989(2013).</li>
<li>Weber, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Absence+of+specific+Chlamydia+trachomatis+inclusion+membrane+proteins+triggers+premature+inclusion+membrane+lysis+and+host+cell+death%5BTitle%5D)+AND+%22Cell+Reports%22%5BJournal%5D)">Absence of specific Chlamydia trachomatis inclusion membrane proteins triggers premature inclusion membrane lysis and host cell death.</a> Cell Reports. 19 (7), 1406-1417 (2017).</li>
<li>Weber, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+functional+core+of+IncA+is+required+for+Chlamydia+trachomatis+inclusion+fusion%5BTitle%5D)+AND+%22Journal+of+Bacteriology%22%5BJournal%5D)">A functional core of IncA is required for Chlamydia trachomatis inclusion fusion.</a> Journal of Bacteriology. 198 (8), 1347-1355 (2016).</li>
</ol>

The authors declare that they have no competing financial interests.

This protocol outlines step-by-step procedures for identifying host biological pathways targeted by bacterial effector proteins using a modified yeast toxicity and suppressor screen. The yeast strain used, S. cerevisiae W303, is auxotrophic for both uracil and leucine. Uracil auxotrophy of the strain is used to select yeast carrying the protein of interest on the pYesNTA-Kan vector while leucine auxotrophy is used to select for the yeast genomic library vector pYep13. The yeast genomic library plasmids carry 3&#...

The first report of procedures similar to those presented here characterized the Legionella pneumophila type IV effector SidD, a deAMPylase that modifies Rab11. Comparable techniques were used for the characterization of several L. pneumophila effectors1,2,3. The assay was adapted to characterize a Coxiella burnetii type IV effector protein4, and recently the utility of this technique was expanded for the characterization of Chlamydia trachomatis inclusion membrane proteins5.
This protocol can be broken into two major parts: 1) the yeast toxicity screen, in which the bacterial effector protein of interest is expressed in yeast and clones are screened for a toxic phenotype as evidenced by a growth defect, and 2) the yeast suppressor screen, in which the toxic phenotype is suppressed by expression of a yeast genomic library in the toxic strain. Thus, the toxicity screen is a screen for toxic phenotypes that manifest as growth defects when the bacterial effector of interest is overexpressed. Toxic clones, successfully transformed with and expressing the bacterial effector, are selected and saved for the next step. The second major step involves overexpressing a partially digested yeast genomic library in the toxic yeast clone. Plasmids making up the yeast genomic library suggested for the use in this protocol carry 5&#8722;20 kb inserts, usually corresponding to 3&#8722;13 yeast open reading frames (ORF) of an average gene size of ~1.5 kb across all plasmids, representing the whole yeast genome covered approximately 10x. This part of the assay is called the suppressor screen, as the goal is to suppress the toxicity of the bacterial effector protein. Potential suppressor plasmids are isolated from yeast, sequenced, and the suppressing ORFs identified. The rationale underlying the suppressor screen is that the effector protein binds, interacts with, and/or overwhelms components of the host pathway it targets, and that providing those host proteins back in excess can rescue the toxic effect on the pathway and thus, the growth defect. Thus, identified ORFs that suppress toxicity often represent multiple participants of a host pathway. Orthogonal experiments are then performed to verify that the bacterial effector indeed interacts with the implicated pathway. This is especially necessary if a binding partner such as clathrin or actin has been identified, because these proteins are involved in a multitude of host processes. Further experiments can then elucidate the physiological function of the effector protein during infection. The toxicity and suppressor screens are also powerful tools for deciphering the physiological function of bacterial effector proteins that do not physically bind host proteins with affinities sufficient to detect by immunoprecipitation or that interact with the host in enzymatic hit-and-run interactions that may not be detected by a yeast-two hybrid screen.
Although the suppressor screen can be a powerful method to reveal potential physiological interactions between bacterial effector proteins and host pathways, the bacterial effector protein must induce a growth defect in yeast, otherwise using it in the suppressor screen will be of little use. Furthermore, the toxic phenotype must result in at least a 2&#8722;3 log10 deficit in growth or it will be difficult to identify suppressors. If a laboratory is set up for cell culture, screening effector proteins for toxicity in common cell lines such as HeLa can often give insight as to whether it is worth the effort to proceed with the yeast toxicity screen. Ectopic expression of the effector protein in HeLa cells sometimes results in toxicity that correlates very strongly with toxicity in the yeast strain used for these screens4. Observable hallmarks of stress in HeLa cells include loss of stress fibers, cell detachment from the plate, and nuclear condensation indicating apoptosis. Any visual indication of stress in HeLa cells make the protein of interest a good candidate for inducing a growth defect in yeast, which replicate much more rapidly and are thus more responsive to perturbation of essential pathways.
It should be noted that the suppressor screen does not always identify host binding partners as suppressors, but it can still implicate critical components of the host pathway(s) targeted, yielding a holistic view of the biological processes being hijacked by the bacterial effector protein. On the surface, this seems counterintuitive, because providing the binding partner of the effector protein in excess would be expected to rescue the growth defect. In efforts to identify pathways targeted by the C. trachomatis effector protein CT229 (CpoS), which binds to at least 10 different Rab GTPases during infection5, none of the Rab binding partners suppressed the toxicity of CT229. However, numerous suppressors involved in clathrin-coated vesicle (CCV) trafficking were identified, which led to further work demonstrating that CT229 specifically subverts Rab-dependent CCV trafficking. Similarly, when investigating the C. burnetii effector protein Cbu0041 (CirA) several Rho GTPases that rescued the yeast growth defect were identified, and it was later found that CirA functions as a GTPase activating protein (GAP) for RhoA4.
The usefulness of the yeast suppressor screen for elucidating host pathways targeted by bacterial effector proteins cannot be overstated, and other researchers attempting to characterize intracellular bacterial effector proteins can greatly benefit from these techniques. These assays are of value if immunoprecipitations and/or yeast-two hybrid screens have failed to find a binding partner and can elucidate which pathways are targeted by the bacterial effector protein. Here, detailed protocols for the toxicity and suppressor screens to identify host biological pathways targeted by intracellular bacterial effector proteins are provided, as well as some of the common obstacles experienced when using these assays and their corresponding solutions.

<table><tbody><tr><td>Agar</td><td>Fisher Scientific</td><td>BP2641500</td><td></td></tr><tr><td>Galactose</td><td>MilliporeSigma</td><td>G0750-1KG</td><td></td></tr><tr><td>GeneJet Gel extraction kit</td><td>ThermoFisher Scientific</td><td>K0691</td><td></td></tr><tr><td>GeneJet PCR purification kit</td><td>ThermoFisher Scientific</td><td>K0701</td><td></td></tr><tr><td>GeneJet plasmid miniprep kit</td><td>Thermo</td><td>K0503</td><td></td></tr><tr><td>Glucose</td><td>MilliporeSigma</td><td>G8270-1KG</td><td></td></tr><tr><td>Herring Sperm DNA</td><td>Promega</td><td>D1811</td><td></td></tr><tr><td>KpnI-HF</td><td>New England Biolabs</td><td>R3142S</td><td></td></tr><tr><td>Lithium acetate dihydrate</td><td>MilliporeSigma</td><td>L6883-250G</td><td></td></tr><tr><td>Peptone</td><td>Fisher Scientific</td><td></td><td></td></tr><tr><td>Phusion High-Fidelity DNA Polymerase</td><td>New England Biolabs</td><td>M0530</td><td></td></tr><tr><td>Poly(ethylene glycol) 3350</td><td>MilliporeSigma</td><td>1546547-1G</td><td></td></tr><tr><td>pYep13</td><td>ATCC</td><td>37323</td><td></td></tr><tr><td>T4 DNA ligase</td><td>New England Biolabs</td><td>M0202S</td><td></td></tr><tr><td>Tryptophan</td><td>MilliporeSigma</td><td>470031-1G</td><td></td></tr><tr><td>XhoI-HF</td><td>New England Biolabs</td><td>R0146S</td><td></td></tr><tr><td>Yeast extract</td><td>Fisher Scientific</td><td>BP1422-500</td><td></td></tr><tr><td>Yeast miniprep kit</td><td>Zymo</td><td>D2001</td><td></td></tr><tr><td>Yeast nitrogen base without amino acids</td><td>MilliporeSigma</td><td>Y0626-250G</td><td></td></tr><tr><td>Yeast Synthetic Drop-out Medium Supplements</td><td>MilliporeSigma</td><td>Y1501-20G</td><td>without uracil</td></tr><tr><td>Yeast Synthetic Drop-out Medium Supplements</td><td>MilliporeSigma</td><td>Y1771-20G</td><td>without uracil, leucine, tryptophan</td></tr></tbody></table>

identification of host pathways targeted by bacterial effector proteins using yeast toxicity and suppressor screens

Identification of Host Pathways Targeted by Bacterial Effector Proteins using Yeast Toxicity and Suppressor Screens

Intracellular bacteria secrete virulence factors called effector proteins into the host cytosol that act to subvert host proteins and/or their associated biological pathways to the benefit of the bacterium. Identification of putative bacterial effector proteins has become more manageable due to advances in bacterial genome sequencing and the advent of algorithms that allow in silico identification of genes encoding secretion candidates and/or eukaryotic-like domains. However, identification of these important virulence factors is only an initial step. Naturally, the goal is to determine the molecular function of effector proteins and elucidate how they interact with the host. In recent years, techniques like the yeast two-hybrid screen and large-scale immunoprecipitations coupled with mass spectrometry have aided in the identification of protein-protein interactions. Although identification of a host binding partner is the crucial first step toward elucidating the molecular function of a bacterial effector protein, sometimes the host protein is found to have multiple biological functions (e.g., actin, clathrin, tubulin), or the bacterial protein may not physically bind host proteins, depriving the researcher of crucial information about the precise host pathway being manipulated. A modified yeast toxicity screen coupled with a suppressor screen has been adapted to identify host pathways impacted by bacterial effector proteins. The toxicity screen relies on a toxic effect in yeast caused by the effector protein interfering with the host biological pathways, which often manifests as a growth defect. Expression of a yeast genomic library is used to identify host factors that suppress the toxicity of the bacterial effector protein and thus identify proteins in the pathway that the effector protein targets. This protocol contains detailed instructions for both the toxicity and suppressor screens. These techniques can be performed in any lab capable of molecular cloning and cultivation of yeast and Escherichia coli.

Before the actual yeast suppressor screen can be performed, the effector protein of interest must be tested for toxicity in yeast. This is accomplished by expressing the protein of interest in yeast under the control of a galactose-inducible promoter. Growth on glucose (noninducing conditions) should first be compared to ensure toxicity is specifically due to the expression of the protein of interest and is not a general defect. As shown in Figure 3, toxicity manifests as smaller colonies an...

Bacterial pathogens secrete proteins into the host that target crucial biological processes. Identifying the host pathways targeted by bacterial effector proteins is key to addressing molecular pathogenesis. Here, a method using a modified yeast suppressor and toxicity screen to elucidate host pathways targeted by toxic bacterial effector proteins is described.

Intracellular bacteria secrete virulence factors called effector proteins into the host cytosol that act to subvert host proteins and/or their associated ...

identification-host-pathways-targeted-bacterial-effector-proteins

Research

JoVE Journal

Genetics

In this video, we describe a procedure for the expression of bacterial type III effectors in yeast and the identification of effector-induced growth inhibition phenotypes.  Such phenotypes can be subsequently exploited to elucidate effector functions and targets.

Identification of Growth Inhibition Phenotypes Induced by Expression of Bacterial Type III Effectors in Yeast

Here we describe a plasmid overexpression screen in Saccharomyces cerevisiae, using an arrayed plasmid library and a high-throughput yeast transformation protocol with a liquid handling robot.

High-throughput Yeast Plasmid Overexpression Screen

We have developed comprehensive, unbiased genome-wide screens to understand gene-drug and gene-environment interactions. Methods for screening these mutant collections are presented.

Competitive Genomic Screens of Barcoded Yeast Libraries

Yeast proteinopathy models are valuable tools to assess the toxicity and aggregation of proteins implicated in disease. Here, we present methods for screening Hsp104 variant libraries for toxicity suppressors. This protocol could be adapted to screen any protein library for toxicity suppressors of any protein that is toxic in yeast.

Isolating Potentiated Hsp104 Variants Using Yeast Proteinopathy Models

Here we present a cost-effective method for defining chemical-genetic interactions in budding yeast. The approach is built on fundamental techniques in yeast molecular biology and is well suited for the mechanistic interrogation of small to medium collections of chemicals and other media environments.

Rapid Identification of Chemical Genetic Interactions in Saccharomyces cerevisiae

Bacterial effector proteins are important for establishing successful infections. This protocol describes the experimental identification of proteinaceous binding partners of a bacterial effector protein in its natural plant host. Identifying these effector interactions via yeast two-hybrid screens has become an important tool in unravelling molecular pathogenicity strategies.

Unravelling the Function of a Bacterial Effector from a Non-cultivable Plant Pathogen Using a Yeast Two-hybrid Screen

This article presents a mating-based method to facilitate overexpression screening in budding yeast using an arrayed plasmid library.

Mating-based Overexpression Library Screening in Yeast

We present a simple suppressor screen protocol in fission yeast. This method is efficient, mutagen-free, and  selective  for  mutations that  often  occur at   a  single  genomic  locus.  The protocol is suitable for isolating suppressors that alleviate growth defects in liquid culture that are caused by a mutation or a drug.

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

This work describes a protocol for a multicopy suppressor genetic screen in Schizosaccharomyces pombe. This screen uses a genome-wide plasmid library to identify suppressor clone(s) of a loss-of-function phenotype associated with a query mutant strain. Novel genetic suppressors of the ell1 null mutant were identified using this screen.

Genetic Screen for Identification of Multicopy Suppressors in Schizosaccharomyces pombe

Fission yeast is used here as a heterologous host to express bacterial cytoskeletal proteins such as FtsZ and MreB as translational fusion proteins with GFP to visualize their polymerization. Also, compounds that affect polymerization are identified by imaging using a fluorescence microscope.

Fission Yeast as a Platform for Antibacterial Drug Screens Targeting Bacterial Cytoskeleton Proteins

Learn yeast toxicity and suppressor screens to identify host pathways targeted by bacterial effector proteins. This method reveals molecular mechanisms of pathogenesis in intracellular pathogens like Chlamydia trachomatis.

Identification of Host Pathways Targeted by Bacterial Effector Proteins using Yeast Toxicity and Suppressor Screens

Explore More Videos