Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

Isolierung und Kultivierung humaner Zellen pilzförmige Papillen Geschmack

doi: 10.3791/3730 Published: May 17, 2012

Summary

Wir wollten eine reproduzierbare Protokoll für die Isolierung und die Pflege langfristiger Kulturen von humanen pilzförmigen Papillen Geschmack Zellen zu entwickeln. Zellen aus menschlichen fungiformen Papillen durch Biopsie gewonnen wurden erfolgreich in der Kultur mehr als acht Durchgängen (12 Monate) aufrecht erhalten, ohne Verlust der Lebensfähigkeit.

Abstract

Geschmack Zellen sind hoch spezialisierte, mit einzigartigen histologischen, molekularen und physiologischen Eigenschaften, die den Nachweis einer Vielzahl von einfachen und komplexen Reize chemische Moleküle in Nahrungsmitteln enthalten ermöglichen. In der menschlichen, individuellen fungiformen Papillen enthalten von null bis zu 20 Geschmacksknospen. Es gibt keine festgelegten Protokoll zur Kultivierung von Zellen menschlichen Geschmack, obwohl die Fähigkeit, Geschmack Papillen Zellen in Kultur für mehrere Zyklen Zelle aufrechtzuerhalten wäre von großem Nutzen für die Charakterisierung der molekularen, regenerative und funktionellen Eigenschaften dieser einzigartigen Sinneszellen sein. Frühere Studien des Geschmacks-Zellen wurden unter Verwendung frisch isolierten Zellen in Primärkultur, Explantatkulturen von Nagern, oder semi-intakten Geschmacksnerven in Gewebeschnitten 1,2,3,4. Obwohl jedes dieser Präparate hat Vorteile, wäre die Entwicklung von langfristigen Kulturen erhebliche Vorteile zur Verfügung gestellt haben, insbesondere für Studien des Geschmacks Zellproliferation und verschierenzierung. Mehrere Gruppen, einschließlich der unsrigen, waren interessiert an der Entwicklung und Etablierung von Zellkultur-Modellen Geschmack. Die meisten Versuche, Kultur Geschmack Zellen haben begrenzte Lebensfähigkeit berichtet, die mit Zellen in der Regel nicht dauerhaft über 3-5 d 5,6,7,8. Vor kurzem berichteten wir auf ein erfolgreiches Verfahren für die verlängerte Kultur von Nagetier Geschmack Zellen 9. Wir berichten hier zum ersten Mal die Etablierung eines in vitro-Kultur-System für isolierte menschliche Zellen pilzförmige Papillen Geschmack. Zellen aus menschlichen fungiformen Papillen durch Biopsie gewonnen wurden erfolgreich in der Kultur mehr als acht Durchgängen (12 Monate) aufrecht erhalten, ohne Verlust der Lebensfähigkeit. Zellen zeigten viele molekulare und physiologische Merkmale charakteristisch für reife Geschmack Zellen. Gustducin und Phospholipase C β2, (PLC-β2) mRNA wurden in vielen Zellen durch reverse Transkriptase-Polymerase-Kettenreaktion festgestellt und bestätigt durch Sequenzierung. Immunzytochemie Analyse zeigte die Anwesenheit von Böducin und PLC-β2-Expression in kultivierten Zellen Geschmack. Kultivierte humane fungiformes Zellen zeigten auch Erhöhung des intrazellulären Calcium in Reaktion auf die entsprechenden Konzentrationen von mehreren Geschmacksreize anzeigt, dass Geschmacksrezeptoren und wenigstens einige der Signalwege vorhanden waren. Diese Ergebnisse zeigen, dass genügend Geschmack Zellen von erwachsenen Menschen erzeugt und aufrechterhalten werden für mindestens acht Passagen. Viele der Zellen behalten physiologischen und biochemischen Merkmale von akut isolierten Zellen aus dem erwachsenen Geschmack Epithel auf ihre Verwendung als Modell Geschmack zu unterstützen. Dieses System ermöglicht weitere Untersuchungen der Prozesse in der Proliferation, Differenzierung und Funktion von Säuger-Zellen-Rezeptor-Geschmack in einem In-vitro-Herstellung beteiligt.

Menschliche pilzförmige Papillen Geschmack für den Aufbau menschlicher fungiformen Zellkultur verwendet wurden, für die Forschung nach einer ordnungsgemäßen Einwilligung unter Forschung Protokolle, die gespendet wurden bewertetund durch den IRB Ausschuss genehmigt. Das Protokoll (# 0934) wurde von Schulman Associates Institutional Review Board Inc., Cincinnati, OH genehmigt. Geschrieben Protokoll unten auf der veröffentlichten Parameter durch Ozdener et al basiert. 2011 10.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Gewinnung von humanen pilzförmigen Papillen Geschmack

  1. Nehmen Sie vier Minuten vor acht Menschen pilzförmige Papillen Geschmack von der Dorsalfläche des vorderen Teils der Zunge mit gebogenen Feder Mikroschere.
  2. Unmittelbar in eine isolierte Lösung (26 mM NaHCO 3, 2,5 mM NaH 2 PO 4, 20 mM Glucose, 65 mM NaCl, 20 mM KCl und 1 mM EDTA in der Nuclease-freiem Wasser und sterilfiltriert).

2. Menschliche pilzförmige Papillen Geschmack Verdauung

Menschliche pilzförmige Papillen Geschmack Zelle getrennt werden kann mit zwei verschiedenen Protokollen enzymatische Verdauung mit kleinen Unterschieden.

  1. Inkubieren fungiformen Papillen in Isolation Lösung mit Pronase (1 mg / ml, Sigma Aldrich) und Elastase (1 mg / ml Sigma Aldrich) bei Raumtemperatur für 30-45 min (Protokoll 1).
  2. Inkubieren fungiformen Papillen mit Kollagenase Typ I (550 U / mL, von Worthington) + Elastase (10 U / ml, von Würzehington) + Trypsin-Inhibitor (0,9 mg / mL, von Worthington) in 2 ml Kalzium Ringerlösung in 35 ° C Wasserbad mit Umwälzung für 30 Minuten und schonende Oxygenierung mit 95% O 2/5% CO 2. (Alternative Methode zur Verdauung, Protokoll 2)
  3. Nach der Inkubation waschen Papillen mit Klingel und verreiben Sie die Papillen mit Feuer poliertes Glas Pasteur Pipette für 10-mal.
  4. Zentrifugieren Sie es für 3 Minuten bei 2500 rpm bei RT und entfernen Isolation Lösung und 1 ml Geschmack Zellkulturmedium.
  5. Übertragen verdaut fungiformen Papillen in Glasschale.
  6. Sezieren fungiformen Papillen sanft mit chirurgischen Rasiermesser.
  7. Fügen Sie 250 ul seziert Papillen in Klonen Zylinder auf Rattenschwanz Kollagen Typ-1 beschichteten Deckglas.
  8. 1 ml der Geschmack Zellkulturmedium in jedes Well.

3. Kultivierung von humanen pilzförmigen Papillen Geschmack Cells

  1. Inkubieren Platte bei 36 ° C in einer befeuchtetenInkubator mit 5% CO 2.
  2. Platzieren in einem Inkubator ungestört von 2 Tagen vor der ersten Änderung des Vollmedium. Geschmackszellen wird schließlich zu der beschichteten Deckgläschen zu binden, obwohl dies nicht deutlich sichtbar in 1 bis 3 Tagen.
  3. Entfernen Sie das Klonen von Platten-und Zylinder-Medium komplett und 1 ml Geschmack Zellmedium in jedes Well.
  4. Ersetzen 1/3 der mittleren alle 6-7 Tage. Ändern Sie nicht öfter Medium und / oder vollständig.
  5. Überprüfen Sie das Zellwachstum unter dem Mikroskop jeden zweiten Tag. Die meisten der neuen Zellen wachsen unter Zellhaufen. Zellhaufen in der Regel nach 2-3 Wochen in Kultur Verlassen der neu generierten Zellen zu lösen.
  6. Sobald 40-50% des Klonens Zylinder wird in den Ausbau der Geschmack Zellen bedeckt, trypsinieren Zellen mit 0,25% w / v Trypsin / EDTA für 2-3 Minuten bei 36 ° C
  7. Übertragen Zellen aus Brunnen in 15 ml Röhrchen, fügen Sie 3 Bände des Geschmacks Zellkulturmedium durch Zentrifugation bei 3000 rpm für 5 Minuten bei Raumtemperatur folgtetur.
  8. Überstand entfernen und Resuspendieren Sie die Zellen mit 1 ml Geschmack Zellmedium.

4. Propagation of Human pilzförmige Papillen Geschmack Cells

  1. Übertragen Sie Zellen in T25-Platte und 4 ml Geschmack Zellmedium (Passage 0). Pflegen Zellen bei 36 ° C in einem befeuchteten Inkubator mit 5% CO 2.
  2. Ersetzen Sie 1/3 des Mediums alle 6-7 Tage bis zum kultivierten Zellen Geschmack 100% Konfluenz erreicht haben. Zu diesem Zeitpunkt, zu schmecken Zellen zu ernten aktivieren, waschen Sie die Zellen einmal mit sterilem PBS dann trypsinieren Zellen unter Verwendung von 0,25% w / v Trypsin / EDTA für 2-3 Minuten bei 36 ° C
  3. Nach Zentrifugation wie oben beschrieben, um die ganze Geschmack Zellmedium und Transfer Zellen in frisches T-75 Flaschen (Kanal 1) zu resuspendieren.
  4. Ersetzen 1/3 der mittleren alle 6-7 Tage. Ändern Sie nicht öfter Medium und / oder vollständig.
  5. Wiederholen Sie Schritt 4,3 und 4,4, wenn die Zellen nahe bei 100% Konfluenz erreicht haben. Split-Zellen nicht mehr als 1:4-Verdünnung in einer T75-Flaschefür die Aufrechterhaltung eines angemessenen Wachstum der Zellen über die Zeit.

5. Einfrieren und Auftauen kultivierte menschliche Zellen pilzförmige Papillen Geschmack

  1. Um Bestände von primären Zellen einfrieren Geschmack, nach Trypsinierung (Schritt 4.2), 3 ml Geschmack komplette Zelle mittel-und Transfer-Zellen auf sterile 15 ml konischen Zentrifugenröhrchen. Zentrifugieren bei 2500 Upm für 5 min bei Raumtemperatur.
  2. Entfernen Sie vorsichtig den Überstand und resuspendieren sanft Zellen mit entsprechenden Volumen Einfriermedium mit 95% fötalem Rinderserum (FBS) und 5% DMSO.
  3. Übertragen Zellen zu kennzeichnen, sterile Kryoröhrchen, fest verschließen, und in einen Behälter, der das Einfrieren Isopropanol. Platz in eine -80 ° C Gefrierschrank für mindestens einen Tag vor der Übertragung auf unbestimmte Zeit zu flüssigem Stickstoff.
  4. Um eine Flasche mit gefrorenem primären humanen pilzförmigen Papillen Geschmack Zellen, bei 37 ° C auftauen Wasserbad bis kurz aufgetaut (ca. 1 Minute), während der Arbeit in einer Laminar-Flow-ZellkulturKapuze.
  5. Übertragen Zellen und Einfriermedium in ein steriles 15 ml konischen Zentrifugenröhrchen eingewogen und mit 5 ml Geschmack Zellkulturmedium.
  6. Zentrifuge Zellen bei 2500 UpM für 5 min bei Raumtemperatur. Sorgfältig Überstand verwerfen, sanft Die Zellen mit vollständigem Geschmack Zellkulturmedium, und in ein steriles T-25 Zellkulturflasche.
  7. Weiter zur Kultivierung von Zellen nach 3 bis 4 fort.

6. Repräsentative Ergebnisse

Versuche, Geschmack Biopsien in Kultur zu züchten erfolgreich waren 90% der Zeit. Ein paar Tage nach Biopsie und Dissoziation, Zellen typischerweise begann zu wachsen und wandern nach außen von den Stücken seziert fungiformen Gewebe, die nach der Dissoziation Verfahren geblieben. Obwohl einzelne Zellen sichtbar waren 24-48 Stunden nach dem Ausstreichen (Abbildung 1A), wuchs Zellen für bis zu 2-3 Wochen unter angehängten Zellhaufen, gelegentlich Erzeugung Tochterzellen (Abbildung 1B). Von BiopsieIng. 08.04 menschlichen pilzförmige Papillen, erreichen erste Isolate von primären humanen pilzförmigen Papillen Geschmack Zellen etwa 2000 bis 8000 Zellen in 4 Wochen in Kultur. Expansion in T25-Zellkulturflaschen (Passage 0) für weitere 3-4 Wochen wird in mit menschlichen pilzförmige Papillen Geschmack Zellen in Kultur angepasst (Abbildung 1C) führen. Primäre humane pilzförmige Papillen Zellen Geschmack kann weiter ausgebaut werden, um nach oben in der Kultur von mindestens einer Million Zellen von Passage-1 in 3-4 Wochen (1D) zu ergeben. Primäre Zellen Geschmack wird sich weiterhin für mehr als 8 Stellen wachsen.

Die Morphologie der kultivierten humanen pilzförmigen Papillen Geschmack Zellen in Kultur war ähnlich kultivierten Zellen chemosensorischen zuvor beschrieben 11,12 .. Die meisten kultivierten humanen pilzförmigen Papillen Geschmack Zellen behielten ihre ursprüngliche Erscheinungsbild der kompakten Zellkörper mit oder ohne einem oder mehreren Prozessen bis zu 15-30 Tage. Nachdem sie erreicht Zusammenfluss meisten der kultivierten ceLLS hatte eine polarisierte-gestreckter erscheinen. Ältere Geschmack Zellen bestehen aus mehreren verschiedenen histologischen Subtypen und Ausstellung Geschmack Zell-spezifische Funktionen. Hier zeigen wir, dass Zellen in diesen Kulturen viele molekulare und physiologische Merkmale charakteristisch für reife Geschmack Zellen anzuzeigen. Gustducin und Phospholipase C - β2, (PLC-β2) mRNA wurden durch reverse Transkriptase-Polymerase-Kettenreaktion und Produkte durch Sequenzierung (2) bestätigt, detektiert. Die Expression von Gustducin und PLC-β2 erkannt wurde immuncytochemisch, die das Vorhandensein von Typ-II-ähnlichen Zellen (Abbildung 3 B und D). Die Prävalenz und Muster der relativen Expression Gustducin und PLC-β2 reflektierenden Zelle Signalwege und Zelltypen nicht exakt widerspiegeln, dass in vivo gesehen. Die Faktoren, die die relative Verteilung der verschiedenen Zelltypen innerhalb eines Geschmacksknospe unbekannt sind, und dürfen nicht in den Kulturbedingungen repliziert werden. Daher ist b oth die Ähnlichkeiten und Unterschiede zwischen den kultivierten Zellen und deren In-vivo-Pendants bieten die Gelegenheit, um die Regulation dieser Eigenschaften auf molekularer Ebene zu untersuchen, unter Bedingungen, die manipuliert und überwacht werden können.

Ein wichtiges Kriterium für ein Modell-System ist das Vorhandensein von entsprechenden funktionellen Eigenschaften. Kultivierte Zellen zeigten auch robust Erhöhung des intrazellulären Calcium in Reaktion auf die entsprechenden Konzentrationen von mehreren Geschmacksreize (Abbildung 4). In diesen Studien hervorzurufen süßen und bitteren Reize eine Erhöhung der intrazellulären Calcium, die zu einer Depolarisation entsprechen kann. Diese Zell-ähnlichen Geschmack Eigenschaften der kultivierten Zellen stützen die Behauptung, dass das Modell, das wir beschreiben hier eine wertvolle Bereicherung für weitere Untersuchungen der Signaltransduktionswege und Regenerationsfähigkeit des menschlichen Geschmacks-Zellen sein.

fig1.jpg "/>
Abbildung 1. Anlage und Morphologie der kultivierten menschlichen Zellen pilzförmige Papillen Geschmack. Primäre humane pilzförmige Papillen Geschmack Zellkulturen auf Kollagen-Typ-1 beschichteten Platten gewachsen waren, wurden nach 2 Tagen (A) abgebildet. Menschliche pilzförmige Papillen Geschmack Zellen wuchsen für bis zu 4 Wochen unter angehängten Zellhaufen, die Anlass zu geben schien Tochterzellen. Die Zellen wuchsen in der Regel bis zur Konfluenz innerhalb von vier Wochen (B) und (C und D) repräsentiert Tag 2 und 4 Wochen nach der Ernte und reseeding bzw. Kultivierte Zellen weiterhin für mindestens 8 Monate wachsen. Maßstabsbalken = 50 nm auf. Ein Teil der Abbildung 1 wurde auch in Ozdener et. al. 10.

2
Abbildung 2. RT-PCR-Ergebnisse zeigten das Vorhandensein von spezifischen Geschmack Biomarker Zelle mRNAs (Gustducin und PLC-β2,). Gesamt-RNA aus kultivierten menschlichen Zellen war fungiformen Reverse TRANSCribed unter Verwendung des Superscript First Strand Synthesis System für RT-PCR (Invitrogen) und für die PCR durch Verstärken mit spezifischen Primern zur Detektion von gustducin und PLC-β2 gestalten. Primer (Tabelle 1) wurden ausgewählt, um ein oder mehrere Introns umfassen. Jede mRNA wurde in kultivierten humanen pilzförmigen Geschmack Papillen Zellen aus Passage 4 oder 5 mit Amplifikationsprodukte der erwarteten Größe, nachgewiesen durch Sequenzierung bestätigt. Spezifische mRNA wurde in Kontrollversuchen ohne reverse Transkriptase was keine Kontaminationen mit genomischer DNA nachgewiesen werden. PCR-Produkte wurden auf 2% igen Agarosegelen getrennt und die amplifizierten Produkte wurden auf dem Gel mit einer Rasierklinge ausgeschnitten. DNA wurde aus dem Gel unter Verwendung des QIAquick Gel Extraction Kit (Qiagen) extrahiert. PCR-Produkte wurden an der University of Pennsylvania Sequencing Einrichtungen sequenziert. C-C-PCR und RT sind Kontrollversuche für die PCR und reverse Transkriptase, jeweils. Teil der 2 wurde auch in Ozdener et. al.

Abbildung 3
Abbildung 3. Immunfärbung von kultivierten menschlichen Zellen pilzförmige Papillen Geschmack Passage 4 oder 5 zeigte Präsenz des Geschmacks Zelle Biomarkern. Kultivierte humane pilzförmige Papillen Geschmack Zellen (5 Tage alt) wurden mit 4% Paraformaldehyd fixiert, gewaschen und mit primären Antikörpern (Tabelle 2) über Nacht bei 4 ° C. Die Bilder wurden mit einem Leica TCS-SP2 konfokalen Laser-Scanning-Mikroskop erworben. Etwa, wurden 60% der kultivierten Geschmack pilzförmige Papillen Zellen mit Gustducin (B) und 20-30% mit PLC-β2 (D) gekennzeichnet. Getriebe Bilder entsprechender Zellen gezeigt (A und C). Zur Kontrolle Immunfärbung mit spezifischen Antikörper Immunglobulin zeigte die Abwesenheit von unspezifischen Immunreaktivität (Daten nicht gezeigt). Maßstabsbalken = 50 nm auf. Teilvon 3 wurde auch in Ozdener et. al. 10.

Abbildung 4
4. Kultivierte humane fungiformes Geschmack Papillen Zellen aus Passage 4 oder 5 auf verschiedene Stimuli zu reagieren. Kultivierte humane fungiformes Geschmack Papillen Zellen (4-5 Tage alt) wurden mit 1 mM Fura-2 AM (Molecular Probes) und 10 mg / ml Pluronic F127 (Molecular Probes) geladen. Veränderungen der intrazellulären Calcium-Spiegel ([Ca 2 +] i) in kultivierten menschlichen Zellen pilzförmige Papillen Geschmack wurden mittels Standard-Handbuch bildgebenden Verfahren. Die Zellen wurden unter Verwendung einer inversen Mikroskop bei Wellenlängen von 340 nm und 380 nm und einer Emissionswellenlänge von einem Bandpassfilter bei 510 nm zentriert eingestellt. Die Stimuli wurden in Bad gelöst und dann pH-Wert nachgestellt und die Osmolarität, wenn nötig. Kultivierte humane pilzförmige Papillen Geschmack Zellen reagierten auf süßen und bitteren Reize. Graphs veranschaulichen repräsentative Reaktionen [Ca 2 +] i-Ebenen in einzelnen Zellen während der Exposition gegenüber (A) Denatonium (2 mM), (B) Sucralose (1 mM). Jede einzelne Kurve stellt einzelne Zellen.

Gen Reihenfolge PCR-Bedingung Erwartete Größe
(Bp)
Referenz
β-Aktin GGACTTCGAGCAAGAGATGG
AGCACTGTGTTGGCGTACAG
7 min
45 Sek.
45 Sek.
45 Sek.
7 min
95
94
53
72
72
234 NM_001101.3
Gustducin TCTGGGTATGTGCCAAATGA
GGCCCAGTGTATTCTGGAAA
7 min
45 Sek.
45 Sek.
45 Sek.
7 min
95
94
53
72
72
386 NM_001102386
PLC-β2 GTCACCTGAAGGCATGGTCT
TTAAAGGCGCTTTCTGCAAT
3 min
30 Sek.
30 Sek.
60 Sek.
7 min
95
94
53
72
72
333 NM_004573

Tabelle 1. Primer und Bedingungen zum Nachweis von spezifischen Molekülen Geschmack verwendet.

Primärer Antikörper Quelle Gastgeber Verdünnung Sekundäre Antikörper Quelle Gastgeber Verdünnung
Gustducin SantaCruz Kaninchen 1:500 Anti-Kaninchen-IgG-Alexa 633 Molecular Probes Ziege 1:500
PLC-β 2 SantaCruz Kaninchen 1:500 Anti-Kaninchen-IgG-Alexa 633 Molecular Probes Ziege 1:500

Tabelle 2. Antikörper zum Nachweis der Expression von spezifischen Molekülen verwendet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Wir haben Zellen aus menschlichen pilzförmige Papillen Geschmack für über 8 Passagen erhalten gepflegt, über einen Zeitraum von 12 Monaten. Diese Kulturen generieren neue Zellen, von denen viele in-vitro-Reifung auf die Bühne, wo sie mehrere Marker von reifen Geschmacksknospe Zelltypen, zum Ausdruck bringen zusätzlich zu den wichtigsten molekularen und physiologischen Eigenschaften der Geschmack Rezeptorzellen. Die Anwesenheit von Gustducin-und PLC-β2 Immunreaktivität in Teilmengen von kultivierten Zellen steht im Einklang mit diesem Ergebnis. Am wichtigsten ist, reagierten einige Zellen, um Anwendungen von süßen und bitteren Geschmack Reize mit vorübergehender Anstieg der intrazellulären Kalzium, das ist ein Feature von dissoziierten Zellen Geschmack 5, Zellen in Geschmacksknospe Scheiben 3 und kultivierten menschlichen Zellen und Ratten-Geschmack 19,10. Dies zeigt nicht nur, dass einige der Zellen in Kultur molekularen Rezeptoren für süß und bitter geäußert, sondern dass sie genug von der G-Protein-gekoppelten-Kaskade zu generieren Calcium Antworten.

Langfristige primären Zellkulturen oft nicht aufrechterhalten kann das ursprüngliche Gewebe und Zellstruktur und zellulären Faktoren, die eine Rolle bei der physiologischen Funktion von Zellen spielen kann. Durch die erfolgreiche langfristige Etablierung der Menschenrechte pilzförmige Papillen Geschmack Zellkultur, hat große Fortschritte gemacht worden noch eine Reihe von Einschränkungen erwähnt werden muss. Die wichtigste davon ist, dass jede Charge primär kultivierten Zellen kann auf Grund von Unterschieden in der ersten Population von Zellen verwendet werden, um die Kultur zu starten. Primäre Zellkulturen oft vermissen das ursprüngliche Gewebe Organisation und Struktur und Wachstumsfaktoren, die eine Rolle in der physiologischen Funktion von Zellen. Die Zellen sind jedoch nicht immer und vollständig in Kontakt mit anderen Zellen, die Kulturen nicht zu 100% Konfluenz wachsen gelassen werden. Im Allgemeinen sind die primären Zellen unterliegt auch Dedifferenzierung und chromosomale Instabilität, durch Verluste oder Gewinne der Chromosomen während der Replikation der Zellen in kontinuierlichen Zellen Li gekennzeichnetnes, kann ein weiteres Problem 13,14,15 sein. Der Vergleich von kultivierten menschlichen Zellen fungiformen mit kultivierten Zellen der Zunge nontaste müssen ausgelotet werden. Diese Fragen müssen noch die Verwendung von vielen experimentellen Ansätzen und Modellsystemen vor unserem Verständnis ist abgeschlossen.

Abschließend beschrieben Dieses Protokoll ermöglicht hier Aufrechterhaltung der menschlichen pilzförmige Papillen Geschmack Zellen in vitro mindestens 8 Durchgänge (12 Monate), ohne dass relevante Zell-physiologischen und molekularen Eigenschaften. Die Weiterentwicklung dieser langfristigen primären Kultur stellt ein Modellsystem für die Untersuchung der Proliferation und Differenzierung, Stimulus-Spezifität, cross-talk und Anpassung Eigenschaften des menschlichen Geschmacks-Rezeptor-Zellen, sowie Geweberegeneration. Darüber hinaus werden die Auswirkungen von Bedingungen, die den Geschmack die Funktionen wie die Infektion beeinträchtigen können Medikamente, Strahlung, giftige oder chemischen Belastungen am molekularen und physiologischen Ebenen untersucht werden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Keine Interessenskonflikte erklärt.

Acknowledgments

Wir bedanken uns bei Aimee Myers und ESI Quayson für technische Kompetenz und Hilfe. Diese Arbeit wurde zum Teil durch NSF 0216310 und Givaudan Inc Zuschuss (NER) unterstützt.

References

  1. Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia. J. Comp. Neurol. 377, 324-340 (1997).
  2. Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells. Neurosci. Lett. 277, 13-16 (1999).
  3. Caicedo, A., Jafri, M. S., Roper, S. D. In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells. J. Neurosci. 20, 7978-7985 (2000).
  4. Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. A reliable method to obtain cells of taste buds from fungiform papillae of mice. Acta Histochem. 112, 107-112 (2010).
  5. Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. A method for isolating and patch-clamping single mammalian taste receptor cells. Brain Res. 503, 326-329 (1989).
  6. Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes. Neuroscience. 106, 217-225 (2001).
  7. Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. Maintenance of rat taste buds in primary culture. Chem. Senses. 26, 861-873 (2001).
  8. Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. Analysis of cell lineage relationships in taste buds. J. Neurosci. 22, 4522-4529 (2002).
  9. Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. Characterization and long-term maintenance of rat taste cells in culture. Chem. Senses. 31, 279-290 (2006).
  10. Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. Characterization of Human Fungiform Papillae Cells in Culture. Chem. Senses. 36, 601-612 (2011).
  11. Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. Characteristics of odorant elicited calcium changes in cultured human olfactory neurons. J. Neurosci. Res. 62, 737-749 (2000).
  12. Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. Continuous culture of neuronal cells from adult human olfactory epithelium. J. Mol. Neurosci. 3, 137-146 (1992).
  13. Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro. Physiol. Genomics. 17, 179-192 (2007).
  14. Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population. Stem Cells Dev. 17, 1109-1121 (2008).
  15. Sandow, S. L., Grayson, T. H. Limits of isolation and culture: intact vascular endothelium and BKCa. Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).
Isolierung und Kultivierung humaner Zellen pilzförmige Papillen Geschmack
Play Video
PDF DOI

Cite this Article

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).More

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter