Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Ein Allelotyping PCR zur Identifizierung Salmonella enterica Serovare Enteritidis, Hadar, Heidelberg, und Typhimurium

doi: 10.3791/3130 Published: July 22, 2011

Summary

Wir beschreiben eine Multiplex-PCR zum schnellen Nachweis von Salmonella enterica Serovare Enteritidis, Hadar, Heidelberg, und Typhimurium. Spezifische Salmonella-Serovare können, indem sie auf einer Multiplex-PCR, um Gene und Sequenzen einzigartig für die O-Antigen-Biosynthese-Cluster und Flagellin eines bestimmten Serovar identifiziert werden. Serovar wird dann auf eine Salmonellen zugeordnet isolieren über das Auftreten von bestimmten, Größe Amplikons (PCR-Produkt), entsprechend dem Ziel Allel auf.

Abstract

Aktuelle kommerzielle PCRs Tests zur Identifizierung von Salmonella Zielgene einzigartig zu dieser Gattung. Allerdings gibt es zwei Arten, sechs Unterarten und über 2.500 verschiedene Salmonella Serovare, und nicht alle sind gleich in ihrer Bedeutung für die öffentliche Gesundheit. Zum Beispiel finden S. enterica Subspezies IIIa Arizona auf einem Tisch Ei-Schicht Betrieb ist unbedeutend im Vergleich zu der Isolierung von S. enterica Subspezies I Serovar Enteritidis, die führende Ursache von Salmonellose Zusammenhang mit dem Konsum von Konsumeiern. Serovare sind basierend auf antigene Unterschiede in Lipopolysaccharid (LPS) (O-Antigen) und Flagellin (H1 und H2-Antigene) identifiziert. Diese antigenen Unterschiede sind das äußere Erscheinungsbild der Vielfalt der Gene und Gen-Allele, die mit diesem Phänotyp assoziiert.

Wir haben eine allelotyping entwickelt, Multiplex-PCR, die Tasten auf genetische Unterschiede zwischen vier großen S. enterica Subspezies I Serovare bei Geflügel gefunden und verbunden mit erheblichen menschlichen Erkrankungen in den USA. Die PCR-Primerpaare wurden die wichtigsten Gene oder Sequenzen nur an einem bestimmten Salmonella Serovar und entwickelt, um ein Amplikon mit einer Größe spezifisch für das Gen oder Allel produzieren ausgerichtet. Salmonella Serovar ist es, eine auf der Kombination von PCR-Test-Ergebnisse für spezifische LPS-Isolat zugeordnet und Flagellin-Gen-Allele. Die Multiplex-PCRs in diesem Artikel beschrieben werden für den Nachweis von S. spezifischen enterica Subspezies I Serovare Enteritidis, Hadar, Heidelberg, und Typhimurium.

Hier zeigen wir, wie die Multiplex-PCRs zu verwenden, um Serovar für eine Salmonellen identifizieren, isolieren.

Protocol

1. Vorbereitung von PCR-Vorlage

Hinweis: Um PCR Verschleppung zu minimieren, ist es wichtig, einige wichtige wichtigsten Schritte in der PCR physikalisch voneinander getrennt zu halten: 1) Vorlage (DNA) Vorbereitung, 2) PCR-Setup, und 3) Gelelektrophorese. Es wird auch empfohlen, Barriere Tipps zu nutzen, um Kultur oder Reagenz Kontamination pipetters verhindern.

  1. Inoculate 1 ml Luria Bertani Brühe oder andere komplexe Medium (Brain Heart Infusion, Superbroth, etc.) mit Salmonella Isolat von einem einzelnen, isolierten Kolonie. Inkubieren Kultur über Nacht bei 37 ° C.
  2. Transfer 1 ml in eine sterile, 1,5 ml Mikrozentrifugenröhrchen, Zentrifuge der bakteriellen Zellsuspension bei 4.500 xg für ca. 2 min. zu Pellet-Zellen.
  3. Dekantieren, Zellpellet in 1 ml 100% Ethanol und stellen bei Raumtemperatur für 10 min. Pellet-Zellen wie zuvor (4.500 xg, 2 min.), Entfernen Sie den Überstand und die Zellen in 1 ml PBS.
  4. Centrifuge Zellen (4.500 xg, 2 min.), Überstand verwerfen und die Zellen in 1 ml sterilem dH 2 O.
  5. Verdünnen Sie die endgültigen Zellsuspension 1 / 20 in dH 2 O (5 μl/95 ul dH 2 O) und bei -20 ° C. Die Haltbarkeit der ganzen Zellen als PCR-Template bei -20 ° C wird etwa einen Monat.

2. PCR-Setup

Hinweis: Vorbereitung und Abgabe des PCR-Reaktionsmischung (Vorlage, Puffer, oligonucletoideprimers, Nukleotiden und Taq DNA Polymerase) muss in einem physisch getrennten Raum gewidmet und vorzugsweise erfolgt in einer PCR-/ UV-Workstation durchgeführt werden.

Hinweis: Die PCR einzurichten Raum muss auch mit einem bestimmten -20 ° C Tiefkühltruhe für die Lagerung von PCR-Reagenzien (Puffer, Oligonukleotid-Primer und Nukleotide), Enzyme und Vorlage in sich geschlossene, engagierte Pipette für die PCR-Setup, Einweg-Latexhandschuhe gesetzt , Laborkittel, Pipettenspitzen, Mikrotiterplatten, Glaskapillaren Mikrozentrifugenröhrchen und 10% Bleichmittel zur Dekontamination von Oberflächen. Verwenden Sie einen dedizierten Pipette-Set (P10, P100 und P1000), um PCR-Reagenzien zu verzichten. Diese Pipette einstellen müssen nie verlassen das Set-up-Workstation.

Hinweis: Erhalten Molekularbiologie oder PCR grade dH 2 O und 1 ml Aliquot in 1,5 ml Röhrchen. Dispense aliquotiert dH 2 O nach jedem Gebrauch, um mögliche Kreuzkontaminationen zu vermeiden. Ein ähnlicher Ansatz wird mit den anderen PCR-Reagenzien empfohlen.

Hinweis: Behandeln Sie den Arbeitsbereich vor der Anwendung mit UV-Beleuchtung und / oder Abwischen Oberflächen mit 10% Bleichmittel. Laborkittel tragen und Latex-Handschuhe bei der Durchführung PCR-Setup. Minimieren hin und her Datenverkehr von PCR-bis zu Gebieten, in denen die PCR-Reaktionen in der thermocylcer und PCR-Produkte (Amplikons) sind auf Agarosegelen getrennt inkubiert werden. Wenn Sie zurück in die PCR-up-Bereich gehen, der Paar Latexhandschuhe Sie derzeit tragen sind und auf ein neues Paar Handschuhe entsorgen.

  1. Machen Sie ein Master-Primer Lager in dH 2 O zu einer Konzentration von 5x10 -4 M. Verdünnen Sie die Primer 1 / 20 in dH 2 O (5 μl/95 ul dH 2 O, 25 M). Die Oligonukleotid-Sequenz für jedes Flagellin Eingabe Primer ist in Tabelle 1 beschrieben.
  2. Abrufen PCR-Reagenzien und Vorlage von -20 ° C Gefrierschrank und lassen Reagenzien und Proben zum Auftauen auf Eis. Verlassen Sie die Taq DNA Polymerase in Gefrierfach, bis sie benötigt.
  3. Dispense Reagenzien für die PCR-Reaktion allelotyping mischen, wie in Tabelle 1 beschrieben.
  4. Dispense 9μl der PCR-Reaktion-Mix in jeweils 10-förmigem Boden in eine sterile, 96-well, Polystyrol-Mikrotiterplatte, beginnend am oberen Rand der Spalte (zB A1) und bewegen Sie die Spalte an den Anfang der nächsten.
  5. Add 1 ul dH 2 O, um die 9 ul PCR-Mix (keine DNA-Steuerung) in die erste Vertiefung (A1), 0.5μl der positiven Kontrolle Vorlagen (i / g, m Tippen Primer-Typhimurium und Enteritidis, r/z10 Eingabe Primer-Heidelberg und Hadar; und 1,2 / e, n, x tippen Primer-Typhimurium und Hadar) bis 9 ul des PCR-Mix in der 2 nd gut (B1), und 1 ul Escherichia coli K12 DH5a die 9 ml PCR-Mix in der dritten und (C1).
  6. Für jede weitere gut (D1-H1; A2, B2), add 1 ul aufgetauten Proben Vorlage der 9 ul der PCR-Reaktion zu mischen. Für die i / g, m allelotyping PCR, S. enterica Serovar Typhimurium (i) und Enteritidis (g, m) dienen als positive Kontrollen und Salmonella-Serovare Heidelberg (r) und Hadar (z10) sind die positiven Kontrollen für die r / z 10 allelotyping Multiplex-PCR.
  7. Platz 10 ul Kapazität Glaskapillaren in dafür vorgesehenen Halterungen für die Idaho Technology Rapidcycler (8).
  8. einmal in der Halterung befestigt, laden jedes Glas mit der PCR-Reaktionsmischung Kapillare durch Berühren der Kapillare zurunteren Vertiefungen der Mikrotiterplatte. Kippen Sie die Halterung, damit die Flüssigkeit zu bewegen in den Schlauch und bieten Platz zwischen den Enden und der PCR-Mix vor Wärmeversiegelung die Glasröhren mit einem Butan-Fackel an beiden Enden der Kapillaren verschließen.
  9. Legen Sie die Kapillaren und Halter in den Idaho Technology Rapidcycler und verwenden Thermocycler-Programme in Tabelle 1 für die verschiedenen allelotyping beschriebenen Primer zur PCR-Lauf.
  10. Gehen Sie zur Gelelektrophorese Schritt, wenn das Thermocycler-Programm abgeschlossen ist.

3. Gel-Elektrophorese

Hinweis: Tragen Sie eine andere Laborkittel für die Verwendung in Elektrophorese-Labor bezeichnet und ein neues Paar Einweg-Latexhandschuhe.

Hinweis: Tragen Sie UV Schutzbrille Schutzbrille oder Gesichtsschutz und waren immer Handschuhe beim Umgang mit Ethidiumbromid, insbesondere Agarosegelen.

  1. Es werden 100 ml geschmolzenem 1,5% (w / v) Molekularbiologie Agarose in 1xTAE (oder 1X TBE) Elektrophorese-Puffer (7) durch wiederholtes Erhitzen der Agarose-Suspension in der Mikrowelle bei 20% Leistung für 2-5 min Abständen mit periodischen visuelle gesetzt Inspektion. Stellen Sie die geschmolzene Agarose in 60 ° C Wasserbad, bis es die Temperatur des Wasserbades im Gleichgewicht.
  2. Richten Sie die Gelform mit Kamm vor dem Gießen der geschmolzenen Agarose. Wählen Sie ein Gel Kamm mit genügend Zähne, um genügend Brunnen für Kontrollen, Proben, und mindestens 3 Molekulargewichts-Standards für ihre Platzierungen an den Enden und der Mitte des Agarosegel zu produzieren.
  3. Add 2 ul Ethidiumbromid (10 mg / ml) zu 100 ml geschmolzenem 1,5% (w / v) Agarose in 1xTAE (oder TBE), schwenken Flasche zu mischen, zu vermeiden Blasen entstehen, und gießen Sie leicht den Inhalt der Flasche in die Mitte des Gels Form für 15 von 10 cm Agarosegel. Verwenden Sie den Rand des Tissue-Papier oder ein Papiertuch, um Luftblasen in der Agarosegel zu entfernen.
  4. Lassen Sie das Gel Form bei Raumtemperatur bis Agarose erstarrt (~ 30-45 min) eingestellt. Übertragen Sie die Gelträger mit Gel & Kamm, um Tauch-, horizontale Elektrophorese-Kammer mit 1X TAE (oder 1X TBE) Elektrophorese-Puffer. Entfernen Sie vorsichtig den Kamm aus dem Agarosegel.
  5. Überprüfen Sie die Platzierung der Gelträger gegenüber der Kathode oder positive Pol der Elektrophoresekammer sicher sein, dieser Pol ist an der Unterseite des Gels. Hinweis: Denken Sie an die negativ geladenen DNA wandert in Richtung der Kathode (dh "ausführen, um red").
  6. Premix 200 ul DNA Molekulargewichtsmarker (0,25 ug / ul) mit 40 ul 6X DNA Loading Dye. Last 4,8 ul der vorgemischten DNA Molecular Weight Marker XIV des ersten, mittleren und letzten Brunnen.
  7. Legen Sie jeden der PCR-Proben beginnend mit gut 2 und Weiterentwicklung, um jede weitere gut, von links nach rechts. Vermeiden Sie das Laden der Probe in eine der Vertiefungen mit dem Molekulargewicht-Standard.
  8. So laden Proben in jedem Glaskapillare enthalten:
    1. Entfernen Sie jede Kapillare aus der Halterung und etch beiden Enden der Kapillare mit einem Glasschneider.
    2. Legen Sie Daumen und Zeigefinger beider Hände auf beiden Seiten der Kapillare durch die Glasschneider markiert und lassen Sie die Kapillare.
    3. Legen Sie die Kapillare Spender auf dem gegenüberliegenden Ende der PCR-Reaktion zu mischen und langsam den Kolben im Uhrzeigersinn, bis die Flüssigkeit am unteren Ende des Rohres.
    4. Legen Sie die Kapillare in den Brunnen zu beladen und langsam drehen Sie den Kolben im Uhrzeigersinn, um die Ficoll-Einwaage in die Agarose gut verzichten. Achten Sie darauf, Punktion der gut mit der Kapillare oder einführen, eine Luftblase in den Brunnen, indem zu viel Vergangenheit, als der letzte der Flüssigkeit verlässt die Kapillare.
  9. Nachdem alle Proben und Standards geladen sind, stellen Sie die konstante Spannung des Netzteils bis 90 V (9 Volt / cm Agarosegel).
  10. Unterbrechen Elektrophorese einmal den gelben Farbstoff (Taurazine) Front ist 1 cm von der Unterseite des Gels.
  11. Nach Elektrophorese beendet ist, übertragen Sie die Gel auf einem UV-Transilluminator mit DNA-Fragmenten und dem Molekulargewicht Standard zu visualisieren. Capture-Bild auf Polaroid-Film mit einer Polaroid-Kamera mit orangen Glasfilter (Einstellungen: 2 x und 4,5 y) oder als digitales Bild mit einer CCD-Kamera und Druckbild mit einem Thermodrucker.
  12. Legen Sie die Kapillare Inhaber in 10% Bleichmittel für 15-30 min. Spülen Sie 3-mal mit dH 2 O und Ort zurück in PCR Setup Zimmer an der Luft trocknen.

4. Vertreter Multiplex PCR Ergebnisse

Ergebnisse für allelotyping PCR von Salmonella-Isolaten 1-10 in Abbildung 1 (Bahnen 3-12) gezeigt und wie folgt interpretiert. Ein O-Allels Bezeichnung ist auf Salmonellen gegeben isolieren auf Amplikon (PCR-Produkt) passend in der Größe der PCR-Kontrolle basiert und für die O-Allel Primer vorhergesagt Sets verwendet (3): B-560bp, C1-340bp, C2-400 bp, D1-620 bp, und E1-280 bp. Für Isolate mit dem O allelotyping PCR (Abb. 1A), wir vergeben O Allele B (Bahnen 10 getestet -13), C1 (Spuren 7-9), C2 (Bahnen 4, 5), D1 (Spur 3) und E1 (Spur 6) zu den zehn Salmonella-Isolate getestet in den Spuren 3-12. Dieselben Salmonella-Isolate getestet wurden, in der gleichen Reihenfolge wie in Abb.. 1A, für H1-Allele i; g, m, r, und z10 (Abb. 1B, C). Wieder ein H1-Allel ist jede zugewiesene isolieren abhängig von der Anwesenheit eines Amplikons Matching in der Größe der PCR-Steuerung und für die 4 H1-Allel Primer vorhergesagt Sets verwendet (3): i-510 bp (Abb. 1B, Spur 2 ); g, m-310 bp (Abb. 1B, Spur 2); r-170 bp (Abb. 1C, Spur 2) und z10-360 bp (Abb. 1C, Spur 2). H1-Allele wurden zu einem der zehn Salmonella-Isolate zugeordnet: i - Isolaten 3 und 8 (Abb. 1B, Spuren 5 und 10); g, m-Isolaten 1 und 5 (Abb. 1B, Bahnen 3 und 7), r zu Isolaten 6 und 9 (Abb. 1C, Spur 8 und 11);. und z10 zu Isolaten 2, 7, und 10 (Abb. 1C, Spuren 4, 9, und 12) Salmonellen isolieren 4 wurde für die vier H1-Allele negativ getestet. Schließlich wurden Salmonella-Isolate mittels PCR für H2-Allele mit der 1,2 assoziiert getestet; 1,5; 1,6; 1,7 Antigen-Komplex und e, n, x, e, n, z15 Antigen-Komplex. Die Primer-Sets für die H2 1,2, 1,5, 1,6, 1,7 komplex und H2 e, n, x, e, n, z15 komplexen produzieren 290 bp und 150 bp Amplifikate, bzw. (3). Die Primer-Sets nicht unterscheiden kann, spezifische H2-Allele in beiden H2-Antigen-Komplex zu einer endgültigen Allel-Typ, ex zuweisen. 1,2, zu einer Isolierung (3) Salmonella-Isolate 4, 6, 8-10 positiv für H2-Allele mit H2 1,2 verbunden waren;. 1,5; 1,6; 1,7 Antigen-Komplex, während Isolate 2 und 7 wurden für H2-Allele mit e, n, x verbundene positive, e, n, z15 Antigen-Komplex (Daten nicht gezeigt). Während Salmonella-Isolate 1, 3 und 5 wurden für die beiden H2-Antigen-Komplexe negativ, nur vereinzelt 1 und 5 wurden für H2 Flagellin negativ, wie unter Verwendung eines generischen H2 Flagellin PCR (1) (Daten nicht gezeigt). Diese Ergebnisse sind in Tabelle 2 zusammen mit dem mutmaßlichen Salmonella Serovar zugeordnet jedes Isolat zusammengefasst.

Abbildung 1
Abbildung 1. Multiplex PCR zur ​​Identifizierung spezifischer O-und H-Allele mit S. Assoziierte enterica Serovare Enteritidis, Hadar, Heidelberg, und Typhimurium. (A) O Allele Multiplex PCR. (B, C) H1 Allele Multiplex PCR zur Identifizierung Flagellin Allele: i / g, m (B) und r/z10 (C). Lanes 1 und 13: 100 bp Leiter (Promega; Madison, WI), Spur 2: Multiplex-PCR-Kontrollen für O-Allele B, C1, C2, D1 und E (A), Allele H1 i / g, m (B), und H1-Allele r/z10 (C); und Gassen 3-12: Salmonella-Isolate 1-10 (Tabelle 2).

PCR Master Mix Thermocycler (Rapidcycler)
Reagenzien Zusammensetzung / Konzentration Betrag   Parameters Erwartete Größe
H1 i / g, m
dH 2 O 63 ul Programm 1 94 ° C für 1 min
10x PCR-Puffer 20 mM MgCl 2 10 pl Programm 2 94 ° C für 1 s
500 mM Tris pH 8 55 ° C für 1 s
2,5 mg / ml BSA 72 ° C für 20 s
5% Ficoll 400 Für 40 Zyklen
10 mMTartrazine Slope = 2,0
Primer i (f) * AACGAAATCAACAACAACCTGC 2 ul Programm 3 72 ° C für 4 min 510 bp
Primer i (r) * TAGCCATCTTTACCAGTTCCC 2 ul
Primer g, m (f) * GCAGCAGCACCGGATAAAG 2 ul 310 bp
Primer g, m (r) * CATTAACATCCGTCGCGCTAG 2 ul
DMSO 5 pl
dNTP 10 mM 2 ul
Taq 5 Einheiten / ul 2 ul
90 ul
H1 r / z 10
dH 2 O 55 ul Programm 1 94 ° C für 1 min
10x PCR-Puffer 30 mM MgCl 2 10 pl Programm 2 94 ° C für 1 s
500 mM Tris pH 8 55 ° C für 1 s
2,5 mg / ml BSA 72 ° C für 20 s
5% Ficoll 400 Für 40 Zyklen
10 mMTartrazine Slope = 2,0
Primer r (f) * CCTGCTATTACTGGTGATC 4μl Programm 3 72 ° C für 4 min 170 bp
Primer r (r) * GTTGAAGGGAAGCCAGCAG 4μl
Primer z 10 (f) * GCACTGGCGTTACTCAATCTC 4μl 360 bp
Primer z 10 (r) * GCATCAGCAATACCACTCGC 4μl
DMSO 5 pl
dNTP 10 mM 2 ul
Taq 5 Einheiten / ul 2 ul
90 ul
PCR Master Mix Thermocycler (Rapidcycler)
Reagenzien Zusammensetzung / Konzentration Betrag   Parameters Erwartete Größe
H2 1,2 / e, n, x
dH 2 O 63,6 ul Programm 1 94 ° C für 1 min
10x PCR-Puffer 20 mM MgCl 2 10 pl Programm 2 94 ° C für 1 s
500 mM Tris pH 8 55 ° C für 1 s
2,5 mg / ml BSA 72 ° C für 20 s
5% Ficoll 400 Für 40 Zyklen
10 mMTartrazine Slope = 2,0
Primer 1,2 (f) * AGAAAGCGTATGATGTGAAA 2 ul Programm 3 72 ° C für 4 min 290 bp
Primer 1,2 (r) * ATTGTGGTTTTAGTTGCGCC 2 ul
Primer e, n, x (f) * TAACTGGCGATACATTGACTG 2 ul 150 bp
Primer e, n, x (r) 1 TAGCACCGAATGATACAGCC 2 ul
DMSO 5 pl
dNTP 10 mM 2 ul
Taq 5 Einheiten / ul 2 ul
90 ul
Generische H2
dH 2 O 72 ul Programm 1 94 ° C für 1 min
10x PCR-Puffer 30 mM MgCl 2 10 pl Programm 2 94 ° C für 10 s
500 mM Tris pH 8 45 ° C für 10 s
2,5 mg / ml BSA 72 ° C für 35 s
5% Ficoll 400 Für 40 Zyklen
10 mMTartrazine Slope = 2,0
Primer fljB (f) * CAAGTAATCAACACTAACAGTC 2 ul Programm 3 72 ° C für 4 min 1.500 bp
Primer fljB (r) * TTAACGTAACAGAGACAGCAC 2 ul
dNTP 10 mM 2 ul
Taq 5 Einheiten / ul 2 ul
90 ul

Tabelle 1. Protokoll für Salmonellen flagellinallelotyping PCR: Zusammensetzung, Bedingungen und erwarteten Ergebnisse.

* Die Arbeitsgruppe Lager Konzentration der PCR-Oligonukleotid-Primer ist 25 uM

Isolieren O Allele H1 Allele H2 Allele Serovar
  B C1 C2 D1 E ich g, m r z10 1,2, 1,5, 1,6, 1,7 e, n, x, e, n, z15 Generische 1  
1 - - - + - - + - - - - - Enteritidis
2 - - + - - - - - + - + + Hadar / Istanbul 3
3 - - + - - + - - - - - + Kentucky
4 - - - - + - - - - + - + Unbekannt
5 - + - - - - + - - - - - Montevideo
6 - + - - - - - + - + - + Infantis oder Virchow 2
7 - + - - - - - - + - + + Mbandaka
8 + - - - - + - - - + - + Typhimurium
9 + - - - - - - + - + - + Heidelberg
10 + - - - - - - - + + - + Haifa

Tabelle 2. Allelotyping PCR Ergebnisse (Abb. 1) und Salmonella Serovar Bezeichnung auf der Identifizierung von O, H1 und H2 Allelen

> 1 H2 PCR erzeugt ein 1,5 kb Amplikon für alle Salmonella besitzen H2 Flagellin, unabhängig von H2-Allels (1). Diese PCR wird verwendet, um monophasischen aus der zweiphasigen Salmonellen zu unterscheiden.
1,5;; 1,6; 1,7 Antigen-Komplex (3) 2 H2 Multiplex-PCR kann nicht zwischen den verschiedenen Allele für die H2 1,2 unterscheiden.
3 Phage Umwandlung von S. enterica Serovar Hadar verändert LPS O Antigen Serovar Istanbul produzieren. Die O allelotyping PCR kann nicht erkennen, diese subtilen genetischen / antigenen Veränderungen.

Serovar 1 O Allele H1 Allele H2 Allele
  B C1 C2 D1 E ich g, m r z10 1,2, 1,5, 1,6, 1,7 e, n, x, e, n, z15 Generische 2
Kalifornien + - - - - - + - - - - -
Typhimurium + - - - - + - - - + - +
Heidelberg + - - - - - - + - + - +
Haifa + - - - - - - - + + - +
Montevideo - + - - - - + - - + - +
Othmarschen - + - - - - + - - - - -
Athinai - + - - - + - - - - + +
Papuana - + - - - - - + - - + +
Mbandaka - + - - - - - - + - + +
Chincol - - + - - - + - - - + +
Kentucky - - + - - + - - - - - +
Hadar / Istanbul 3 - - + - - - - - + - + +
Enteritidis - - - + - - + - - - - -
Seremban - - - + - + - - - + - +
Campinense - - - + - - - + - - + +
Lome - - - + - - - + - - - +
Portland - - - + - - - - + + - +
Ruanda - - - + - - - - + - + +
Treguier - - - + - - - - + - - +
Simi - - - - + - - + - - + +
Weltevreden - - - - + - - + - - - +
Kristianstad - - - - + - - - + - + +
Biafra - - - - + - - - + - - +

Tabelle 3. Salmonella enterica Serovare von Allelotyping PCR identifiziert

1 Die Serovare in Fettdruck hervorgehoben sind diejenigen, häufiger von Diagnose-oder Lebensmittel-Mikrobiologie-Labor gestoßen.
2 H2 PCR erzeugt ein 1,5 kb Amplikon für alle Salmonella besitzen H2 Flagellin, unabhängig von H2-Allels (1). Diese PCR wird verwendet, um monophasischen aus der zweiphasigen Salmonellen zu unterscheiden.
3 Phage Umwandlung von S. enterica Serovar Hadar verändert LPS O Antigen Serovar Istanbul produzieren. Die O allelotyping PCR kann nicht erkennen, diese subtilen genetischen / antigenen Veränderungen.

Discussion

Die meisten kommerziell verfügbaren PCR-Tests für den Nachweis von Salmonella Ziele Gene einzigartig für die Gattung (zB Invalidität). Allerdings sind nicht alle Salmonella gleich in ihrer Fähigkeit, Krankheiten an Menschen oder Prävalenz in Tierpopulationen verursachen. Frühzeitige Erkennung von antigenen Unterschiede in Salmonella LPS O-Antigen und flagellinH1 und H2-Antigene hat zur Differenzierung von Salmonella in mehr als 2.500 Serovare auf diesen antigene Unterschiede. Es gibt 46 verschiedene O-Antigene und 86 verschiedene Flagellin (H)-Antigene in der Gattung Salmonella identifiziert. Salmonella kann man (H1) oder zwei verschiedene (H1 & H2) Flagellin besitzen. Die andere Kombination von O, H1, H2 und Antigenen für die 2.500 Salmonella-Serovare heute anerkannt. Ein Serovar wird auf Basis der antigenen Formel aus der Identifizierung der einzelnen O-und H-Antigene gewonnen zugeordnet. Die antigenen Formel ist wie O geschrieben: H1: H2, und wo "-", bezieht sich auf das Fehlen von H1 oder H2 Flagellin und "NT" (nicht-typisierbaren) für Salmonellen negativ für die O-Antigen. Zum Beispiel ist der Serovar Typhimurium eine S. zugeordnet enterica Isolat mit der antigenen Formel B: i: 1,2, während Enteritidis eine mit der Formel D1 isolieren gegeben ist: g, m: -. Dieses Antigen-Variation in der Salmonella Bevölkerung ist die äußere Manifestation von Unterschieden bei der Nukleotid-Ebene, daher leicht durch PCR genutzt werden.

Wir haben die genetischen Unterschiede mit spezifischen O-und H-Allele assoziiert zu einem allelotyping PCR zur ​​Identifizierung von S. zu entwickeln identifiziert enterica Serovare: Enteritidis, Hadar, Heidelberg, und Typhimurium (3). Die richtige Zuordnung und Berichterstattung von Salmonella Serovar erfordert die Prüfung für alle Allele, die mit O verbunden: H1: H2 antigenen Formeln für Enteritidis (D1: g, m: -), Hadar (C2: z10: e, n, x), Heidelberg (B : r: 1,2), und Typhimurium (B: i: 1,2). Ohne Kenntnis der O-Allels oder Antigen, die Feststellung des H1 g, hat m-Allels allein nicht unbedingt identifizieren Salmonella Enteritidis als andere Salmonella-Serovare isoliert: Agona, Kalifornien, und Montevideo, besitzen auch die gleiche Allel. Während die allelotyping PCR ursprünglich entworfen wurde, um zu erkennen in den Vordergrund genannten Salmonella-Serovare, kann dieser Test identifizieren zusätzliche 19 Serovare (Tabelle 3). Unsere allelotyping PCR wurde ursprünglich entwickelt, um O-und H-Allele zu erkennen. In der Praxis hat es sich mehr praktische und kostengünstige für uns die O-Antigen, das durch Objektträgeragglutination Test zu identifizieren, mit O-spezifischen Antiseren, anstatt die O allelotyping PCR bei der Arbeit mit isolierten Salmonella Kulturen. Aber wir empfehlen die Verwendung der O allelotyping PCR, wenn Ihr Labor verwendet diese PCR als Bildschirm (2) oder zur Eingabe von Salmonellen auf FTA-Karten (6) isoliert eingereicht, und verfügen über eine Salmonellen-spezifische PCR mit dem ersten Bildschirm von Proben (4 ). Begrenzen Sie die allelotyping PCRs, nur die Proben, die als Salmonella durch PCR oder biochemische / antigenen Tests identifiziert werden.

Das Protokoll in diesem Artikel beschrieben wird ist für den Einsatz mit dem Idaho Technology Rapidcycler, ein Heißluft-Thermocycler, dass man zu verkleinern Reaktionsvolumina und läuft Reaktionsbedingungen in weniger Zeit als viele Heizblock Thermocycler ermöglicht optimiert. Zur Anpassung dieses Protokoll für die Verwendung mit einem Heizblock Thermocycler kann verlangen, Optimierung von Reaktionsbedingungen empirisch durch Absenken / Anheben Glühtemperaturen; Anpassung Primer-Konzentration oder Einstellung MgCl 2-Konzentrationen. Zum Beispiel mussten wir das Protokoll für die MJ Research PTC-200 Thermocycler wie folgt anzupassen. Arbeiten mit der gleichen Reaktion Bände in Tabelle 1 beschrieben, die Arbeiterklasse Lager concentrationof der i-Primer-Satzes auf 2,5 pM verdünnt war, wurde die Annealingtemperatur von 55 ° C bis 45 ° C und Inkubationszeiten bei der Denaturierung, Annealing und Extension Schritten gesenkt wurde auf 20 s für die i / g, m allelotyping PCR verlängert. Nach der entsprechenden positiven und negativen Kontrollen werden in der ersten Inbetriebnahme und Optimierung für jedes PCR, einschließlich veröffentlichten Protokollen von wesentlicher Bedeutung. Wir empfehlen den Erwerb bekannten Salmonella-Serovare, die speziell Anatum (E1: e, h: 1,6), Enteritidis (D1: g, m: -), Hadar (C2: z10: e, n, x), Heidelberg (B: r : 1,2), Montevideo (C1: g, m, s: 1,2,7) und Typhimurium (B: i: 1,2) sowie ein Labor Escherichia coli K12-Stamm (DH5a, LE393, JM109, etc. ) als positive und negative Kontrollen jeweils für die allelotyping PCR-Tests in diesem Artikel beschrieben. Mehrere dieser Salmonella-Serovare als entweder positiv oder negativ Kontrollen dienen, je nachdem, welches Allel getestet.

Bestimmte Vorsichtsmaßnahmen und Richtlinien müssen befolgt während der Durchführung dieser und anderen diagnostischen PCR werden. Erstens die räumliche Trennungder Vorlage Vorbereitung, Aufbau PCR und Gelelektrophorese ist von entscheidender Bedeutung bei der Verhinderung möglich PCR carry-over Kontamination und fehlerhafte Berichterstattung der Falsch-Positiven. Darüber hinaus ist die Einbeziehung der entsprechenden Kontrollen notwendig in jeder Routine PCR wie diese Kontrollen Probleme zu identifizieren, wie sie entstehen und helfen bei der Interpretation der Ergebnisse (5). Am wichtigsten ist, ist die Konsistenz wichtig, insbesondere im Hinblick auf die elektrophoretische Bedingungen für Amplikons (PCR-Produkt) Detektion andestimation von Amplicongröße. Um dies zu verdeutlichen, haben wir absichtlich ausgesetzt Elektrophorese früher als in 1A gedacht. Das Molekulargewicht-Standards (Spuren 1 und 13) und der positiven Kontrolle (Spur 2) sind nicht ausreichend getrennt, um genau zu schätzen Größen oder beobachten Trennung von DNA-Fragmenten, wo es kleine Unterschiede (~ 50 bp) in den Größen. Ausreichende Trennung von DNA-Fragmenten, insbesondere das Molekulargewicht-Standards ist notwendig, da die Berichterstattung Positive ist abhängig von der genauen Schätzung der Amplikon Größe und die Unterscheidung zwischen "richtig positiv" aus nicht-spezifischen Amplikons, die manchmal in den täglichen Ablauf einer PCR (5 eingehalten werden ). Zum Beispiel gibt es eine nicht-spezifische Amplikon in Abbildung 1B, Spur 7 (~ 700 bp groß). Hätte Elektrophorese zu früh, abgesetzt werden, wenn der Farbstoff vor nur auf dem halben Weg Punkt im Agarosegel, gäbe es wenig Unterschied zwischen 500 bp und 700 bp DNA-Fragmente werden. Daher würde Probe in Spur 7 irrtümlich gemeldet haben, als positiv für beide i und g, m-Allele.

Schließlich muss man die Grenzen bei jedem Test assoziiert zu erkennen. Mehrere der H1/H2 allelotyping PCR nicht die Trennschärfe, um subtile genetische Unterschiede in Allele aus der H2 1,2 erkennen; 1,5; 1,6; 1,7 Antigen-Komplex; e, n, x / e , n, z15 Antigen-Komplex und dem H1 G-Antigen-Komplex, der die g, m-Allel enthält. Ein oder zwei Aminosäure-Veränderungen Rechnung für die unterschiedliche Epitope in diesen Flagellen-Antigene zu präsentieren. Es war daher schwierig für uns, Grundierungen, dass diese manchmal einzigen Basenpaar Unterschiede in der Flagellin Gensequenz (3) ausgenutzt werden könnte, um Design. Zum Beispiel Salmonella-Serovare Dublin (D1: g, p: -) - sind auch PCR-positiv mit unserem g, mallelotyping Grundierungen und Berta (D1:: f, g, t). Die H2 allelotyping Primer nicht unterscheiden kann, Typhimurium (B: i: 1,2) aus Lagos (B: i: 1,5), Heidelberg (B: r: 1,2) aus Bradford (B: r: 1,5), Winneba (B: r: 1,6), oder Remo (B: r: 1,7), oder Hadar (C2: z10: e, n, x) aus Glostrup (C2: z10: e, n, z15). Zwar ist die Wahrscheinlichkeit der Begegnung mit einigen dieser Serovare: Lagos, Bradford, Winneba, Remo oder Glustrup remote ist, ist es eine Möglichkeit und erfordert entweder die Bereitstellung Disclaimer auf der Prüfungen "Beschränkung oder anderen Bestätigungstest.

Im Ergebnis dieser PCR-basierten Serotypisierung schnell identifiziert S. enterica Serovare Enteritidis, Hadar, Heidelberg und Typhimurium und O, H1 und H2-Allele mit 19 zusätzlichen Serotypen assoziiert. Dieser Assay ist eine schnelle, kostengünstige Alternative zu herkömmlichen mikrobiologischen Ansatz zur Serotypisierung Salmonella.

Disclosures

Keine Interessenskonflikte erklärt.

Acknowledgments

Diese Arbeit wurde von USDA Grants 1999-35212-8680, 2005-01378 und 2010-04288-01, USDA Formula Funds und dem Staat Veterinärmedizin Georgiens Agricultural Research Grant unterstützt. Das Protokoll in dieser Publikation beschrieben wurde für den Einsatz von Studenten im Rahmen der gezielten Forschung Kurse entwickelt: MIBO 4900L, GENE 4960H, BCMB 4960L und BIOL 4960H an der University of Georgia und wird von den Schülern auf verschiedene molekulare Epidemiologie Forschungsprojekte in den Maurer Labor. Wir wollen die vielen Studenten, die Forschung geleistet haben, Maurer und Lee Labors und unserer Abteilung Stuhl, John Glisson für die Unterstützung unserer Bemühungen, Bachelor-Anweisung mit der Forschung zu integrieren danken.

Materials

Name Company Catalog Number Comments
Luria Bertani Fisher Scientific (or any comparable source)
Microfuge tubes Fisher Scientific 1.5 ml capacity (or any comparable source)
Ethanol Fisher Scientific 200 proof (or any comparable source)
dH2O Sigma-Aldrich Molecular Biology Grade (or any comparable source; PCR only)
10 x PCR Buffer: Idaho Technologies 20 mM MgCl2 (buffer comes with BSA, Ficoll and Tartrazine)
30 mM MgCl2
40 mM MgCl2
PCR primers
DMSO
dNTP Roche Group (or any comparable source)
Taq DNA Polymerase Denville Scientific (or any comparable source)
Capillary pipettes Idaho Technologies 10 µl volume
Rapid Cycler Idaho Technologies
Agarose Bio-Rad Low EEO; Molecular Biology Grade (or any comparable source)
50 X TAE Buffer or 5X TBE Buffer Fisher Scientific (or any comparable source)
Ethidium bromide Bio-Rad (or any comparable source)
Horizontal, submersible gel electrophoresis chamber with gel mold Bio-Rad (or any comparable source)
Power supply Bio-Rad (or any comparable source)
Molecular Imager Gel Doc System Bio-Rad (or any comparable source)
Table 4. Materials

DOWNLOAD MATERIALS LIST

References

  1. Dauga, C., Zabrovskaia, A., Grimont, P. A. D. Restriction fragment length polymorphism analysis of some flagellin genes of Salmonella enterica. J. Clin. Microbiol. 36, 2835-2843 Forthcoming.
  2. Hong, Y., Liu, T., Lee, M. D., Hofacre, C. L., Maier, M., White, D. G., Ayers, S., Wang, L., Berghaus, R., Maurer, J. A rapid screen of broth enrichments for Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium using an allelotyping multiplex PCR that targets O and H antigen alleles. J. Food Prot. 72, 2198-2201 (2009).
  3. Hong, Y., Liu, T., Lee, H. ofacre, Maier, C. L., White, M., Ayers, D. G., Wang, S., Berghaus, L., R, M. aurer J.Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiol. (2008).
  4. Liu, T., Liljebjelke, K., Bartlett, E., Hofacre, C. L., Sanchez, S., Maurer, J. J. Application of nested PCR to detection of Salmonella in poultry environments. J. Food Prot. 65, 1227-1232 (2002).
  5. Maurer, J. J. Rapid detection and limitation of molecular techniques. Ann. Rev. Food Sci. Tech. 2, 259-279 (2011).
  6. Moscoso, H., Alvarado, I., Hofacre, C. L. Molecular analysis of infectious bursal disease virus from bursal tissues collected on FTA filter paper. Avian Dis. 50, 391-396 (2006).
  7. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning: a laboratory. 2nd ed, Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y. (1989).
  8. Wittwer, C. T., Fillmore, G. C., Hillyard, D. R. Automated polymerase chain reaction capillary tubes with hot air. Nucleic Acids Res. 17, 4353-4357 (1989).
Ein Allelotyping PCR zur Identifizierung<em> Salmonella enterica</em> Serovare Enteritidis, Hadar, Heidelberg, und Typhimurium
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).More

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter