Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Allelotyping belirlenmesi için bir PCR Salmonella enterica Serovars Enteritidis, Hadar, Heidelberg ve Typhimurium

doi: 10.3791/3130 Published: July 22, 2011

Summary

Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, ve Typhimurium hızlı tespiti için bir multipleks PCR açıklar. Belirli Salmonella serovars, belirli bir serovar O-antijen biyosentezi küme ve flagellin benzersiz genler ve dizileri bir multipleks PCR hedef tespit edilebilir. Serovar hedef allel ilgili özel, boyut amplikonlarının (PCR ürünü) görünümünü dayalı izole Salmonella sonra atanır.

Abstract

Bu cinse özgü Salmonella hedef genlerin belirlenmesi için mevcut ticari PCR testleri. Ancak, iki tür, altı alttür ve 2.500 'in üzerinde farklı Salmonella serovars, ve tüm halk sağlığı için önemi eşit. Örneğin, S. bulma enterica alttür IIIa Arizona bir tablo yumurta katman çiftlikte S. izolasyonu ile karşılaştırıldığında önemsiz enterica alttür serovar Enteritidis, salmonelloz tablo yumurta tüketimi ile bağlantılı önde gelen nedenidir. Serovars antijenik lipopolisakkarid farklılıklar (LPS) (O antijen) ve flagellin (H1 ve H2 antijenleri) göre tespit edilir. Bu antijenik farklılıklar bu fenotip ile ilişkili genler ve gen allel çeşitliliğini dış görünüş.

Multipleks PCR allelotyping geliştirilen dört ana S. arasında genetik farklılıkların tuşları enterica alttür I serovars kümes hayvanlarında bulunan ve ABD'de önemli bir insan hastalığı ile ilişkili . PCR primer çiftleri, anahtar gen ya da belirli bir Salmonella serovar benzersiz ve bu gen ya da alleli için belirli bir büyüklüğe sahip bir Amplikon üretmek için tasarlanmış dizileri hedef alındı. Salmonella serovar özel LPS için PCR testi sonuçlarının kombinasyonu dayalı izole etmek için atanır ve flagellin allel gen. Bu makalede açıklanan multipleks PCR S. tespiti için özeldir enterica alttür I serovars Enteritidis, Hadar, Heidelberg, ve Typhimurium.

Burada Salmonella izole serovar belirlemek için multipleks PCR nasıl kullanılacağını göstermektedir.

Protocol

1. PCR Şablon Hazırlama

Not:) 1) şablonu (DNA) hazırlanması, 2 PCR kurulumu, ve 3) jel elektroforezi: PCR kontaminasyon en aza indirmek için, birçok önemli önemli adımlar PCR birbirlerinden fiziksel-ayrı tutmak için önemlidir. Ayrıca pipetters kültür veya reaktif kontaminasyonu önlemek için bariyer ipuçları kullanılması tavsiye edilir.

  1. Tek bir izole koloni izole Salmonella Luria Bertani et suyu ya da diğer karmaşık orta (Beyin Kalp İnfüzyon, Superbroth, vb.) 1 ml inoküle edin . Gecede kültür inkübe 37 ° ° C.
  2. 1 ml steril, 1.5 ml kapasiteli mikrofuge'de tüp aktarın, yaklaşık 2 dakika süreyle 4500 xg'de bakteriyel hücre süspansiyonu santrifüj. pelet hücreleri.
  3. Durusu süpernatant, oda sıcaklığında 10 dakika süreyle% 100 etanol ve set 1 ml hücre pelletini tekrar süspansiyon haline getirin. Pelet (4,500 xg, 2 dak.) Daha önce olduğu gibi hücreleri, 1 ml PBS içinde supernatant ve tekrar süspansiyon hücreleri çıkarmak.
  4. Santrifüj hücreleri (4,500 xg, 2 dak.), 1 ml steril dH 2 O supernatant ve tekrar süspansiyon hücreleri silmek
  5. -20 DH 2 O (5 μl/95 ul dH 2 O) ve mağaza ° C nihai hücre süspansiyonu 1 / 20 sulandırınız PCR şablon olarak tüm hücreleri -20 ° C'de raf ömrü yaklaşık bir ay.

2. PCR Kurulum

Not: PCR reaksiyon karışımı (şablonu tamponlar, oligonucletoideprimers, nükleotidler ve Taq DNA polimeraz) hazırlanması ve dağıtımı, PCR UV / iş istasyonu adanmış ve tercihen yapılan fiziksel olarak ayrı bir odada yapılması gerekir.

Not: PCR oda da PCR kurulum, tek kullanımlık lateks eldiven için adanmış pipetter atanmış bir -20 ° C PCR depolama için dondurucu (tamponlar, oligonükleotid primerler ve nükleotidlerin), enzimler ve şablon ile kendine yer almalıdır kurdu , laboratuvar ceket, bariyer ipuçları, microtiter plakalar, cam kapilerleri, mikrofuge'de tüpler, ve dekontaminasyon yüzeyler için% 10 çamaşır suyu. PCR dağıtmak için özel bir pipetter seti (P10, P100, P1000) kullanın. Bu pipet seti set-up istasyonu asla terk gerekir.

Not: moleküler biyoloji ya da PCR derece dH 2 O ve kısım 1 ml 1.5 ml kapasiteli santrifüj tüplerine alın. Çapraz bulaşmayı önlemek için her kullanımdan sonra aliquoted dH 2 O koyun. Benzer bir yaklaşım, diğer PCR ile tavsiye edilir.

Not: UV aydınlatma ve / veya% 10'luk çamaşır suyu ile yüzey aşağı silme kullanmadan önce çalışma alanı dekontamine. PCR kurulum yapmadan laboratuvar ceket ve lateks eldiven giyin. PCR ile ileri ve geri trafiğini azaltmak PCR reaksiyonları thermocylcer ve PCR ürünleri agaroz jel (amplikonlarının) ayrılır inkübe alanlarda set-up. PCR set-up alana geri giderseniz, henüz giyen ve yeni bir çift eldiven, lateks eldiven çifti atmayın.

  1. 5x10 -4 M. bir konsantrasyon dH 2 o ana astar stok olun 1 / 20 dH 2 O (25 mcM 5 μl/95 ul dH 2 o) primerler seyreltilir. Her flagellin yazarak astar oligonükleotid sırası Tablo 1'de açıklanmıştır.
  2. -20 ° C derin dondurucu PCR ve şablon almak ve reaktifler ve numune buz üzerinde çözünme izin. Taq DNA polimeraz gerektiği kadar dondurucuda bekletin.
  3. Allelotyping PCR reaksiyon karışımı Tablo 1'de açıklandığı gibi reaktifler koyun.
  4. Sütun (örneğin, A1) üst kısmında başlayan ve sonraki üst sütunu aşağı hareket, steril, 96-de, polistiren mikrotiter plate 10 yuvarlak alt kuyuların her birine PCR reaksiyon karışımı 9μl dağıtın.
  5. Pozitif kontrol şablonları (0.5μl ilk kuyusu (A1), (DNA kontrolü) PCR karışımı 9 ul 1 dH 2 O ul Ekle i / g, m yazarak primerleri Typhimurium ve Enteritidis; r/z10 yazarak primerleri-Heidelberg ve Hadar ve 1,2 / e, n, x yazarak primerleri-Typhimurium ve Hadar) 9 ul 2. PCR karışımı (B1) ve 1 ul Escherichia coli K12, DH5α üçüncü kuyuda PCR karışımı 9 ml (C1).
  6. Her ek iyi (D1-H1, A2, B2), PCR reaksiyon karışımı 9 ul 1 ul çözülmüş örnek şablonu ekleyin. I / g, m allelotyping PCR, S. için enterica serovar Typhimurium (i) ve Enteritidis (g, m) pozitif kontrol olarak hizmet ve Salmonella serovars Heidelberg (r) ve Hadar (z10) r / z 10 allelotyping multipleks PCR için pozitif kontrol.
  7. 10 ul kapasitesi cam kapilerleri Idaho Teknoloji Rapidcycler (8) için belirlenmiş sahipleri içine yerleştirin.
  8. bir kez sahibinin güvenli, her bir cam kapiller dokunarak PCR reaksiyon karışımı ile kapiller yükmikrotiter plate alt kuyu. Sıvı tüp aşağı hareket ve ısı, kılcal damarların her iki ucunda mühür için bir bütan meşale ile cam tüp sızdırmazlık önce sona erer ve PCR karışımı arasında boşluk sağlamak için izin sahibinin yatırın.
  9. Kılcal tüpler ve tutucu Idaho Teknoloji Rapidcycler içine yerleştirin ve PCR çalışması için farklı allelotyping primerler Tablo 1'de açıklanan PCR programları kullanın.
  10. PCR programı tamamlandıktan sonra jel elektroforezi adıma geçin.

3. Jel Elektroforez

Not: elektroforez laboratuvar kullanımı için belirlenmiş farklı bir laboratuvar önlüğü ve yeni bir çift tek kullanımlık lateks eldiven giyin .

Not: UV koruyucu göz gözlük veya yüz siperi giyin ve her zaman etidyum bromür, özellikle agaroz jel ele eldiven vardı.

  1. 100 ml% 1.5 (w / v) 1xTAE moleküler biyoloji sınıf agaroz elektroforez tamponu (7) art arda 2-5 dakika aralıklarla% 20 güç periyodik görsel bir mikrodalga agaroz süspansiyon ısıtma (veya 1X TBE) erimiş hazırlayın muayene. Erimiş agaroz 60 ° C su banyosu su banyosu sıcaklığı equilibrates kadar ayarlayın.
  2. Jel kalıp erimiş agaroz dökülmeden önce tarak ile ayarlayın. Denetimleri, örnekler ve biter ve agaroz jel ortasında yerleşimler için en az 3 molekül ağırlığı standartları için yeterli kuyuları üretmek için yeterli dişlere sahip bir jel tarak seçin.
  3. Ul 2 ethidium bromür (10 mg / ml) 100 ml erimiş% 1.5 (w / v) 1xTAE agaroz (TBE), karışımı yavaşça girdap şişe üreten kabarcıkları önlemek için, şişe içeriği ve yavaşça dökün 10 cm agaroz jel için 15 jel kalıp ortasına. Agaroz jel kabarcıkları kağıt mendil ya da kağıt havlu kenarı kullanın.
  4. Agaroz katılaşır (~ 30-45 dk) kadar oda sıcaklığında jel kalıp edelim. Dalgıç, yatay elektroforez odasına 1X TAE (veya 1X TBE) elektroforez tamponu içeren jel ve tarak ile jel tepsisi aktarın. Agaroz jel tarak yavaşça çıkarın.
  5. Bu kutup jel altındaki emin olmak için elektroforez odasının katot veya pozitif kutup göre jel tepsisi yerleştirme kontrol edin. Not: katot doğru negatif yüklü DNA göç (yani, "kırmızı çalıştırmak") unutmayın.
  6. 6X DNA Yükleniyor Boya 40 ul DNA molekül ağırlığı belirteçleri (0.25 mcg / ml) karışımlar 200 ul. İlk, orta ve son kuyuların önceden karıştırılmış DNA Molekül Ağırlığı Marker XIV 4.8 ul yükleyin.
  7. PCR örneklerinin her biri de 2 ile başlayan ve sonraki her iyi ilerleyen, soldan sağa hareket yükleyin. Herhangi bir moleküler ağırlık standardı içeren kuyulardan numune yükleme kaçının.
  8. Her cam kapiller bulunan örnekler yüklemek için:
    1. Tutucu ve kılcal bir cam kesici ile aşındırma sona erer her kılcal çıkarın.
    2. Place başparmak ve işaret parmağı ile her iki ellerini cam kesici ile işaretlenmiş kılcal her iki tarafında ve kılcal ek bileşenini.
    3. PCR reaksiyon karışımı sonunda tam tersi kılcal dağıtıcı yerleştirin ve yavaş yavaş sıvı tüpün en alt gelene kadar pistonu saat yönünde çevirin.
    4. Kapiller yüklenecek kuyunun içine yerleştirin ve yavaş yavaş iyi agaroz Ficoll ağırlıklı numune dağıtmak için pistonu saat yönünde çevirin. Ponksiyon iyi sıvı son kılcal ayrıldığında çok geçmiş dönüm kılcal ya da iyi bir hava kabarcığı tanıtmak için dikkatli olun.
  9. Bir kez tüm numuneler ve standartlar yüklenir, V (9 volt / cm agaroz jel) 90 sabit gerilim güç kaynağı.
  10. Sarı boya (Taurazine) ön kez elektroforez jel alttan 1 cm bırakın.
  11. Elektroforez tamamlandıktan sonra, DNA parçaları ve molekül ağırlığı standart görselleştirmek için jel UV transilluminator'de aktarın. Polaroid filmi ya da bir termal yazıcı ile bir CCD kamera ve baskı görüntüsü kullanarak dijital görüntü olarak: turuncu cam filtre (2 x ve 4,5 y ayarları) ile bir Polaroid kamera kullanarak görüntü yakalayın.
  12. 15-30 dakika süreyle% 10'luk çamaşır suyu kılcal sahipleri yerleştirin. DH 2 O ve PCR kurulum oda hava kuru yerde 3 kez durulayın.

4. Temsilcisi Multiplex PCR Sonuçlar

Salmonella allelotyping PCR Sonuçlar 1-10 Şekil 1 (3-12 şeritli) gösterilen ve aşağıdaki gibi yorumlanır izole eder. O allel atama PCR kontrolü boyutunda eşleşen Amplikon (PCR ürünü) dayalı izole Salmonella verilen ve O aleli astar olarak tahmin edilmektedir (3) ayarlar: B-560bp, C1-340bp, C2-400 bp D1-620 bp, E1-280 bp. O allel B (10 şeritli atanan O allelotyping PCR (Şekil 1A), test izolatlarının içinOn Salmonella 13), C1 (7-9 şeritli), C2 (şerit 4, 5), D1 (şerit 3), ve E1 (6 şeritli), şerit 3-12 test izole eder . Bu aynı Salmonella izolatları Şekil olarak aynı sırayla test edildi. 1A, H1 allel i; g, m, r ve z10 (Şekil 1B, C). (3) Yine, H1 allel her PCR kontrolü boyutu ile eşleşen bir Amplikon varlığına bağlı izole atanır ve 4 H1 allel astar için öngörülen ayarlar: i-510 bp (Şekil 1B, 2 şeritli ); g, m-310 bp (Şekil 1B, şerit 2), r-170 bp (Şekil 1C, şerit 2) ve z10-360 bp (Şekil 1C, şerit 2). H1 allel on Salmonella izolatlarının ayrıldı: i - 3 ve 8 (Şekil 1B, 5 ve 10 şeritli) izole, g, m-izolatları 1 ve 5 (Şekil 1B, 3 ve 7 şeritli), r izolatları 6 ve 9 (Şekil 1C, şerit 8 ve 11);. izolatları 2, 7 ve 10 (Şekil 1C, şerit, 4, 9, ve 12) ve z10 Salmonella izole 4 test edilen dört H1 allel için negatif idi . Son olarak, Salmonella izolatları 1,2 ile ilişkili H2 allelleri için PCR ile test edilmiştir, 1,5, 1,6, 1,7 antijen kompleksi ve e, n, x, e, n, Z15 antijen kompleksi. H2 1,2 astar ayarlar; 1,5, 1,6, 1,7 karmaşık ve H2 e, n, x, e, n, Z15 karmaşık 290 bp ve 150 bp amplikonlarının, (3). Primer setleri, kesin bir allel tipi, eski atamak için karmaşık ya H2 antijen içinde belirli H2 allel ayrım yapamaz. 1,2, (3) Salmonella izole izole 4, 6, 8-10 H2 1,2 ile ilişkili H2 allelleri için pozitif, 1,5, 1,6, 1,7 antijen kompleksi izolatları 2 ve 7 e, n, x ile ilişkili H2 allelleri için olumlu; e, n, Z15 antijen kompleksi (veriler gösterilmemiştir). Salmonella, 1, 3, ve 5 iki H2 antijen kompleksleri için negatif idi izole ederken, sadece 1 ve 5, H2 flagellin için genel bir H2 flagellin PCR (1) (veri gösterilmez) kullanılarak belirlenir negatifti izole . Bu sonuçlar her izole etmek için atanan olası Salmonella serovar ile birlikte Tablo 2'de özetlenmiştir.

Şekil 1
Şekil 1. S. ile İlişkili Özgül O ve H Alleller belirlenmesi için Multiplex PCR enterica Serovars Enteritidis, Hadar, Heidelberg, ve Typhimurium (A) O Allel Multiplex PCR. (B, C) Flagellin Alleller belirlenmesi için H1 Allel Multiplex PCR: i / g, m (B) ve r/z10 (C). Lanes: 100 baz puan (bp) merdiven (Promega; Madison, WI); şeritli 2: O allelleri için multipleks PCR kontrolleri, B, C1, C2, D1, ve E (A), H1 allel 1 ve 13 / g, m (B) ve 1-10 (Tablo 2) H1 allel r/z10 (C) ve şerit 3-12: Salmonella izole eder.

PCR Master Mix PCR (Rapidcycler)
Reaktifler Kompozisyonu / konsantrasyon Miktar   Parametreler Beklenen Boyutu
H1 i / g, m
dH 2 O 63 ul Program 1 1 dakika için 94 ° C
10X PCR buffer 20 mM MgCl 2 10 ul Program 2 1 s için 94 ° C
500 mMTris pH8 1 s için 55 ° C
2.5 mg / ml BSA 20 saniye 72 ° C
% 5 Ficoll 400 40 devir için
10 mMTartrazine Eğim = 2.0
Primer i (f) * AACGAAATCAACAACAACCTGC 2 ul Program 3 4 dakika süreyle 72 ° C 510 bp
Primer i (r) * TAGCCATCTTTACCAGTTCCC 2 ul
Primer g, m (f) * GCAGCAGCACCGGATAAAG 2 ul 310 bp
Primer g, m (r) * CATTAACATCCGTCGCGCTAG 2 ul
DMSO 5 ul
dNTP 10 mM 2 ul
Taq 5 adet / ml 2 ul
90 ul
H1 r / z 10
dH 2 O 55 ul Program 1 1 dakika için 94 ° C
10X PCR buffer 30 mM MgCl 2 10 ul Program 2 1 s için 94 ° C
500 mMTris pH8 1 s için 55 ° C
2.5 mg / ml BSA 20 saniye 72 ° C
% 5 Ficoll 400 40 devir için
10 mMTartrazine Eğim = 2.0
Primer r (f) * CCTGCTATTACTGGTGATC 4μl Program 3 4 dakika süreyle 72 ° C 170 bp
Primer r (r) * GTTGAAGGGAAGCCAGCAG 4μl
Primer z 10 (f) * GCACTGGCGTTACTCAATCTC 4μl 360 bp
Primer z 10 (r) * GCATCAGCAATACCACTCGC 4μl
DMSO 5 ul
dNTP 10 mM 2 ul
Taq 5 adet / ml 2 ul
90 ul
PCR Master Mix PCR (Rapidcycler)
Reaktifler Kompozisyonu / konsantrasyon Miktar   Parametreler Beklenen Boyutu
H2 1,2 / e, n, x
dH 2 O 63.6 ul Program 1 1 dakika için 94 ° C
10X PCR buffer 20 mM MgCl 2 10 ul Program 2 1 s için 94 ° C
500 mMTris pH8 1 s için 55 ° C
2.5 mg / ml BSA 20 saniye 72 ° C
% 5 Ficoll 400 40 devir için
10 mMTartrazine Eğim = 2.0
Primer 1,2 (f) * AGAAAGCGTATGATGTGAAA 2 ul Program 3 4 dakika süreyle 72 ° C 290 bp
Primer 1,2 (r) * ATTGTGGTTTTAGTTGCGCC 2 ul
Primer e, n, x (f) * TAACTGGCGATACATTGACTG 2 ul 150 bp
Primer e, n, x (r) 1 TAGCACCGAATGATACAGCC 2 ul
DMSO 5 ul
dNTP 10 mM 2 ul
Taq 5 adet / ml 2 ul
90 ul
Jenerik H2
dH 2 O 72 ul Program 1 1 dakika için 94 ° C
10X PCR buffer 30 mM MgCl 2 10 ul Program 2 10 s için 94 ° C
500 mMTris pH8 10 s için 45 ° C
2.5 mg / ml BSA 35 s için 72 ° C
% 5 Ficoll 400 40 devir için
10 mMTartrazine Eğim = 2.0
Primer fljB (f) * CAAGTAATCAACACTAACAGTC 2 ul Program 3 4 dakika süreyle 72 ° C 1.500 bp
Primer fljB (r) * TTAACGTAACAGAGACAGCAC 2 ul
dNTP 10 mM 2 ul
Taq 5 adet / ml 2 ul
90 ul

Tablo 1. Salmonella flagellinallelotyping PCR için Protokol: kompozisyon, koşullar ve beklenen sonuçlar.

* PCR oligonükleotid primerler çalışma stok konsantrasyonu 25 mcM

Izole etmek O Allel H1 Allel H2 Allel Serovar
  B C1 C2 D1 E ben g, m r z10 1,2, 1,5, 1,6, 1,7 e, n, x, e, n, Z15 Jenerik 1  
1 - - - + - - + - - - - - Enteritidis
2 - - + - - - - - + - + + Hadar / İstanbul 3
3 - - + - - + - - - - - + Kentucky
4 - - - - + - - - - + - + Bilinmeyen
5 - + - - - - + - - - - - Montevideo
6 - + - - - - - + - + - + Infantis veya Virchow 2
7 - + - - - - - - + - + + Mbandaka
8 + - - - - + - - - + - + Typhimurium
9 + - - - - - - + - + - + Heidelberg
10 + - - - - - - - + + - + Haifa

Tablo 2. O, H1, H2 Alleller Kimlik dayanarak Allelotyping PCR (Şekil 1) ve Salmonella serovar belirlenmesi

> 1 H2 PCR H2 alleli (1) ne olursa olsun, H2, flagellin sahip tüm Salmonella 1.5 kb Amplikon üretir. Bu PCR monofazik bifazik Salmonella ayırt etmek için kullanılır.
1,5, 1,6, 1,7 antijen kompleksi (3) 2 H2 multipleks PCR H2 1,2 için farklı alleller arasında ayrım olamaz.
S. 3 Faj dönüşüm serovar İstanbul üretmek için enterica serovar Hadar değiştirir LPS O antijeni. O allelotyping PCR bu ince genetik / antijenik değişiklikler ayırt edemez.

Serovar 1 O Allel H1 Allel H2 Allel
  B C1 C2 D1 E ben g, m r z10 1,2, 1,5, 1,6, 1,7 e, n, x, e, n, Z15 Jenerik 2
Kaliforniya + - - - - - + - - - - -
Typhimurium + - - - - + - - - + - +
Heidelberg + - - - - - - + - + - +
Haifa + - - - - - - - + + - +
Montevideo - + - - - - + - - + - +
Othmarschen - + - - - - + - - - - -
Athinai - + - - - + - - - - + +
Papuana - + - - - - - + - - + +
Mbandaka - + - - - - - - + - + +
Chincol - - + - - - + - - - + +
Kentucky - - + - - + - - - - - +
Hadar / İstanbul 3 - - + - - - - - + - + +
Enteritidis - - - + - - + - - - - -
Seremban - - - + - + - - - + - +
Campinense - - - + - - - + - - + +
Lome - - - + - - - + - - - +
Portland - - - + - - - - + + - +
Ruanda - - - + - - - - + - + +
TREGUIER - - - + - - - - + - - +
Simi - - - - + - - + - - + +
Weltevreden - - - - + - - + - - - +
Kristianstad - - - - + - - - + - + +
Biafra - - - - + - - - + - - +

Allelotyping PCR ile Belirlenen Tablo 3. Salmonella enterica Serovars

1 kalın vurgulanan serovars, daha yaygın olarak teşhis veya gıda mikrobiyolojisi laboratuvar tarafından karşılaşılan olanlar .
2 H2 PCR H2 alleli (1) ne olursa olsun, H2, flagellin sahip tüm Salmonella 1.5 kb Amplikon üretir. Bu PCR monofazik bifazik Salmonella ayırt etmek için kullanılır.
S. 3 Faj dönüşüm serovar İstanbul üretmek için enterica serovar Hadar değiştirir LPS O antijeni. O allelotyping PCR bu ince genetik / antijenik değişiklikler ayırt edemez.

Discussion

Salmonella cinsi (örn. invaziv) özgü hedefleri genlerin tespiti için piyasada bulunan PCR testleri. Ancak, tüm Salmonella insan ve hayvan popülasyonlarının prevalansı hastalığa neden yeteneklerini eşit. Salmonella LPS O-antijen ve flagellinH1 ve H2 antijenleri antijenik farklılıklar erken tanınması, bu antijenik farklılıklar üzerinde 2.500 serovars Salmonella farklılaşma yol açmıştır . Cinsi, Salmonella belirlenen 46 ayrı O antijenleri ve 86 ayrı flagellin (H) antijenleri vardır. Salmonella (H1) ya da iki farklı (H1, H2) flagellins sahip olabilir. O, H1, H2 antijenleri 2500 Salmonella serovars hesabı farklı bir birleşimi bugün kabul etti . Serovar belirlenmesi bireysel O ve H antijenleri elde edilen antijenik formül üzerinde olarak atanır. O antijenik formül olarak şöyle yazılabilir: H1: H2 ve burada "-" O-antijen için negatif Salmonella H1 veya H2 flagellin ve "NT" (tiplendirilemeyen) yokluğu anlamına gelir . Örneğin, bir S. serovar Typhimurium atanır 1,2 Enteritidis bir formülü D1 ile izole edilirken: i: enterica antijenik formül B ile izole g, m: -. Salmonella nüfusunun Bu nedenle PCR ile kolayca yararlanılabilir nükleotid düzeyde farklılıklar antijenik varyasyon dışa tezahürüdür.

Biz belirlenmesi S. allelotyping PCR geliştirmek için belirli O ve H alleller ile ilişkili genetik farklılıkları tespit enterica serovars: Enteritidis, Hadar, Heidelberg ve Typhimurium (3). Hadar (C2: z10: e, n, x), Heidelberg (B-H1: Salmonella serovar Enteritidis H2 antijenik formüller (D1:: g, m) doğru atama ve raporlama O ile ilişkili tüm alleller için test : r: 1,2) ve Typhimurium (B: i: 1,2). O aleli veya antijen, H1 g bulgu bilgisi olmadan, tek başına m allel mutlaka Salmonella Salmonella serovars olarak Enteritidis olarak izole tanımlamaz: Agona, California ve Montevideo, aynı zamanda bu aynı allel sahip. Allelotyping PCR başlangıçta ön plana Salmonella serovars belirtilen algılamak için tasarlanmış iken, bu test bir ek 19 serovars (Tablo 3) tanımlayabilirsiniz. Bizim allelotyping PCR aslında O ve H allel tespit etmek için tasarlanmıştır. Pratikte ise, bize değil, O-spesifik antiserumlar kullanılarak izole edilen Salmonella kültürleri ile çalışırken O allelotyping PCR performans, O-antijen slayt aglütinasyon testi ile tespit etmek için daha pratik ve uygun maliyetli hale gelmiştir. Ancak, laboratuvar (2) bir ekran veya Salmonella FTA kartları (6) teslim izole yazmak için bu PCR kullanıyorsa O allelotyping PCR yöntemi tavsiye ve numunelerin ilk ekran ile Salmonella-spesifik PCR (4 include .) Allelotyping PCR PCR veya biyokimyasal / antijen testleri Salmonella olarak tanımlanır sadece bu örnekleri sınırlayın.

Bu makalede açıklanan protokol Idaho Teknoloji Rapidcycler, bir çok ısıtma bloğu thermocyclers daha kısa sürede reaksiyon hacmi ve çalışan reaksiyon şartları küçültün sağlayan bir sıcak hava PCR ile kullanım için optimize edilmiştir. Ayarlayarak astar konsantrasyonları; veya MgCl 2 konsantrasyonları ayarlayarak bir ısıtma bloğu PCR ile kullanmak için bu protokol uyarlamak için tavlama sıcaklıkları düşürülmesi / yükseltilmesi deneysel reaksiyon koşulları optimize gerekebilir. Örneğin, MJ Research PTC-200 PCR aşağıdaki gibi protokol uyum sağlamak zorunda kalıyor. Tablo 1'de açıklanan aynı reaksiyon hacmi ile çalışma, çalışma stok concentrationof i astar set 2.5 mcM seyreltilir, tavlama sıcaklığı 55 ° C - 45 ° C ve inkübasyon denatürasyon kez, tavlama ve uzatma adımları düşürülmüştür i / g, m allelotyping PCR için 20 saniye kadar uzatılmış oldu. Yayınlanan protokoller de dahil olmak üzere herhangi bir PCR için başlangıç ​​yukarı ve optimizasyonu, uygun pozitif ve negatif kontroller gereklidir. Hadar (C2: z10: e, n, x), Heidelberg (B: r - Enteritidis (D1:: g, m) Biz özellikle Anatum (E1:: e, h 1,6), bilinen Salmonella serovars elde önermektedir. : 1,2), Montevideo (C1: g, m, s: 1,2,7) ve Typhimurium (B: i: 1,2) ve bir laboratuvar Escherichia coli K12 suşu (DH5α LE393, JM109, vb . sırasıyla bu makalede anlatılan allelotyping PCR testleri pozitif ve negatif kontrolleri gibi). Bu Salmonella serovars birkaç test edildiği allel bağlı olarak, pozitif veya negatif kontrol olarak hizmet verecek.

Bazı önlemler ve kurallar Bu ve diğer herhangi bir teşhis PCR yaparken takip edilmesi gerekir. İlk olarak, fiziksel ayırmaşablon hazırlama, PCR set-up ve jel elektroforezi mümkün PCR carry-over, kirlenme ve yanlış pozitif hatalı raporlama önlenmesinde kritik önem taşımaktadır. Ayrıca, bu kontroller olarak ortaya çıkan sorunları belirlemek ve sonuçları (5) yorumlanmasına yardımcı olarak gerekli kontrollerin dahil herhangi bir rutin PCR gereklidir. En önemlisi, tutarlılık Amplikon boyutu Amplikon (PCR ürünü) algılama andestimation elektroforetik koşulları açısından, özellikle önemlidir. Bu noktayı açıklamak için, biz bilerek Şekil 1A amaçlanan daha önceki elektroforez askıya aldı. Moleküler ağırlık standartları (şerit 1 ve 13) ve pozitif kontrol (2 şeritli), yeterince doğru boyutları tahmin ya da küçük boyutlarda farklılıklar vardır (~ 50 bp) DNA parçalarının ayrılması gözlemlemek için ayrılmış değildir. Yeterli DNA parçalarının ayrılması, özellikle moleküler ağırlık standartları, pozitif Amplikon boyutu ve bazen herhangi bir PCR (5 günlük çalışma gözlenen non-spesifik amplikonlarının ayırt "gerçek pozitif" doğru tahmin bağlıdır esastır .) Örneğin, Şekil 1B, şeritli 7 (boyut olarak ~ 700 bp) non-spesifik bir Amplikon vardır. Boya ön agaroz jel yarı yolda noktada sadece elektroforez, çok erken kesilmeli olsaydı, 500 bp ve 700 bp DNA parçalarının arasında çok az bir farklılaşma var olacaktır. Bu nedenle, örnek şeritli 7 yanlışlıkla i ve g, m allel hem de olumlu bildirilmiştir olurdu.

Son olarak, herhangi bir test ile ilgili sınırlamaları tanımak gerekir. 1,5, 1,6, 1,7 antijen kompleksi; e, n, x / e H2 1,2 ait alleller ince genetik farklılıkları ayırt etmek H1/H2 allelotyping PCR çeşitli ayrımcı güç yok? n, g, m allel Z15 antijen içeren karmaşık ve H1 G antijen kompleksi,. Bir ya da iki farklı epitoplar bu flagellar antijenleri bulunan amino asit değişiklikleri oluşturmaktadır. Bu nedenle bize flagellin gen sekansı (3), bu bazen tek bir baz çifti farklılıklar yararlanabilir primerler dizayn için zordu. Örneğin, Salmonella serovars Dublin (D1: g: p) ve Berta (D1: f, g, t:) primerler mallelotyping, g da PCR pozitif. Bradford (1,5: r B), Heidelberg (1,2 B: r), Lagos (: i 1,5 B) H2 allelotyping primerler Typhimurium (1,2: i B) ayırt edemez Glostrup'dan ikinci Winneba (B: r: 1,6), ya da Remo (C2: z10: e, n, Z15) (B: ​​r: 1,7), ya da Hadar (e, n, x C2: z10). Bu serovars karşılaşma ihtimalini de beraberinde getirir: Lagos, Bradford, Winneba, Remo veya Glustrup uzak bir olasılık ve ya testler sınırlama veya başka bir doğrulayıcı test feragatname sağlayan gerektirir.

Sonuç olarak, bu PCR tabanlı serotipleme hızla S. tanımlar enterica serovars Enteritidis, Hadar, Heidelberg ve Typhimurium ve O, H1 ve H2 allel 19 ek serovars ile ilişkilidir. Bu testte serotipleme Salmonella geleneksel mikrobiyolojik yaklaşım hızlı, düşük maliyetli bir alternatif.

Disclosures

Çıkar çatışması ilan etti.

Acknowledgments

Bu çalışma, ABD Tarım Bakanlığı Hibe 1999-35212-8680 2.005-01.378 ve 2010-04288-01, USDA Formula Fonları ve Gürcistan'ın Veterinerlik Tarımsal Araştırma Grant Devlet tarafından desteklenen olmuştur. Bu yayında açıklanan protokol yönettiği araştırma derslerin bir parçası olarak lisans öğrencileri tarafından kullanılmak için geliştirilmiştir: MIBO 4900L, GENE 4960H, BCMB 4960L, ve Georgia Üniversitesi BIOL 4960H ve Maurer birkaç moleküler epidemiyoloji araştırma projeleri öğrenciler tarafından kullanılan laboratuvar. Maurer ve Lee laboratuvarlar araştırmalar yapmış, pek çok lisans öğrencileri ve Bölüm Başkanı John Glisson araştırma ile lisans eğitimi bütünleştirmek için çabalarımızı desteklemek için teşekkür etmek istiyorum.

Materials

Name Company Catalog Number Comments
Luria Bertani Fisher Scientific (or any comparable source)
Microfuge tubes Fisher Scientific 1.5 ml capacity (or any comparable source)
Ethanol Fisher Scientific 200 proof (or any comparable source)
dH2O Sigma-Aldrich Molecular Biology Grade (or any comparable source; PCR only)
10 x PCR Buffer: Idaho Technologies 20 mM MgCl2 (buffer comes with BSA, Ficoll and Tartrazine)
30 mM MgCl2
40 mM MgCl2
PCR primers
DMSO
dNTP Roche Group (or any comparable source)
Taq DNA Polymerase Denville Scientific (or any comparable source)
Capillary pipettes Idaho Technologies 10 µl volume
Rapid Cycler Idaho Technologies
Agarose Bio-Rad Low EEO; Molecular Biology Grade (or any comparable source)
50 X TAE Buffer or 5X TBE Buffer Fisher Scientific (or any comparable source)
Ethidium bromide Bio-Rad (or any comparable source)
Horizontal, submersible gel electrophoresis chamber with gel mold Bio-Rad (or any comparable source)
Power supply Bio-Rad (or any comparable source)
Molecular Imager Gel Doc System Bio-Rad (or any comparable source)
Table 4. Materials

DOWNLOAD MATERIALS LIST

References

  1. Dauga, C., Zabrovskaia, A., Grimont, P. A. D. Restriction fragment length polymorphism analysis of some flagellin genes of Salmonella enterica. J. Clin. Microbiol. 36, 2835-2843 Forthcoming.
  2. Hong, Y., Liu, T., Lee, M. D., Hofacre, C. L., Maier, M., White, D. G., Ayers, S., Wang, L., Berghaus, R., Maurer, J. A rapid screen of broth enrichments for Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium using an allelotyping multiplex PCR that targets O and H antigen alleles. J. Food Prot. 72, 2198-2201 (2009).
  3. Hong, Y., Liu, T., Lee, H. ofacre, Maier, C. L., White, M., Ayers, D. G., Wang, S., Berghaus, L., R, M. aurer J.Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiol. (2008).
  4. Liu, T., Liljebjelke, K., Bartlett, E., Hofacre, C. L., Sanchez, S., Maurer, J. J. Application of nested PCR to detection of Salmonella in poultry environments. J. Food Prot. 65, 1227-1232 (2002).
  5. Maurer, J. J. Rapid detection and limitation of molecular techniques. Ann. Rev. Food Sci. Tech. 2, 259-279 (2011).
  6. Moscoso, H., Alvarado, I., Hofacre, C. L. Molecular analysis of infectious bursal disease virus from bursal tissues collected on FTA filter paper. Avian Dis. 50, 391-396 (2006).
  7. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning: a laboratory. 2nd ed, Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y. (1989).
  8. Wittwer, C. T., Fillmore, G. C., Hillyard, D. R. Automated polymerase chain reaction capillary tubes with hot air. Nucleic Acids Res. 17, 4353-4357 (1989).
Allelotyping belirlenmesi için bir PCR<em> Salmonella enterica</em> Serovars Enteritidis, Hadar, Heidelberg ve Typhimurium
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).More

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter