Name: Mycobacterial DNA Extraction using Bead Beating in Custom Buffer Followed by NGS Workflow (Video) | JoVE Journal
Uploaded: 2025-06-13T14:20:00.000+00:00
Duration: 9 min 18 s
Description: Learn bead-beating DNA extraction from Mycobacterium tuberculosis for next-generation sequencing workflows. This rapid method enables reliable TB diagnostics and drug resistance detection in resource-limited settings.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

R01AI153213 National Institute of Allergy and Infectious Diseases (NIAID).

This study was conducted at the University of California San Francisco (UCSF) under Institutional Biosafety Committee approval (BUA #BU198320-01GBUA/BABB) and follows UCSF research ethics guidelines. We obtained remnant sputum samples collected by Discovery Life Sciences under an IRB-approved Waiver of Consent protocol from individuals with non-TB respiratory conditions.
1. Preparation of buffers
<ol>
	<li>Custom Triton buffer (Table 1): To prepare 100 mL of custom Triton buffer, start by combining 2 mL of 5 M NaCl, 1 mL of 1 M Tris-HCl (pH 8), 1 mL of Triton X-100, and 0.2 mL of 0.5 M ethylenediaminetetraacetic acid (EDTA). Add ultrapure water to bring the total volume to 100 mL. Filter sterilize before use. The final buffer contains 100 mM NaCl, 10 mM Tris-HCl, 1 mM EDTA, and 1% Triton X-100.</li>
	<li>Low EDTA TE (Table 2): To prepare 100 mL of Low EDTA TE Buffer, combine 1 mL of 1M Tris-HCl (pH 8) and 0.02 mL of 0.5 M EDTA. Add ultrapure water to bring the total volume to 100 mL. The final buffer contains 10 mM Tris-HCl and 0.1 mM EDTA.</li>
</ol>
2. Preparation of lysis tubes
<ol>
	<li>Using a scalpel blade carefully cut the bottom off a 1.5 mL screw cap tube just below the inflection point.</li>
	<li>Cut the tip off a P1000 tip, cut a V shaped wedge near the end, and wedge the prepared bottom of the screw cap tube in it. Refer to Figure 1 for a diagram of the scoop.</li>
	<li>Fill a sterile container (e.g., a reservoir or Petri dish) with 0.1 mm Zirconia-Silicate Beads and use the prepared scoop to distribute one scoopful of beads (~200 mg) into 1.5 mL screw cap tubes.</li>
</ol>
<img alt="Petri dish experiment setup with a pipette and P1000 tip for laboratory liquid handling." class="xfigimg" src="/files/ftp_upload/68037/68037fig1.jpg" data-altupdatedat="1762509930000" data-alt="Figure 1"> 
Figure 1: In-house bead distribution scoop. The scoop was designed for the easy transfer of ~200 mg of 0.1 mm zirconium beads into processing tubes. <a href="https://www.jove.com/files/ftp_upload/68037/68037fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
3. Preparation of input
NOTE: All sample preparation should be conducted according to your facility's biosafety protocols. We strongly recommend handling infectious materials inside a Class II Biosafety Cabinet (BSC) to minimize the risk of aerosol exposure.
<ol>
	<li>Bacterial cell culture
	<ol>
		<li>Centrifuge ~ 5 mL of M. tuberculosis culture (either MGIT or turbid liquid culture) in a 15 mL conical centrifuge tube at max speed (≥ 3,000 x g) for 10 min.</li>
		<li>Using a 10 mL serological pipette, carefully remove all but ~ 500 µL of the supernatant without disturbing the pellet. Remove the remaining supernatant with a P1000 pipette without disturbing the pellet.</li>
		<li>Resuspend the pellet in 350 µL of custom Triton buffer by pipetting up and down. If required (i.e., to remove samples for processing outside a BSL-3), inactivate the sample according to the standard operating procedures.</li>
	</ol>
	</li>
	<li>Sputum preparation
	<ol>
		<li>Transfer 1-5 mL of sputum sample (spontaneous or induced) into a sterile 50 mL centrifuge tube.</li>
	</ol>
	</li>
	<li>DTT liquefaction
	<ol>
		<li>Add four volumes of 100 mM dithiothreitol to the sputum sample (volume may vary). If using a commercial reagent, follow the manufacturer's dilution instructions.</li>
		<li>Vortex thoroughly for 30 s. Incubate at room temperature (20-25 °C) for 7 min. Vortex again for 30 s.</li>
		<li>Repeat steps 3.3.1. and 3.3.2. 1x, for very viscous samples, perform up to 5 incubation-vortex cycles.</li>
		<li>Centrifuge at maximum speed (≥ 3,000 x g) for 10 min. Using a 10 mL serological pipette, carefully discard all but ~ 500 µL of the supernatant. Remove the remaining supernatant with a P1000 pipette without disturbing the pellet.</li>
		<li>Resuspend the pellet in 350 µL of custom Triton buffer.</li>
	</ol>
	</li>
	<li>NALC-NaOH liquefaction
	<ol>
		<li>To prepare the NALC-NaOH solution, follow the manufacturer's instructions for preparation and dilution.</li>
		<li>Add four volumes of NALC-NaOH solution to the sputum sample (spontaneous or induced, volume may vary).</li>
		<li>Vortex for 30 s. Incubate at room temperature (20-25 °C) for 7 min. Repeat steps 3.4.1 and 3.4.2. 1x. For very viscous samples, perform up to 5 incubation-vortex cycles.</li>
		<li>Add PBS to the 50 mL mark. Vortex briefly to mix. Centrifuge at maximum speed (≥ 3,000 x g) for 10 min.</li>
		<li>Using a 50 mL serological pipette, carefully discard all but ~ 500 µL of the supernatant. Remove the remaining supernatant with a P1000 pipette without disturbing the pellet.</li>
		<li>Resuspend the pellet in 350 µL of custom Triton buffer. If required (i.e., to remove samples for processing outside a BSL-3), inactivate the sample according to the standard operating procedures.</li>
	</ol>
	</li>
</ol>
4. Extraction of DNA
<ol>
	<li>Transfer the inactivated bacterial suspension (350 µL from step 3) to a new well-labeled 1.5 mL screw cap tube containing ~250 µL of 0.1 mm Zirconia-Silicate Beads.</li>
	<li>Bead beat the lysate at 6.5 m/s for 45 s with 2 min rest between runs. Repeat for a total of three bead-beating cycles.</li>
	<li>Centrifuge at max speed (≥ 12,000 x g) for 2 min and transfer 150 µL of the supernatant to a new well-labeled tube. Take care not to transfer beads or cell debris.</li>
	<li>Allow cleanup magnetic beads to equilibrate to room temperature for 30 min and vortex thoroughly to ensure complete resuspension before use.</li>
	<li>Add 180 µL (1.2x volume) of cleanup magnetic beads and mix by pipetting up and down 10x. Incubate at room temperature for 2 min.</li>
	<li>Place on a magnetic rack and wait for the solution to clear for ~ 2 min. Using a P200 pipette, carefully discard the supernatant without disturbing the magnetic beads.</li>
	<li>With the tube still on the magnetic rack, add 500 µL of freshly prepared 70 % (v/v) ethanol, dispensing along the opposite tube wall to the magnetic beads. Wait for 30 s.</li>
	<li>Repeat steps 4.5. - 4.7. for a total of two washes. At the end of the last wash, remove residual ethanol with a P10 pipette. Dry the beads briefly for ~ 2 min.</li>
	<li>Immediately after the bead pellet becomes opaque, remove the tube from the magnetic rack and resuspend in 20 µL of Low EDTA Tris Buffer. Do not allow the beads to become dry and cracked.</li>
	<li>Mix by pipetting or vortexing to ensure all the beads are in solution. Incubate at room temperature for 5 min.</li>
	<li>Place on a magnetic rack and wait for the solution to become clear for ~ 2 min. Transfer the eluted DNA to a new well-labeled tube for downstream analysis. Aspirate &lt;20 µL of extracted DNA to avoid magnetic bead carry-over.</li>
</ol>
5. qPCR enumeration of mycobacterial DNA
<ol>
	<li>To quantify mycobacterial DNA using a quantitative PCR targeting 99 nucleotides of the mycobacterial atpE (Rv1305), assemble a 10 µL reaction mixture per sample on ice containing 5 µL of universal probe master mix (2x), 0.4 µL each of forward primer (5'-AATTCCTGGTGTAGCGGTGG-3', 10 µM), and reverse primer (5'-GTTTACGGCGTGGACTACCA-3', 10 µM), 0.2 µL of TaqMan probe (5'-VIC-AGGAGGAACACCGGTGGCGA-MGB-3', 10 µM), 2 µL of DNA template, and 2 µL of nuclease-free water (Table 3).</li>
	<li>Run the reaction using the following thermal cycling conditions: initial denaturation at 95 °C for 60 s, followed by 35 cycles of 95 °C for 10 s and 60 °C for 30 s (with a capture here, using a ramp rate of 2.11 °C/s; Table 4). 
	NOTE: In this case, qPCR was performed using a TaqMan assay with VIC-labeled probe on a QuantStudio 3 Real-Time PCR System,</li>
	<li>Run all samples, standards, and controls in technical triplicates. Generate standard curves using serial dilutions of purified M. tuberculosis DNA. Perform relative quantification analysis using analysis Software.</li>
	<li>Export the resulting relative quantification values to CSV format and visualize using R Studio (version 2024.09.1+394) to generate box plots comparing DNA yields across extraction methods.</li>
</ol>

<ol><li>Jouet, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Deep+amplicon+sequencing+for+culture-free+prediction+of+susceptibility+or+resistance+to+13+anti-tuberculous+drugs%5BTitle%5D)+AND+%22Eur+Respir+J%22%5BJournal%5D)">Deep amplicon sequencing for culture-free prediction of susceptibility or resistance to 13 anti-tuberculous drugs.</a> Eur Respir J. 57 (3), 2002338(2021).</li>
<li>George, S., et al. DNA Thermo-Protection Facilitates Whole Genome Sequencing of Mycobacteria Direct from Clinical Samples by the Nanopore Platform. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aGeorge%2C+S+%22bioRxiv%22">bioRxiv</a>. , (2020).</li>
<li>Doyle, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Direct+whole-genome+sequencing+of+sputum+accurately+identifies+drug-resistant+mycobacterium+tuberculosis+faster+than+MGIT+culture+sequencing%5BTitle%5D)+AND+%22J+Clin+Microbiol%22%5BJournal%5D)">Direct whole-genome sequencing of sputum accurately identifies drug-resistant mycobacterium tuberculosis faster than MGIT culture sequencing.</a> J Clin Microbiol. 56 (8), e00666-e00718 (2018).</li>
<li>Noordhoek, G. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sensitivity+and+Specificity+of+PCR+for+Detection+of+Mycobacterium+Tuberculosis%3A+A+Blind+Comparison+Study+among+Seven+Laboratories%5BTitle%5D)+AND+%22J+Clin+Microbiol%22%5BJournal%5D)">Sensitivity and Specificity of PCR for Detection of Mycobacterium Tuberculosis: A Blind Comparison Study among Seven Laboratories.</a> J Clin Microbiol. 32, (1994).</li>
<li>Jaber, M., Rattan, A., Verma, A., Tyagi, J., Kumar, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+simple+method+of+DNA+extraction+from+Mycobacterium+tuberculosis%5BTitle%5D)+AND+%22Tubercle+Lung+Dis%22%5BJournal%5D)">A simple method of DNA extraction from Mycobacterium tuberculosis.</a> Tubercle Lung Dis. 76 (6), 578-581 (1995).</li>
<li>Käser, M., Ruf, M. T., Hauser, J., Marsollier, L., Pluschke, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Optimized+method+for+preparation+of+DNA+from+pathogenic+and+environmental+mycobacteria%5BTitle%5D)+AND+%22Appl+Environ+Microbiol%22%5BJournal%5D)">Optimized method for preparation of DNA from pathogenic and environmental mycobacteria.</a> Appl Environ Microbiol. 75 (2), 414-418 (2009).</li>
<li>De Almeida, I. N., Da Silva Carvalho, W., Rossetti, M. L., Costa, E. R. D., De Miranda, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evaluation+of+Six+Different+DNA+Extraction+Methods+for+Detection+of+Mycobacterium+Tuberculosis+by+Means+of+PCR-IS6110%3A+Preliminary+Study%5BTitle%5D)+AND+%22BMC+Res+Notes%22%5BJournal%5D)">Evaluation of Six Different DNA Extraction Methods for Detection of Mycobacterium Tuberculosis by Means of PCR-IS6110: Preliminary Study.</a> BMC Res Notes. 6, 561(2013).</li>
<li>Pan, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Comparison+of+four+DNA+extraction+methods+for+detecting+Mycobacterium+tuberculosis+by+real-time+PCR+and+its+clinical+application+in+pulmonary+tuberculosis%5BTitle%5D)+AND+%22J+Thorac+Dis%22%5BJournal%5D)">Comparison of four DNA extraction methods for detecting Mycobacterium tuberculosis by real-time PCR and its clinical application in pulmonary tuberculosis.</a> J Thorac Dis. 5 (3), 251-257 (2013).</li>
<li>Kelly-Cirino, C., Niles, J., Ray, B., Stewart, A. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aKelly-Cirino%2C+C+%22Maximizing+Mycobacterium+Tuberculosis+DNA+Yield+for+Molecular+Methods+with+PrepIT.MAX%22">Maximizing Mycobacterium Tuberculosis DNA Yield for Molecular Methods with PrepIT.MAX</a>. PD-WP-00045 (Issue 2/2015-11), Accessed January 27 (2020).</li>
<li>Votintseva, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Same-day+diagnostic+and+surveillance+data+for+tuberculosis+via+whole-genome+sequencing+of+direct+respiratory+samples%5BTitle%5D)+AND+%22J+Clin+Microbiol%22%5BJournal%5D)">Same-day diagnostic and surveillance data for tuberculosis via whole-genome sequencing of direct respiratory samples.</a> J Clin Microbiol. 55 (5), 1285-1298 (2017).</li>
<li>Odumeru, J., Gao, A., Chen, S., Raymond, M., Mutharia, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Use+of+the+Bead+Beater+for+Preparation+of+Mycobacterium+Paratuberculosis+Template+DNA+in+Milk%5BTitle%5D)+AND+%22Can+J+Vet+Res%22%5BJournal%5D)">Use of the Bead Beater for Preparation of Mycobacterium Paratuberculosis Template DNA in Milk.</a> Can J Vet Res. 65 (4), 201-205 (2001).</li>
<li>Oh, T. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+Effective+Method+of+RNA+Extraction+from+Mycobacterium+tuberculosis%5BTitle%5D)+AND+%22Ann+Clin+Microbiol%22%5BJournal%5D)">An Effective Method of RNA Extraction from Mycobacterium tuberculosis.</a> Ann Clin Microbiol. 19 (1), 20-23 (2016).</li>
<li>Miyata, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Assessment+of+the+quality+of+dna+extracted+by+two+techniques+from+mycobacterium+tuberculosis+for+fast+molecular+identification+and+genotyping%5BTitle%5D)+AND+%22Braz+J+Microbiol%22%5BJournal%5D)">Assessment of the quality of dna extracted by two techniques from mycobacterium tuberculosis for fast molecular identification and genotyping.</a> Braz J Microbiol. 42 (2), 774-777 (2011).</li>
<li>Votintseva, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mycobacterial+DNA+extraction+for+whole-genome+sequencing+from+early+positive+liquid+%28MGIT%29+cultures%5BTitle%5D)+AND+%22J+Clin+Microbiol%22%5BJournal%5D)">Mycobacterial DNA extraction for whole-genome sequencing from early positive liquid (MGIT) cultures.</a> J Clin Microbiol. 53 (4), 1137-1143 (2015).</li>
<li>Kolia-Diafouka, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Optimized+Lysis-Extraction+Method+Combined+With+IS6110-Amplification+for+Detection+of+Mycobacterium+tuberculosis+in+Paucibacillary+Sputum+Specimens%5BTitle%5D)+AND+%22Front+Microbiol%22%5BJournal%5D)">Optimized Lysis-Extraction Method Combined With IS6110-Amplification for Detection of Mycobacterium tuberculosis in Paucibacillary Sputum Specimens.</a> Front Microbiol. 9, 2224(2018).</li>
<li>Bonnet, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+Comprehensive+Evaluation+of+GeneLEAD+VIII+DNA+Platform+Combined+to+Deeplex+Myc-TB+Assay+to+Detect+in+8+Days+Drug+Resistance+to+13+Antituberculous+Drugs+and+Transmission+of+Mycobacterium+tuberculosis+Complex+Directly+From+Clinical+Samples%5BTitle%5D)+AND+%22Front+Cell+Infect+Microbiol%22%5BJournal%5D)">A Comprehensive Evaluation of GeneLEAD VIII DNA Platform Combined to Deeplex Myc-TB Assay to Detect in 8 Days Drug Resistance to 13 Antituberculous Drugs and Transmission of Mycobacterium tuberculosis Complex Directly From Clinical Samples.</a> Front Cell Infect Microbiol. 11, 707244(2021).</li>
<li>Mann, B. C., et al. Systematic review and meta-analysis of protocols and yield of direct from sputum sequencing of Mycobacterium tuberculosis. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aMann%2C+BC+%22bioRxiv%22">bioRxiv</a>. , (2024).</li>
<li>Schwab, T. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Field+evaluation+of+nanopore+targeted+next-generation+sequencing+to+predict+drug-resistant+tuberculosis+from+native+sputum+in+South+Africa+and+Zambia%5BTitle%5D)+AND+%22J+Clin+Microbiol%22%5BJournal%5D)">Field evaluation of nanopore targeted next-generation sequencing to predict drug-resistant tuberculosis from native sputum in South Africa and Zambia.</a> J Clin Microbiol. 63 (3), e0139024(2025).</li>
<li>Colman, R. E., Seifert, M., De la Rossa, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evaluating+culture-free+targeted+next-generation+sequencing+for+diagnosing+drug-resistant+tuberculosis%3A+a+multicentre+clinical+study+of+two+end-to-end+commercial+workflows%5BTitle%5D)+AND+%22Lancet+Infect+Dis%22%5BJournal%5D)">Evaluating culture-free targeted next-generation sequencing for diagnosing drug-resistant tuberculosis: a multicentre clinical study of two end-to-end commercial workflows.</a> Lancet Infect Dis. 25 (3), 325-334 (2025).</li>
<li>Oberacker, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Bio-On-Magnetic-Beads+%28BOMB%29%3A+Open+platform+for+high-throughput+nucleic+acid+extraction+and+manipulation%5BTitle%5D)+AND+%22PLoS+Biol%22%5BJournal%5D)">Bio-On-Magnetic-Beads (BOMB): Open platform for high-throughput nucleic acid extraction and manipulation.</a> PLoS Biol. 17 (1), e3000107(2019).</li>
<li>Limberis, J. D., Metcalfe, J. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Turbolysis%3A+A+low-cost%2C+small+footprint+alternative+to+commercial+bead+beaters+for+cell+lysis%5BTitle%5D)+AND+%22HardwareX%22%5BJournal%5D)">Turbolysis: A low-cost, small footprint alternative to commercial bead beaters for cell lysis.</a> HardwareX. 19, e00576(2024).</li>
</ol>

The authors have nothing to disclose.

In this work, we present a robust, validated protocol for extracting high-quality M. tuberculosis DNA using bead-beating with magnetic bead cleanup for downstream molecular and NGS applications.
The method offers several advantages over existing M. tuberculosis DNA extraction protocols. While traditional phenol-chloroform extraction typically takes several days and introduces hazardous chemicals, this method is completed in under 60 min with minimal hazardous waste. This appr...

Extracting high-quality DNA from M. tuberculosis is necessary for the detection of drug-resistant tuberculosis (TB) using targeted next-generation sequencing (NGS) and whole genome sequencing (WGS) but is often overlooked. We developed a standardized protocol to provide consistent, high-quality DNA for clinical NGS applications, including targeted NGS approaches like Deeplex-MycTB (GenoScreen) and whole genome sequencing, which are now recommended by the World Health Organization (WHO) for the diagnosis of drug-resistant tuberculosis. Notably, while the WHO recommends these NGS-based diagnostic strategies, it does not specify the particular DNA extraction protocols to support them. Our method can be used with WHO-endorsed tests as well as with emerging technologies that require high-quality mycobacterial DNA.
The extraction challenge stems from M. tuberculosis&#39;s unique cell wall, comprised of mycolic acids and lipids that make it exceptionally difficult to break open. Current published extraction solutions have substantial variation in lysis (e.g., sonication, chemical, heat, and bead-beating) and DNA extraction methods (e.g., phenol-chloroform extraction, ethanol precipitation, CTAB-based and column and bead-based methods), which results in differences in DNA yield, purity, and quality1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16. In addition, research groups rarely use the same DNA extraction method and often measure success differently. This makes determining which method works best difficult since the optimal approach depends on the type of molecular application. For example, resolving M. tuberculosis structural variants in sputum using long-read sequencing requires higher-quality DNA and more accurate polymerase than running a paid diagnostic tool that only targets a small region of rpoB. Several factors further complicate DNA extraction success. The amount of DNA we can extract varies based on the sample type, how many bacteria are present, and whether there are substances (co-extracted non-mycobacterial DNA and PCR inhibitors) that interfere with the process. Even technical aspects like how precisely a lab technician pipettes can affect the results. Current methods often fall short when processing samples with low bacterial loads or high levels of contaminating DNA, which are commonly encountered in clinical settings17,18,19.
Bead beating in custom buffer, followed by a bead clean-up protocol, offers key advantages over other methods. It is a simple and rapid workflow that reduces the opportunity for operator-dependent variation and maintains DNA integrity for downstream NGS applications. This standardized approach particularly suits clinical laboratories seeking reliable, reproducible results using WHO-recommended NGS drug resistance assays and all WGS applications.

<table><tbody><tr><td>0.1 mm Zirconia-Silicate Beads</td><td>Biospec Products</td><td>11079101z</td><td>Beads used for bead-beating step to lyse mycobacterial cells</td></tr><tr><td>AMPure XP Beads</td><td>Beckman Coulter</td><td>A63880</td><td>Magnetic beads for DNA cleanup post-lysis</td></tr><tr><td>EDTA (0.5M, pH 8.0)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>AM9260G</td><td>Custom Triton/ Low EDTA Buffer Components</td></tr><tr><td>Fastprep 24</td><td>MPbio, USA</td><td>116004500</td><td>Equipment for bead beating at 6.5 m/s</td></tr><tr><td>Forward Primer</td><td>Thermo Fisher Scientific</td><td>Custom synthesis</td><td>Primer sequence: AATTCCTGGTGTAGCGGTGG</td></tr><tr><td>H&lt;sub&gt;2&lt;/sub&gt;O (Water, molecular biology grade)</td><td>Thermo Fisher Scientific</td><td>BP2819-1</td><td>Custom Triton/ Low EDTA Buffer Components</td></tr><tr><td>Luna Universal Probe</td><td>New England Biolabs</td><td>M3004</td><td>qPCR reagent for Mycobacterial DNA enumeration</td></tr><tr><td>MycoPrep Kit</td><td>BD</td><td>SKU/REF 240863</td><td>BD MycoPrep Specimen Digestion for NALC-NaOH Sputum Processing</td></tr><tr><td>NaCl (Sodium Chloride, 5M solution)</td><td>Thermo Fisher Scientific</td><td>AM9759</td><td>Custom Triton/ Low EDTA Buffer Components</td></tr><tr><td>PBS</td><td>Millipore Sigma</td><td>P2272</td><td>Sputum Processing</td></tr><tr><td>Reverse Primer</td><td>Thermo Fisher Scientific</td><td>Custom synthesis</td><td>Primer sequence: GTTTACGGCGTGGACTACCA</td></tr><tr><td>TaqMan Probe</td><td>Thermo Fisher Scientific</td><td>Custom synthesis</td><td>Probe sequence: AGGAGGAACACCGGTGGCGA</td></tr><tr><td>Tris-HCl (1M, pH 8.0)</td><td>Thermo Fisher Scientific</td><td>AM9855G</td><td>Custom Triton/ Low EDTA Buffer Components</td></tr><tr><td>Triton X-100</td><td>Thermo Fisher Scientific</td><td>28314</td><td>Custom Triton/ Low EDTA Buffer Components</td></tr></tbody></table>

mycobacterial dna extraction using bead beating in custom buffer followed by ngs workflow

Mycobacterial DNA Extraction using Bead Beating in Custom Buffer Followed by NGS Workflow

Tuberculosis is a deadly disease, and the emergence of antibiotic drug resistance in the causative agent bacterium, Mycobacterium tuberculosis, worsens treatment outcomes. Precise and rapid drug resistance identification through sequencing technologies is needed to improve tuberculosis patient outcomes through tailored therapeutic regimens. The DNA extraction method is critical for downstream molecular assays and is complicated by the tough cell wall of Mycobacterium, the low bacillary load of many clinical samples, and the complexity of the sputum matrix. There are numerous M. tuberculosis DNA extraction methods reported, but there is currently no gold standard. Furthermore, few of these methods are shown to work consistently, and many are not suitable for low-resource and high-burden tuberculosis settings. Consequently, laboratories frequently introduce their own procedure modifications, resulting in significant method variability. Here, we present a cost-effective, rapid, and standardized protocol for Mycobacterial DNA extraction from both clinical sputum and culture that produces DNA suitable for qPCR, and which should be considered for use in clinical diagnostics laboratories.

We tested the DNA extraction protocol on both cultured M. tuberculosis and M. tuberculosis spiked sputum samples (n = 3 for each condition). Using cultured M. tuberculosis H37Rv mc² 7901, we standardized the input to 8.4 x 106 cells per 50 µL, equivalent to 1 mL of a MGIT culture at 200 GU. For sputum experiments, we spiked 1 mL of sputum pooled from individuals with non-TB respiratory conditions (obtained commercially) with two different bacterial concentrations (50,000, roughly a 1...

This protocol shows bead-beating combined with DNA capture bead purification provides a fast and consistent method for extracting DNA from Mycobacterium tuberculosis samples, making it an effective choice for next-generation sequencing applications.

Tuberculosis is a deadly disease, and the emergence of antibiotic drug resistance in the causative agent bacterium, Mycobacterium tuberculosis, worsens ...

Our diagnostics research focuses on improving the detection of drug resistance in tuberculosis in limited resource settings, with a focus on speed and pragmatism. In TB diagnostics, there are more comprehensive genotypic assays, and even a number of new rapid phenotypic assays, and there are consistent pushes to get these tests closer to the point of care. But there are a number of pragmatic barriers that still exist.Resource challenges from reagents to infrastructure to logistics continue to be significant barriers. With anything beyond the technical sophistication of a Cepheid Xpert assay, protocol standardization is difficult in different settings. So, MTB DNA extraction as detailed in this work here, is a prime example of that.There is a critical need to expand sequencing-based TB diagnostics, but many labs still lack a reliable way to extract high quality DNA. Our goal is to share a method that's simple, practical, and suitable for low-resource point-of-care setting. Here we present a simple low cost protocol designed for use in resource-limited settings.It has been validated for NGS applications, and is compatible with automated liquid handling systems. To begin, combine sodium chloride solution Tris hydrochloride buffer, Triton X 100, and EDTA to make the Triton buffer. Mix by stirring and add ultrapure water to reach a final volume of 100 milliliters.Filter sterilize the buffer before use. Next, prepare 100 milliliters of low-EDTA Tris-EDTA buffer by combining one milliliter of one-molar Tris-HCl and 20 microliters of 0.5-molar EDTA. Mix and fill with ultrapure water to reach a final volume of 100 milliliters.Then filter sterilize the buffer. To prepare the lysis tubes, use a scalpel blade to carefully cut the bottom off a 1.5-milliliter screw-cap tube just below the inflection point. Cut the tip off a P1000 pipette tip and make a V-shaped wedge near the end.Wedge the cut bottom of the screw-cap tube into the V-shaped pipette tip to form a scoop. Fill a sterile container with 0.1-millimeter zirconia silicate beads. Using the prepared scoop, transfer approximately 200 milligrams of beads into 1.5-milliliter screw-cap tubes.For the preparation of the bacterial cell culture, transfer five milliliters of mycobacterium tuberculosis culture into a 15-milliliter conical centrifuge tube. Centrifuge it at maximum speed for 10 minutes. Now use a 10-milliliter serological pipette to carefully remove all but approximately 500 microliters of the supernatant without disturbing the pellet.Use a P1000 pipette to remove the remaining supernatant. Resuspend the pellet in 350 microliters of custom triton buffer, then mix well by pipetting up and down. Heat the sample in a dry heat bath for 30 minutes at 95 degrees Celsius.To prepare the sputum transfer one to five milliliters of sputum sample into a sterile 50-milliliter centrifuge tube. To perform Dithiothreitol liquefaction, add four volumes of 10-millimolar Dithiothreitol to the sputum sample, then vortex thoroughly for 30 seconds. Centrifuge the sample at maximum speed for 10 minutes.Then use a 10-milliliter serological pipette to discard all but 500 microliters of the supernatant. Remove the rest of the supernatant with a P1000 pipette without disturbing the pellet. Resuspend the pellet in 350 microliters of custom triton buffer.To perform the NALC sodium hydroxide liquefaction, add four volumes of the NALC sodium hydroxide solution to the sputum sample. Vortex the mixture for 30 seconds. Then incubate the tube for seven minutes at room temperature.Now add PBS up to the 50 milliliter mark. Vortex the contents of the tube to mix well, then centrifuge the tube at maximum speed for 10 minutes. After centrifugation, with a 50-milliliter serological pipette, discard the supernatant as demonstrated earlier.Then resuspend the pellet in 350 microliters of custom triton buffer. First, transfer 350 microliters of inactivated sample into a labeled 1.5-milliliter screw-cap tube containing 250 microliters of 0.1-millimeters zirconia silicate beads. Bead beat the lysate at 6.5 meters per second for 45 seconds with two minutes'rest between cycles.Centrifuge the sample at maximum speed for two minutes, then transfer 150 microliters of the supernatant to a new labeled tube. Next vortex cleanup magnetic beads that have been equated at room temperature for 30 minutes, to resuspend them. Transfer 180 microliters of magnetic beads to the DNA sample.Pipet up and down 10 times to mix. After a two minute incubation at room temperature, place the tube on a magnetic rack and wait two minutes for the solution to clear. Then use a 200-microliter pipette to discard the supernatant.With the tube still on the magnetic rack, add 500 microliters of freshly prepared 70%ethanol along the opposite wall, and wait for 30 seconds. At the end of the last wash, remove residual ethanol with a 10-microliter pipette and air dry for two minutes. As soon as beads turn opaque, remove the tube from the magnetic rack.Resuspend in 20 microliters of low EDTA Tris buffer. Mix by pipetting or vortexing to ensure all the beads are in solution before a five-minute incubation at room temperature. Next, place the tube on a magnetic rack for two minutes until clear.Then transfer less than 20 microliters of the eluated DNA to a new labeled tube to avoid bead carryover. To quantify mycobacterial DNA using a quantitative PCR targeting 99 nucleotides of the mycobacterial atpE, assemble a QPCR master mix on ice. Adjust master mix based on the amount of samples and standards, including a 10%overage to account for pipetting loss.Run the thermal cycler with 95 degrees Celsius for 60 seconds, followed by 35 cycles of 95 degrees Celsius for 10 seconds, and 60 degrees Celsius for 30 seconds with ramp rate of 2.11 degrees Celsius per second. Run all samples, standards and controls in triplicate. Here, mycobacterium tuberculosis cultures yielded the highest DNA concentrations among all tested conditions.Spiked sputum samples showed progressively lower DNA yields, and increased variation with decreasing bacterial input, especially in the 10, 000 bacteria group.

mycobacterial-dna-extraction-using-bead-beating-custom-buffer

Research

JoVE Journal

Immunology and Infection

The comparison and optimization of two plant organellar DNA enrichment methods are presented: traditional differential centrifugation and fractionation of the total gDNA based on methylation status. We assess the resulting DNA quantity and quality, demonstrate performance in short-read next-generation sequencing, and discuss the potential for use in long-read single-molecule sequencing.

Optimization and Comparative Analysis of Plant Organellar DNA Enrichment Methods Suitable for Next-generation Sequencing

Nanopore technology for sequencing biomolecules has wide applications in the life sciences, including identification of pathogens, food safety monitoring, genomic analysis, metagenomic environmental monitoring, and characterization of bacterial antibiotic resistance. In this article, the procedure for metagenomic soil DNA sequencing for species identification using the nanopore sequencing technology is demonstrated.

Nanopore DNA Sequencing for Metagenomic Soil Analysis

Here, we describe a protocol to obtain amplicon sequence data of soil, rhizosphere, and root endosphere microbiomes. This information can be used to investigate the composition and diversity of plant-associated microbial communities, and is suitable for the use with a wide range of plant species.

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

Long-read sequences greatly facilitate the assembly of complex genomes and characterization of structural variation. We describe a method to generate ultra-long sequences by nanopore-based sequencing platforms. The approach adopts an optimized DNA extraction followed by modified library preparations to generate hundreds of kilobase reads with moderate coverage from human cells.

Ultra-long Read Sequencing for Whole Genomic DNA Analysis

Described here is a simplified standard operating procedure for microbiome profiling using 16S rRNA metagenomic sequencing and analysis using freely available tools. This protocol will help researchers who are new to the microbiome field as well as those requiring updates on methods to achieve bacterial profiling at a higher resolution.

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

Described here is a DNA extraction protocol using magnetic beads to produce high quality DNA extractions from mosquitoes. These extractions are suitable for a downstream next-generation sequencing approach.

A Magnetic-Bead-Based Mosquito DNA Extraction Protocol for Next-Generation Sequencing

Gene expression is regulated by interactions of gene promoters with distal regulatory elements. Here, we descirbe how low input Capture Hi-C (liCHi-C) allows the identification of these interactions in rare cell types, which were previously unmeasurable.

An Integrated Workflow to Study the Promoter-Centric Spatio-Temporal Genome Architecture in Scarce Cell Populations

We present an optimized method for DNA extraction from decontaminated sputum using a matrix-based extraction method combined with a magnetic bead purification for downstream targeted next-generation sequencing of Mycobacterium tuberculosis.

Matrix-based DNA Extraction for Targeted Next-Generation Sequencing on Decontaminated Sputum Samples

This protocol describes the CTAB method for extracting high-quality DNA from mycobacteria, overcoming challenges posed by their tough, mycolic acid-rich cell walls. The process involves enzymatic digestion, cell lysis with CTAB, and DNA purification through organic extraction and ethanol precipitation. This method produces DNA suitable for molecular studies and is reliable for mycobacterial research.

Whole-Genome Deoxyribonucleic Acid Extraction from Mycobacterium Species via the Cetyltrimethylammonium Bromide Technique

Here, we present a protocol to enable whole-genome sequencing of bacterial sexually transmitted infections from clinical samples using target enrichment. This novel, syndromic panel-based method overcomes challenges of abundant human DNA and low bacterial loads, facilitating genomic surveillance for Chlamydia trachomatis, Neisseria gonorrhoeae, Treponema pallidum, and Mycoplasma genitalium.

Generating Whole Bacterial Genomes from Clinical Samples using a Target Enrichment Workflow

The current study describes a workflow for nanopore sequencing of plasmids when the chromosomal sequence is already known or of no interest. An initial plasmid DNA enrichment step ensures optimal plasmid sequence depth and maximizes the number of samples that can be sequenced per flow cell.

Long-Read Plasmid Sequencing and Assembly Using Nanopore Sequencing-Based Workflows

Learn bead-beating DNA extraction from Mycobacterium tuberculosis for next-generation sequencing workflows. This rapid method enables reliable TB diagnostics and drug resistance detection in resource-limited settings.

Mycobacterial DNA Extraction using Bead Beating in Custom Buffer Followed by NGS Workflow

Explore More Videos