Name: Modeling Mitochondrial Disease Using Brain Organoids: A Focus on Mitochondrial Encephalomyopathy, Lactic Acidosis, and Stroke-like Episodes (Video) | JoVE Journal
Uploaded: 2025-10-10T14:03:00.000+00:00
Duration: 8 min 56 s
Description: Learn brain organoid modeling for MELAS mitochondrial disease using patient-derived iPSCs. This method enables high-throughput drug screening and reveals pathophysiological mechanisms through heteroplasmy analysis.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

The 414C2 iPSCs were obtained from RIKEN BRC. Funding support was provided by JSPS KAKENHI (24H00648 to M.F., 23K08971 to C.S.) and AMED Translational Research Network Program (25yf0126001j002 to M.F.). This work was supported by a fellowship of the German Academic Exchange Service (DAAD) to F.B.

The two iPSC lines (2-6 and 2-8) were derived from the same MELAS patient&#39;s fibroblasts using well-established methods8. They differ only in their heteroplasmy levels. The 414C2 iPSC line established from a healthy individual was used as a control. The protocol used in this study followed the guidelines of the Ethics Committee of Kitasato University School of Medicine (#G22-02).
1. Cell culture
<ol>
	<li>Thawing frozen cell stocks
	<ol>
		<li>Prepare 6-well plates by coating with laminin according to the manufacturer&#39;s instructions.</li>
		<li>Warm the culture medium for feeder-free iPSCs containing 10 &#181;M ROCK inhibitor to 37 &#176;C.</li>
		<li>Retrieve the frozen iPSC vial from the liquid nitrogen (LqN2) tank and rapidly thaw in a 37 &#176;C water bath.</li>
		<li>Transfer the thawed suspension into 10 mL of prewarmed medium. Centrifuge at 120 &#215; g for 5 min at room temperature (22 &#176;C).</li>
		<li>Carefully remove the supernatant and gently resuspend the pellet by tapping the tube. Add fresh medium and seed cells into 6-well plates precoated with laminin. Incubate at 37 &#176;C in a humidified incubator with 5% CO2.</li>
	</ol>
	</li>
	<li>Medium change
	<ol>
		<li>Replace the medium (without ROCK inhibitor) every 1-2 days.</li>
	</ol>
	</li>
</ol>
2. Generation of cerebral organoids
<ol>
	<li>Initiation of differentiation (Day 0)
	<ol>
		<li>Remove medium from iPSC (~70-80% confluent) culture plates. Wash cells with PBS.</li>
		<li>Add enzyme solution and incubate at 37 &#176;C for 5 min.</li>
		<li>Add medium to stop the reaction. Transfer cells into a 15 mL tube. Centrifuge at 190 &#215; g for 5 min at room temperature (22 &#176;C).</li>
		<li>Resuspend the pellet in 1 mL of differentiation medium containing 30 &#181;M ROCK inhibitor, 5 &#181;M SB431542, and 2.5 &#181;M IWP-2. 
		NOTE: The basic medium is the same as that used in step 1.1.2.</li>
		<li>Count the cells. Seed 3 &#215; 103&#160;cells in 100 &#181;L per well in U-shaped, 96-well, low-attachment plates. Incubate for 6 days at 37 &#176;C, 5% CO2.</li>
	</ol>
	</li>
	<li>Medium change (Day 6)
	<ol>
		<li>Transfer organoids (from step 2.1.5) from a 96-well plate to a 10 cm dish using a wide-bore pipette. Add 50 &#181;L of medium (DMEM/F12 with 1% N2, 1% glutamine substitute 1% NEAA, 2.5 &#181;M IWP-2, 5 &#181;g/mL heparan sulfate, and 1% PS) to each well of a new 96-well plate. 
		NOTE: Use wide-bore pipettes throughout the experiments when transferring organoids to avoid disrupting their 3D-structure. Additionally, 8-channel pipettes are helpful for performing experiments quickly and accurately.</li>
		<li>Collect organoids into 2 mL tubes. Carefully remove the medium so as not to aspirate the organoids and add 1.5 mL of DMEM/F12. Repeat 3x to wash the organoids.</li>
		<li>Remove medium and add 500 &#181;L of fresh medium to tubes with organoids. Transfer all organoids to a 10 cm dish, then add 5 mL of medium to make it easier to pick up each organoid.</li>
		<li>Pick up a single organoid using a micropipette adjusted to 50 &#181;L and transfer it to one well of 96-well plate.&#160;Repeat until all of the organoids are transferred to the 96-well plate (final volume 100 &#181;L). Incubate for 3 days at 37 &#176;C, 5% CO2.</li>
	</ol>
	</li>
	<li>Medium change (Day 9)
	<ol>
		<li>(Optional) Transfer organoids to a 10 cm dish when using 8-channel pipettes. Skip step 2.3.1 when using single-channel micropipettes and proceed to step 2.3.2.</li>
		<li>Collect organoids into 2 mL tubes. Wash 3x with DMEM/F12 as step 2.2.2.</li>
		<li>Resuspend in differentiation medium (1:1 DMEM/F12 and neurobasal) containing 1% N2, 2% B27 without vitamin A, 100 &#181;M 2-mercaptoethanol (ME), 2.5 &#181;g/mL insulin, 1% glutamine substitute, 0.5% NEAA, and 1% basement membrane extract. 
		NOTE: Prepare small aliquots of basement membrane extract for single use and store at -20&#8239;&#176;C until needed. Thaw the extract at 4&#8239;&#176;C without allowing it to exceed 8&#8239;&#176;C, then mix it into cold medium and warm the medium at room temperature for approximately 30&#8239;min.</li>
		<li>Transfer ~10 organoids per well into a 6-well plate. Adjust final volume of medium for 1 well to 2 mL. Culture statically for 6 days at 37 &#176;C, 5% CO2.</li>
	</ol>
	</li>
	<li>Medium change (Day 15)
	<ol>
		<li>Collect organoids into 15 mL tubes. Leave the tube undisturbed until all organoids have settled. Remove supernatant and add fresh differentiation medium (same as step 2.3.3 but with B27 + vitamin A). 
		NOTE: Usually, organoids settle at the bottom of the tube without centrifugation. However, small organoids derived from patient iPSCs may not sink efficiently. In that case, centrifuge the tubes at 120 &#215; g for 3 min at room temperature to collect the organoids.</li>
		<li>Transfer ~10 organoids per well into a 6-well plate. Culture statically for 15 days at 37 &#176;C, 5% CO2.</li>
		<li>Replace medium every 5-7 days until Day 30.</li>
	</ol>
	</li>
</ol>
3. Dissociation of cerebral organoids for 2D culture (Day 30)
<ol>
	<li>Coating plates with poly-L-ornithine (PO)
	<ol>
		<li>Prepare PO stock solution by dissolving 10 mg of PO in 66.7 mL of H2O and make small aliquots for single use. Store them at&#160;-20 &#176;C until use.</li>
		<li>Dilute the PO stock solution 1:5 with H2O and coat culture plates with the diluted solution. Incubate overnight at 37 &#176;C.</li>
	</ol>
	</li>
	<li>Laminin coating
	<ol>
		<li>Remove PO and wash wells 3 x 5 min with PBS.</li>
		<li>Add laminin (1:1,000 in PBS) and incubate at 37 &#176;C for 3 h or overnight. 
		NOTE: Stock solution of laminin is 1 mg/mL. Prepare small aliquots and store at -80&#8239;&#176;C until needed.</li>
	</ol>
	</li>
	<li>Dissociation into single neurons
	<ol>
		<li>Thaw the dissociation solution at 4 &#176;C for 1 h before use.</li>
		<li>Transfer&#160;organoids into a 15 mL tube and leave the tube undisturbed until all organoids have settled. Remove supernatant and add 5mL of PBS to rinse organoids.</li>
		<li>After&#160;removing PBS, add 1 mL of enzyme solution and pipette gently 1&#8211;2x. Incubate at 37 &#176;C for 5 min; pipette several times. If necessary, incubate for an additional 2&#8211;3 min. Pipette again to complete dissociation.</li>
		<li>Centrifuge at 200 &#215; g for 5 min. Remove supernatant, add 1 mL of dispersion solution, and pipette.</li>
		<li>Layer isolation solution beneath and centrifuge at 200 &#215; g for 5 min.</li>
		<li>Add 1 mL of neuronal medium (neurobasal with 1% B27, 0.25% glutamine substitute, 1% PS) and mix. Pass suspension through a 70 &#181;m strainer into a 50 mL tube.</li>
		<li>Count the cells. Seed cells at 1 &#215; 105 cells/cm2 on PO/laminin-coated plates. Replace medium every 4-7 days until Day 60.</li>
	</ol>
	</li>
</ol>
4. Harvesting cells and organoids for cellular and molecular analysis
<ol>
	<li>Organoid fixation for immunofluorescence (Day 30)
	<ol>
		<li>Harvest organoids (step 2.4.3) into microtubes.</li>
		<li>Remove medium carefully not to aspirate organoids, and add 1 mL of PBS to rinse organoids.</li>
		<li>Remove PBS carefully not to aspirate organoids, and add 4% paraformaldehyde (PFA) to fix for 30 min at room temperature.</li>
		<li>Wash 3x with PBS.</li>
		<li>Store at 4 &#176;C until use.</li>
	</ol>
	</li>
	<li>Organoid collection for RT-qPCR (Day 30)
	<ol>
		<li>Transfer organoids (step 2.4.3) into microtubes. Wash with PBS as described in step 4.1.2.</li>
		<li>Add lysis buffer and snap-freeze in liquid nitrogen (LqN2). Store at &#8722;80 &#176;C until use.</li>
	</ol>
	</li>
	<li>Cell fixation for immunofluorescence (Day 60)
	<ol>
		<li>Remove culture medium and add PBS to wash cells.</li>
		<li>Fix in 4% PFA for 15 min at room temperature.</li>
		<li>Remove PFA and add PBS to wash cells. Repeat this step 3x.</li>
		<li>Store at 4 &#176;C until use.</li>
	</ol>
	</li>
</ol>
5. RT-qPCR
<ol>
	<li>Extract total RNA from organoids according to the kit manufacturer&#39;s instructions.</li>
	<li>Synthesize cDNA from 1 &#181;g of total RNA prepared in Step 5.1 according to the kit manufacturer&#39;s instructions in a total reaction volume of 20 &#181;L.</li>
	<li>Perform quantitative PCR using the following primers: FOXG1_forward: CGCCAGATTTCCATGTGTGC; FOXG1_reverse: GTTCTCAAGGTCTGCGTCCA; ACTB_forward: TGAAGTGTGACGTGGACATC; ACTB_reverse: GGAGGAGCAATGATCTTGAT. Set up the final concentration for each reaction as follows: 1x fluorescent master mix, 0.25 &#181;M forward primer, 0.25 &#181;M reverse primer. Total reaction volume is 15 &#181;L, including 0.2 &#181;L of cDNA from Step 5.2. Use the following PCR conditions: initial denaturation at 95 &#176;C for 1 min; 40 cycles of 95 &#176;C for 15 s and 60 &#176;C for 30 s.</li>
	<li>Normalize FOXG1 expression to ACTB as the internal control.</li>
</ol>
6. Immunofluorescence staining
<ol>
	<li>Incubate organoids (Day 30) in 10% sucrose for 1 h at 4 &#176;C, then 30% sucrose for &#8805;3 h at 4 &#176;C.</li>
	<li>Mount organoids in embedding medium and prepare cryosection (10 &#181;m) using cryostat. Store sections on slide glasses at &#8722;20 &#176;C until use.</li>
	<li>Remove embedding medium by PBS wash (2 x 5 min).</li>
	<li>Permeabilize in 0.3% PBST for 10 min. Wash with PBS.</li>
	<li>Block in 10% normal goat serum in 0.1% PBST for 1 h. Incubate overnight at 4 &#176;C with primary antibodies: anti-FOXG1 (1:200), anti-TUBB3 (1:500-1:1,000). Wash 3x with PBS.</li>
	<li>Incubate with secondary antibody (1:500) + Hoechst 33258 (1:500) for 1 h. Wash 3x with PBS.</li>
	<li>Mount and observe under a confocal microscope.</li>
</ol>
7. Heteroplasmy analysis
<ol>
	<li>Harvest iPSCs using cell scrapers and transfer to microtubes. Add 0.5 mL of PBS and centrifuge at 100 &#215; g for 5 min. Remove supernatant and proceed to Step 7.2.</li>
	<li>Extract total DNA according to the kit manufacturer&#39;s instructions.</li>
	<li>Set up the final concentration for each PCR reaction: 1x fluorescent master mix, 0.25 &#181;M forward primer, 0.25 &#181;M reverse primer. Total reaction volume is 15 &#181;L, including 50 ng of total DNA from Step 7.2. Use the following PCR conditions: initial denaturation at 95 &#176;C for 1 min; 40 cycles of 95 &#176;C for 15 s and 60 &#176;C for 30 s. Primer sequences are as follows: MELASwt_foward: gtttgttaagatggcagagc; MELASwt_reverse: ggaattgaacctctgactgtaaagttt; MELASmut_foward: gtttgttaagatggcagg; MELASmut_reverse: ggaattgaacctctgactgtaaagttt; FBXO15_ foward: gccaggaggtcttcgctgta; FBXO15_ reverse: aatgcacggctagggtcaaa.</li>
	<li>Use threshold cycle values to calculate mitochondrial DNA copy number (mutant vs wild-type).</li>
	<li>Normalize to FBXO15 nuclear gene copy number.</li>
</ol>
8. Evaluation of organoid size and shape
<ol>
	<li>Capture images of organoids using microscope with TIFF format.</li>
	<li>Measure size and circularity using open-source image analysis software. Open the TIFF files saved in Step 8.1 by clicking File | Open and selecting the file. Choose Freehand selections and trace the organoid. Then Click Analyze | Measure. The values for Area and Circularity in the results were used for the analysis in Step 8.3.</li>
	<li>Analyze the data by performing a t-test to evaluate whether there are significant differences compared with the control lines using statistical software.</li>
</ol>

<ol><li>Sproule, D. M., Kaufmann, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mitochondrial+encephalopathy%2C+lactic+acidosis%2C+and+strokelike+episodes%3A+basic+concepts%2C+clinical+phenotype%2C+and+therapeutic+management+of+MELAS+syndrome%5BTitle%5D)+AND+%22Ann+N+Y+Acad+Sci%22%5BJournal%5D)">Mitochondrial encephalopathy, lactic acidosis, and strokelike episodes: basic concepts, clinical phenotype, and therapeutic management of MELAS syndrome.</a> Ann N Y Acad Sci. 1142, 133-158 (2008).</li>
<li>Kirino, Y., Suzuki, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Human+mitochondrial+diseases+associated+with+tRNA+wobble+modification+deficiency%5BTitle%5D)+AND+%22RNA+Biol%22%5BJournal%5D)">Human mitochondrial diseases associated with tRNA wobble modification deficiency.</a> RNA Biol. 2 (2), 41-44 (2005).</li>
<li>Shaffer, S. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Role+of+taurine+in+the+pathologies+of+MELAS+and+MERRF%5BTitle%5D)+AND+%22Amino+Acids%22%5BJournal%5D)">Role of taurine in the pathologies of MELAS and MERRF.</a> Amino Acids. 46, 47-56 (2014).</li>
<li>Shaffer, S. W., Kim, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Effects+and+mechanisms+of+taurine+as+a+therapeutic+agent%5BTitle%5D)+AND+%22Biomol+Ther%22%5BJournal%5D)">Effects and mechanisms of taurine as a therapeutic agent.</a> Biomol Ther. 26, 225-241 (2018).</li>
<li>Rikimaru, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Taurine+ameliorates+impaired+mitochondrial+function+and+prevents+stroke-like+episodes+in+patients+with+MELAS%5BTitle%5D)+AND+%22Intern+Med%22%5BJournal%5D)">Taurine ameliorates impaired mitochondrial function and prevents stroke-like episodes in patients with MELAS.</a> Intern Med. 51 (24), 3351-3357 (2012).</li>
<li>Ohsawa, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Taurine+supplementation+for+prevention+of+stroke-like+episodes+in+MELAS%3A+a+multicentre%2C+open-label%2C+52-week+phase+III+trial%5BTitle%5D)+AND+%22J+Neurol+Neurosurg+Psychiatry%22%5BJournal%5D)">Taurine supplementation for prevention of stroke-like episodes in MELAS: a multicentre, open-label, 52-week phase III trial.</a> J Neurol Neurosurg Psychiatry. 90 (5), 529-536 (2019).</li>
<li>Tolle, I., Tiranti, V., Prigione, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Modeling+mitochondrial+DNA+diseases%3A+from+base+editing+to+pluripotent+stem-cell-derived+organoids%5BTitle%5D)+AND+%22EMBO+Rep%22%5BJournal%5D)">Modeling mitochondrial DNA diseases: from base editing to pluripotent stem-cell-derived organoids.</a> EMBO Rep. 24 (4), e55678(2023).</li>
<li>Fujikura, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Induced+pluripotent+stem+cells+generated+from+diabetic+patients+with+mitochondrial+DNA+A3243G+mutation%5BTitle%5D)+AND+%22Diabetologia%22%5BJournal%5D)">Induced pluripotent stem cells generated from diabetic patients with mitochondrial DNA A3243G mutation.</a> Diabetologia. 55 (6), 1689-1698 (2012).</li>
<li>Nakamura, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Pathological+progression+induced+by+the+frontotemporal+dementia-associated+R406W+tau+mutation+in+patient-derived+iPSCs%5BTitle%5D)+AND+%22Stem+Cell+Rep%22%5BJournal%5D)">Pathological progression induced by the frontotemporal dementia-associated R406W tau mutation in patient-derived iPSCs.</a> Stem Cell Rep. 13 (4), 684-699 (2019).</li>
<li>Pagliaro, A., Artegiani, B., Hendriks, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Emerging+approaches+to+enhance+human+brain+organoid+physiology%5BTitle%5D)+AND+%22Trends+Cell+Biol%22%5BJournal%5D)">Emerging approaches to enhance human brain organoid physiology.</a> Trends Cell Biol. 35 (6), 483-499 (2025).</li>
<li>Kodaira, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Impaired+respiratory+function+in+MELAS-induced+pluripotent+stem+cells+with+high+heteroplasmy+levels%5BTitle%5D)+AND+%22FEBS+Open+Bio%22%5BJournal%5D)">Impaired respiratory function in MELAS-induced pluripotent stem cells with high heteroplasmy levels.</a> FEBS Open Bio. 5, 219-225 (2015).</li>
<li>Homma, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Taurine+rescues+mitochondria-related+metabolic+impairments+in+the+patient-derived+induced+pluripotent+stem+cells+and+epithelial-mesenchymal+transition+in+the+retinal+pigment+epithelium%5BTitle%5D)+AND+%22Redox+Biol%22%5BJournal%5D)">Taurine rescues mitochondria-related metabolic impairments in the patient-derived induced pluripotent stem cells and epithelial-mesenchymal transition in the retinal pigment epithelium.</a> Redox Biol. 41, 101921(2021).</li>
</ol>

The authors have no conflicts of interest to disclose.

Organoids induced from human embryonic stem cells (ESCs)/iPSCs represent promising disease models for rare intractable diseases, whereas the generation of brain organoids typically requires extended culture periods lasting several months10 and the use of expensive equipment, such as an engineered container that continuously stirs the culture medium and maintains stable conditions for long-term 3D cell culture. In this study, we established brain organoids within a short timeframe using standard ce...

Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) are mitochondrial diseases that are characterized by neurological dysfunction, stroke-like episodes, and various systemic symptoms. The most common cause is a m.3243A&#62;G variant in the mitochondrial leucine tRNA gene, MT-TL11. This variant is believed to impair taurine modification at the anticodon, thereby reducing leucine translation efficiency and contributing to mitochondrial dysfunction in MELAS2,3,4. Notably, improvements in symptoms have been reported following high-dose taurine administration5,6. However, the presence of non-responders suggests that additional, as yet unidentified, pathophysiological mechanisms may contribute to disease in individuals harboring the m.3243A&#62;G variant.
To elucidate disease mechanisms caused by genetic variants, it is ideal to use experimental models in which all variables are identical except for the causative variant, enabling accurate phenotypic comparisons. Genome-edited cell lines and animal models with corrected variants are often used as controls for nuclear gene disorders. However, repair of mtDNA variants remains technically challenging, even with advanced genome editing technologies7. Therefore, the establishment of experimental models with identical nuclear backgrounds remains challenging. To address this issue, we utilized two induced pluripotent stem cell (iPSC) lines derived from the same patient with MELAS that differ only in their heteroplasmy levels (i.e., the proportion of mitochondrial DNA carrying the MT-TL1 m.3243A&#62;G variant8), and generated brain organoids as a disease model. Although heteroplasmy levels can fluctuate during cell passaging or differentiation, potentially influencing phenotypes and causing batch-to-batch variability in experimental outcomes, patient-derived cells carrying mitochondrial gene variants remain valuable for investigating disease pathogenesis.
In this study, we generated brain organoids from iPSCs derived from a patient with MELAS and investigated their pathophysiology to better understand disease mechanisms. Using two iPSC lines with high and low heteroplasmy levels, we observed significant differences in neural induction efficiency, which correlated with the degree of heteroplasmy. Our findings suggest that patient-derived iPSC-based brain organoids provide a valuable platform for elucidating the mechanisms underlying MELAS and for facilitating drug screening.

<table><tbody><tr><td>10 cm cell culture dish</td><td>corning</td><td>353003</td><td></td></tr><tr><td>6 well plate ultra low attachment surface</td><td>corning</td><td>3471</td><td></td></tr><tr><td>70 &amp;mu;m cell strainer</td><td>corning</td><td>352350</td><td></td></tr><tr><td>Accutase</td><td>nacalai tesque</td><td>12679-54</td><td>enzymes used to dissociate iPSCs</td></tr><tr><td>B27 supplement</td><td>Thermofischer scientific</td><td>17504001</td><td></td></tr><tr><td>B27 supplement minus vitamin A</td><td>Thermofischer scientific</td><td>12587010</td><td></td></tr><tr><td>&amp;beta;-mercaptoethanol (2-ME)</td><td>sigma</td><td>M3148</td><td>Discard according to the institution&#039;s rules.</td></tr><tr><td>Cell Culture 6 well multi plate</td><td>corning</td><td>353046</td><td></td></tr><tr><td>cell saver tip</td><td>BMBio ECO</td><td>BMT-200W</td><td>wide-bore pipett tip</td></tr><tr><td>cell scrapers</td><td>SUMITOMO BAKELITECO., LTD.</td><td>MS-93100</td><td></td></tr><tr><td>Confocal microscope</td><td>Zeiss</td><td>LSM710</td><td></td></tr><tr><td>Cryostat</td><td>Leica</td><td>CM3050</td><td></td></tr><tr><td>Culture Mouse Laminin 1</td><td>R&amp;amp;D</td><td>3400-010-02</td><td>used for coating plates for 2D cultures of dissociated neurons</td></tr><tr><td>DMEM/F12</td><td>FUJIFILM Wako Pure Chermical Co.</td><td>042-30795</td><td></td></tr><tr><td>Fluorescence Mounting Medium</td><td>DAKO</td><td>S302380-2</td><td>mounting medium</td></tr><tr><td>FOXG1 antibody</td><td>abcam</td><td>ab196868</td><td></td></tr><tr><td>Glutamax</td><td>Thermofischer scientific</td><td>35050061</td><td></td></tr><tr><td>Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor Plus 488</td><td>Thermofischer scientific</td><td>A32723</td><td></td></tr><tr><td>Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor Plus 555</td><td>Thermofischer scientific</td><td>A32732</td><td></td></tr><tr><td>Heparan Sulfate (HS)</td><td>sigma</td><td>H7640</td><td></td></tr><tr><td>High capacity RNA-to-cDNA Kit</td><td>Thermofischer scientific</td><td>4387406</td><td>used to synthesize cDNA from RNA</td></tr><tr><td>Hoechst 33258</td><td>Thermofischer scientific</td><td>H3569</td><td></td></tr><tr><td>ImageJ</td><td></td><td>version 1.52a</td><td>used to measure size and circularity of organoids</td></tr><tr><td>iMatrix-511 silk</td><td>Takara Bio Inc.</td><td>892021</td><td>coating for plates for iPSC culture</td></tr><tr><td>insulin</td><td>FUJIFILM Wako Pure Chermical Co.</td><td>&amp;nbsp;090-06481</td><td></td></tr><tr><td>IWP2</td><td>Tocris Bioscience</td><td>3533</td><td></td></tr><tr><td>Keyence BZ-X810</td><td>Keyence</td><td>BZ-X810</td><td>used to capture images for Figure 3A</td></tr><tr><td>LSM710</td><td>Carl Zeiss AG</td><td></td><td>confocal microscope</td></tr><tr><td>LSM980</td><td>Carl Zeiss AG</td><td></td><td>confocal microscope</td></tr><tr><td>LUNA Universal qPCR Master Mix</td><td>New England Biolabs</td><td>M3003</td><td></td></tr><tr><td>Matrigel</td><td>Corning</td><td>354277</td><td></td></tr><tr><td>N2 supplement</td><td>Thermofischer scientific</td><td>17502001</td><td></td></tr><tr><td>Neurobasal medium</td><td>Thermofischer scientific</td><td>21103049</td><td></td></tr><tr><td>Neuron Dissociation Solution&amp;nbsp;</td><td>FUJIFILM Wako Pure Chermical Co.</td><td>291-78001</td><td></td></tr><tr><td>non-essential amino acids (NEAA)</td><td>nacalai tesque</td><td>06344-56</td><td></td></tr><tr><td>Normal Goat Serum</td><td>Jackson ImmunoResearch Inc.&amp;nbsp;</td><td>005000121</td><td></td></tr><tr><td>Nunclon Sphera 96-Well, Nunclon Sphera-Treated, U-Shaped-Bottom Microplate</td><td>Thermofischer scientific</td><td>174929</td><td></td></tr><tr><td>paraformaldehyde (PFA)</td><td>nacalai tesque</td><td>09154-85</td><td>Discard according to the institution&#039;s rules.</td></tr><tr><td>PBS</td><td>nacalai tesque</td><td>14249-24</td><td></td></tr><tr><td>PBS</td><td>nacalai tesque</td><td>27575-31</td><td></td></tr><tr><td>penicillin/streptomycin (PS)</td><td>nacalai tesque</td><td>26253-84</td><td></td></tr><tr><td>Poly-L-ornithine (PO)</td><td>sigma</td><td>P3655</td><td></td></tr><tr><td>Polyoxyethylene(10) Octylphenyl Ether (Triton)</td><td>FUJIFILM Wako Pure Chermical Co.</td><td>168-11805</td><td></td></tr><tr><td>PRISM&amp;nbsp;</td><td>GraphPad</td><td>version 9.5.0</td><td></td></tr><tr><td>QIAamp DNA Mini Kit&amp;nbsp;</td><td>QIAGEN</td><td>51304</td><td>used to extract total DNA</td></tr><tr><td>RNeasy Mini Kit</td><td>QIAGEN</td><td>74104</td><td>used to extract total RNA</td></tr><tr><td>SB-431542</td><td>Cayman Chemical</td><td>13031</td><td></td></tr><tr><td>slide glasses</td><td>MATSUNAMI</td><td>CRE-05</td><td></td></tr><tr><td>StemFit AK02N</td><td>Takara Bio Inc.</td><td>AK02N</td><td>medium used for the culture of undiffereintiated iPSCs and from differentiation Day 0 to Day 6</td></tr><tr><td>Sucrose</td><td>FUJIFILM Wako Pure Chermical Co.</td><td>196-00015</td><td></td></tr><tr><td>Tissue-Tek O.C.T. Compound</td><td>Sakura Finetek Japan Co.,Ltd.</td><td>4583</td><td>Cryopreservation medium</td></tr><tr><td>TUBB3 antibody</td><td>Promega</td><td>G712A</td><td></td></tr><tr><td>Y27632</td><td>FUJIFILM Wako Pure Chermical Co.</td><td>030-24021</td><td>ROCK inhibitor</td></tr><tr><td>ZEN</td><td>Carl Zeiss AG</td><td>2.3SP1(black edition)</td><td>software to analyze the images taken&amp;nbsp; with confocal microscope (LSM710)</td></tr><tr><td>ZEN</td><td>Carl Zeiss AG</td><td>2.6 (blue edition)</td><td>software to analyze the images taken&amp;nbsp; with confocal microscope (LSM980)</td></tr></tbody></table>

modeling mitochondrial disease using brain organoids: a focus on mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes

Modeling Mitochondrial Disease Using Brain Organoids: A Focus on Mitochondrial Encephalomyopathy, Lactic Acidosis, and Stroke-like Episodes

Mitochondrial Encephalomyopathy, Lactic Acidosis, and Stroke-like episodes (MELAS) are mitochondrial disorders most commonly caused by a m.3243A&#62;G variant in mitochondrial tRNALeu. To investigate the pathophysiology of MELAS, we generated brain organoids from multiple induced pluripotent stem cell (iPSC) lines derived from a patient with MELAS carrying the m.3243A&#62;G variant. These lines share an identical nuclear genetic background but differ in their heteroplasmy levels involving the m.3243A&#62;G variant. We observed significant differences in organoid size, morphology, and neural induction efficiency, which correlated with the degree of heteroplasmy. Dissociated neurons from the organoids were transferred into a 2D-culture system, which is convenient and suitable for high-throughput drug screening. The organoids also exhibited significant differences in the formation of neural networks, depending on heteroplasmy levels. Our results suggest that patient-derived iPSC-based organoid models represent a useful platform for studying MELAS mechanisms and for drug screening. This video presents comprehensive and user-friendly methods, including protocols for generating organoids and evaluating phenotypes.

We generated brain organoids and conducted 2D neuronal cultures using a relatively simple protocol with minor modifications based on Nakamura et al.9 (Figure 1). In the previous protocol, V-shaped 96-well plates were used, whereas in this study, we used U-shaped 96-well low-attachment plates to allow the cells to naturally aggregate at the center of each well. Using the healthy control iPSC line 414C2, we successfully induced brain organoids containing FOXG1-positive ...

Brain organoids serve as a valuable model for Mitochondrial Encephalomyopathy, Lactic Acidosis, and Stroke-like episodes (MELAS) studies, offering insights into their underlying pathophysiology and providing a platform for drug screening. Organoids derived from cell lines with varying levels of heteroplasmy of disease-causing genes exhibit significant phenotypic differences.

Mitochondrial Encephalomyopathy, Lactic Acidosis, and Stroke-like episodes (MELAS) are mitochondrial disorders most commonly caused by a m.3243A&#62;G ...

The scope of our research is to understand mitochondrial disease meters, and find drugs to treat it. The challenge is to retain the capacity for high throughput assays, even though the technique contains organoid formation. To begin, remove the medium from induced pluripotent stem cell culture plates when they are approximately 70 to 80%confluent.Wash the cells with PBS. Add 350 microliters of enzyme solution to the cells and incubate. Add 800 microliters of stem fit medium to stop the reaction.After transferring the cell suspension to a fresh tube, centrifuge it at 190G for five minutes at 22 degrees Celsius. Next, re-suspend the pellet in one milliliter of differentiation medium. After counting the cells, seed 3000 cells in 100 microliters into each well of a U-shaped 96 well low attachment plate.Incubate for six days at 37 degrees Celsius, with 5%carbon dioxide. After incubation, use a wide bore pipette to transfer the organoids from the 96 well plate into a 10 centimeter dish. Pipette 50 microliters of supplemented DMEM/F12 medium to each well of a new 96 well plate.Collect the organoids into two milliliter tubes. Remove the medium carefully without aspirating the organoids, and add 1.5 milliliters of supplemented DMEM/F12 medium. After pipetting out the last wash, add 500 microliters of fresh medium.Then transfer the organoids to a 10 centimeter dish. Add five milliliters of medium to facilitate picking each organoid. Transfer all organoids into each well of a 96 well plate using a micro pipette set to 50 microliters, and incubate for three days.At day nine, collect the organoids into two milliliter tubes and wash three times with DMEM/F12. Then re suspend the organoids in differentiation medium. Transfer approximately 10 organoids per well into a six well plate and adjust the final volume of medium in each well to two milliliters.Culture the plate statically for six days at 37 degrees Celsius with 5%carbon dioxide. On the 15th day, collect the organoids into 15 milliliter tubes. After letting the tubes to settle, add fresh differentiation medium supplemented with B27 and vitamin A after pipetting out the supernatant.Transfer approximately 10 organoids per well into a six well plate. Culture the organoid statically for 15 days at 37 degrees Celsius with 5%carbon dioxide. Coat the culture plates with the dilute poly-L-Ornithine solution.Incubate the plates overnight at 37 degrees Celsius. The next day, wash the wells three times for five minutes each with PBS. Now add diluted laminin solution to the wells.Incubate the plates for three hours at 37 degrees Celsius, or overnight. Centrifuge the organoid suspension at 200G for five minutes. Remove the supernatant and add one milliliter of enzyme solution.Mix well and incubate at 37 degrees Celsius for five minutes before centrifuging. After removing the supernatant and adding one milliliter of dispersion solution, carefully layer the isolation solution beneath the suspension. Then centrifuge the suspension at 200G for five minutes.Now, pipette one milliliter of neuronal medium into the tube. Mix the solution and pass the suspension through a 70 micrometer strainer into a 50 milliliter tube. After counting the cells, seed the cell suspension at a density of 100, 000 cells per square centimeter on poly-L-Ornithine and Laminin coated plates.Replace the medium every four to seven days until day 60. To fix the organoids for immunofluorescence, first harvest the organoids into micro tubes. Rinse the organoids with PBS, then fix the organoids in 4%Paraformaldehyde for 30 minutes at room temperature.Post fixation, wash the fixed organoids three times with PBS. Store the organoids at four degrees Celsius until used. 30 days after seeding for 2D neuronal culture, remove the culture medium from the plates.Then wash the cells with PBS. Fix the cells with 4%Paraformaldehyde for 15 minutes at room temperature. Pipette out the Paraformaldehyde, then wash the cells with PBS three times.Store the fixed cells at four degrees Celsius until used. To collect the organoids for RTQPCR, transfer the organoids into micro tubes. Pipette PBS into the tubes to wash the organoids.Now, add 350 microliters of lysis buffer to the organoids, then snap freeze them in liquid nitrogen. Store the tubes at minus 80 degrees Celsius until used. Brain organoids containing FOXG1 positive neurons were successfully induced from the healthy control IPSC line 414C2 on day 30, and 2D cultured neural networks were obtained on day 60.Heteroplasmy levels of the M.3243A to G variant were confirmed by QPCR. Line two to eight had low heteroplasmy, and lines two to six had high heteroplasmy. Brain organoids derived from the low heteroplasmy line two to eight exhibited sizes and morphologies similar to those from healthy controls.Organoids generated from the high heteroplasmy line two to six displayed reduced size of 0.3 square millimeters, and irregular morphology with a circularity value of 0.82. Most neurons induced from the 414C2 line and the two to eight line were FOXG1 positive on days 30 and 60. FOXG1 positive neurons were rarely detected in organoids or 2D cultured neurons derived from the two to six line.Our results suggests that patient derived IPSC based organoid models represent a useful platform for studying mirrors, mechanisms, and for drug screening. Our conventional methods with a short culture time and cost effectiveness offer practical tools for investigating the pathophysiology of MELIS. We would like to search for potential drugs for MELIS by using compounds with patient delivered organized in the future.

modeling-mitochondrial-disease-using-brain-organoids-focus-on

Research

JoVE Journal

Neuroscience

Source: Kennedy, L. H., et. al. Visualization and Live Imaging of Oligodendrocyte Organelles in Organotypic Brain Slices Using Adeno-associated Virus and Confocal Microscopy. J. Vis. Exp. (2017)This video demonstrates the imaging of oligodendrocyte mitochondria in organotypic mouse brain slices. The slice is placed inside a bath chamber with continuous fluid circulation and controlled temperature. After setting up various parameters of the confocal microscope, time-lapse images of mitochondria...

Confocal Imaging of Mitochondrial Movement within Oligodendrocytes in Organotypic Brain Slice Cultures

Mitochondrial visualization and analysis from mammalian brain tissue is a challenging task. Here, we describe how three dimensional (3D) reconstruction analysis from the serial block-face scanning electron microscopy (SBFSEM) can be used to gain insights on the morphological and volumetric analysis of this critical energy generating organelle.



Analysis of Brain Mitochondria Using Serial Block-Face Scanning Electron Microscopy

Modeling human brain development has been hindered due to the unprecedented complexity of neural epithelial tissue. Here, a method for the robust generation of brain organoids to delineate early events of human brain development and to model microcephaly in vitro is described.

Generation of iPSC-derived Human Brain Organoids to Model Early Neurodevelopmental Disorders

The goal of this technique is to prepare a highly enriched culture of primary motoneurons (MNs) from murine spinal cord. To evaluate the consequences of mutations causing MN diseases, we describe here the isolation of these isolated MNs and their transfection by magnetofection.

Modeling Charcot-Marie-Tooth Disease In Vitro by Transfecting Mouse Primary Motoneurons

We describe a detailed protocol for the generation of human induced pluripotent stem cell-derived brain organoids and their use in modeling mitochondrial diseases.

Generation of Human Brain Organoids for Mitochondrial Disease Modeling

The electroporation of primate cerebral organoids provides a precise and efficient approach to introduce transient genetic modification(s) into different progenitor types and neurons in a model system close to primate (patho)physiological neocortex development. This allows the study of neurodevelopmental and evolutionary processes and can also be applied for disease modeling.

Targeted Microinjection and Electroporation of Primate Cerebral Organoids for Genetic Modification

This study presents a method to analyze the morphology of mitochondria based on immunostaining and image analysis in mouse brain tissue in situ. It also describes how this allows one to detect changes in mitochondrial morphology induced by protein aggregation in Parkinson's disease models.

Histological Examination of Mitochondrial Morphology in a Parkinson's Disease Model

This protocol presents a workflow for the propagation, differentiation, and staining of cultured SH-SY5Y cells and primary rat hippocampal neurons for mitochondrial ultrastructure visualization and analysis using stimulated emission depletion (STED) microscopy.

Using Live Cell STED Imaging to Visualize Mitochondrial Inner Membrane Ultrastructure in Neuronal Cell Models

This protocol aims to stably plate dorsal-ventral fused assembloids on multi-electrode arrays for modeling epilepsy in vitro.

A Multi-Electrode Array Platform for Modeling Epilepsy Using Human Pluripotent Stem Cell-Derived Brain Assembloids

One feature of Alzheimer's Disease is the elevation of Aβ1-42 peptide. Here we provide a protocol for preparing synthetic Aβ1-42 oligomers, which impairs hippocampal Long-Term Potentiation, a cellular correlate of memory. This procedure is useful for investigating mechanisms of Aβ-induced pathology and drug screening.

Preparation of Oligomeric &beta;-amyloid1-42 and Induction of Synaptic Plasticity Impairment on Hippocampal Slices

Learn brain organoid modeling for MELAS mitochondrial disease using patient-derived iPSCs. This method enables high-throughput drug screening and reveals pathophysiological mechanisms through heteroplasmy analysis.

Modeling Mitochondrial Disease Using Brain Organoids: A Focus on Mitochondrial Encephalomyopathy, Lactic Acidosis, and Stroke-like Episodes (Video) | JoVE Journal

Modeling Mitochondrial Disease Using Brain Organoids: A Focus on Mitochondrial Encephalomyopathy, Lactic Acidosis, and Stroke-like Episodes

Explore More Videos