Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

בידוד והתרבות של האדם בחוש הטעם תאים Fungiform גבשושיות

doi: 10.3791/3730 Published: May 17, 2012

Summary

המטרה היא לפתח פרוטוקול לשחזור לבידוד ושמירה לטווח ארוך של תרבויות אנושיות הטעם תאים fungiform גבשושיות. תאים מאדם fungiform גבשושיות מתקבל על ידי ביופסיה נשמרו בהצלחה במשך יותר משמונה קטעים (12 חודשים) בתרבות ללא אובדן הכדאיות.

Abstract

תאים הטעם הם מאוד מיוחדים, עם מאפיינים ייחודיים, היסטולוגית מולקולריות ופיזיולוגיות המאפשרים זיהוי של מגוון רחב של גירויים פשוטים ומולקולות כימיות מורכבות הכלולים מזונות. ב האדם גבשושיות, fungiform הפרט להכיל מאפס עד כמה שרק 20 בלוטות הטעם. אין פרוטוקול מבוסס תאים אנושיים culturing הטעם, אם כי היכולת לשמור על גבשושיות הטעם התאים בתרבית תאים במשך מחזורים רבים תהיה התועלת רבה לאפיון תכונות מולקולריות, רגנרטיבית, ופונקציונלי של תאים אלה ייחודיים חושיות. מחקרים קודמים של תאים הטעם היה לעשות שימוש טרי תאים מבודדים בתרבות העיקרי, תרבויות explant של מכרסמים, או חצי שלמות בלוטות הטעם של פרוסות רקמה 1,2,3,4. למרות כל ההכנות הללו יש יתרונות, פיתוח לטווח ארוך תרבויות היתה יכולה לספק יתרונות משמעותיים, במיוחד מחקרים של התא טעם שגשוג differentiation. מספר קבוצות, כולל שלנו, היה מעוניין בפיתוח והקמת תא מודלים טעם ותרבות. רוב הניסיונות תאים הטעם תרבות דיווחו על יכולת הקיום מוגבל, עם תאים בדרך כלל לא מעבר שנמשך 3-5 ד 5,6,7,8. אנחנו לאחרונה דווח על שיטה מוצלחת לתרבות המורחבת של טעם תאים מכרסמים 9. אנחנו כאן לדווח לראשונה על הקמת במערכת התרבות חוץ גופית עבור מבודדים תאים אנושיים הטעם fungiform גבשושיות. תאים מאדם fungiform גבשושיות מתקבל על ידי ביופסיה נשמרו בהצלחה במשך יותר משמונה קטעים (12 חודשים) בתרבות ללא אובדן הכדאיות. תאים מוצגים תכונות מולקולריות ופיזיולוגיים רבים האופייניים לתאי הטעם בוגרים. Gustducin ו phospholipase C β2, (PLC-β2) mRNA התגלו תאים רבים מהתגובה transcriptase-פולימראז הפוך שרשרת ואושרו על ידי סידור. ניתוח Immunocytochemistry הפגינו נוכחות של משבducin ו PLC-β2 ביטוי בתאים בתרבית הטעם. בתרבית תאים fungiform אדם גם הציגו עליות סידן תוך תאי בתגובה ריכוזים מתאימים של גירויים הטעם מספר המצביעים על כך קולטני הטעם, לפחות בחלק מן המסלולים איתות נכחו. תוצאות אלו מצביעות על כך מספיק תאים הטעם של בני אדם בוגרים יכול להיות שנוצר ומתוחזק על לפחות שמונה קטעים. רבים מן התאים לשמור על מאפיינים פיזיולוגיים ביוכימיים של תאים מבודדים בחריפות מן האפיתל טעם מבוגר כדי לתמוך השימוש בהם כמערכת מודל טעם. מערכת זו תאפשר מחקרים נוספים של התהליכים המעורבים בידול התפשטות, והתפקוד של תאים קולטני הטעם של יונקים לקראת במבחנה.

האדם גבשושיות fungiform טעם בשימוש להקמת התרבות האנושית תא fungiform נתרמו לחקר בעקבות הסכמה מדעת נכונה תחת פרוטוקולים מחקר נבדקוואושרה על ידי ועדת IRB. פרוטוקול (# 0934) אושרה על ידי שולמן Associates מוסדי סקירה עמוד Inc, סינסינטי, אוהיו. בפרוטוקול נכתב מתחת מבוסס על פרמטרים שפורסמו שדווחו על ידי Ozdener et al. 2011 10.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. קבלת גבשושיות האדם טעם Fungiform

  1. הסר 07:56 fungiform האדם גבשושיות הטעם מפני השטח הגבי של החלק הקדמי של הלשון באמצעות microscissors האביב מעוגלים.
  2. המקום מיד פתרון הבידוד (26 mM NaHCO 3, 2.5 מ"מ לאא 2 PO 4, גלוקוז 20 מ"מ, 65 מ"מ NaCl, KCl 20 מ"מ, ו 1 mM EDTA מומס במים nuclease ללא ולסנן עיקור).

2. האדם גבשושיות Fungiform טעם עיכול

האדם התא fungiform גבשושיות הטעם יכול להיות מנותק באמצעות שני פרוטוקולים שונים עיכול אנזימטי עם הבדלים קלים.

  1. דגירה fungiform גבשושיות בפתרון בידוד עם pronase (1 מ"ג / מ"ל, סיגמא אולדריץ') ו elastase (1 מ"ג / מ"ל ​​סיגמא אולדריץ') בטמפרטורת החדר למשך 30-45 דקות (פרוטוקול 1).
  2. דגירה fungiform גבשושיות עם collagenase סוג אני (550 U / mL, החל וורטינגטון) + elastase (10 יח' / מ"ל, החל ווארטhington) + מעכבי טריפסין (0.9 מ"ג / מ"ל, החל וורטינגטון) ב 2 סידן פתרון מ"ל רינגר חינם ב 35 ° C שיטה חלופית אמבט מים עם מחזור הדם במשך 30 דקות החמצון עדין עם 95% מ 2/5% CO 2. (עבור עיכול, פרוטוקול 2)
  3. לאחר הדגירה, לשטוף עם גבשושיות הצלצול ו triturate את גבשושיות עם זכוכית מלוטשת אש פיפטה פסטר במשך 10 פעמים.
  4. סרכזת אותו במשך 3 דקות על סל"ד 2500 ב RT ולהסיר פתרון בידוד ולהוסיף 1 מ"ל של המדיום הסלולרי טעם ותרבות.
  5. העברת מתעכל fungiform גבשושיות לתוך צלחת זכוכית.
  6. לנתח fungiform גבשושיות בעדינות עם סכין כירורגית.
  7. הוסף 250 μl של גבשושיות גזור לגליל שיבוט על coverslip זנב עכברוש קולגן מסוג 1 מצופה.
  8. הוסף 1 מ"ל של המדיום הסלולרי טעם תרבות לבאר כל אחד.

3. Culturing של האדם בחוש הטעם תאים Fungiform גבשושיות

  1. דגירה צלחת על 36 מעלות צלזיוס humidifiedבחממה המכילה 5% CO 2.
  2. מניחים באינקובטור ללא הפרעה במשך 2 ימים לפני השינוי הראשון של בינוני מלא. תאים הטעם בסופו של דבר להיקשר coverslip מצופה, אם כי זה לא יכול להיות נראית בבירור 1 עד 3 ימים.
  3. הסר גליל שיבוט מהצלחת ובינוניים לחלוטין ולהוסיף 1 מ"ל של המדיום הסלולרי טעם גם לתוך כל אחד.
  4. להחליף 1/3 של 6-7 ימים בינוניים לכל דבר. אל תשנה בינוני לעיתים קרובות יותר ו / או לחלוטין.
  5. יש לבדוק את גדילת התאים תחת מיקרוסקופ כל יום אחר. רוב התאים החדשים גדלים מתחת אשכולות סלולריים. צבירי תאים בדרך כלל לנתק לאחר 2-3 שבועות בתרבות עוזב את התאים החדש.
  6. לאחר 40-50% של הגליל שיבוט מכוסה בהרחבת התאים הטעם, trypsinize תאים באמצעות 0.25% w / v טריפסין / EDTA במשך 2-3 דקות על 36 ° C.
  7. להעביר את התאים מן הבארות ל -15 מ"ל צינורות, להוסיף 3 כרכים של המדיום הסלולרי טעם תרבות ואחריו צנטריפוגה בסל"ד 3000 למשך 5 דקות בכל מזג החדרature.
  8. הסרה של תאים supernatant ו resuspend עם 1 מ"ל של המדיום הסלולרי הטעם.

4. התפשטות האדם בחוש הטעם תאים Fungiform גבשושיות

  1. להעביר את התאים לתוך צלחת T25 ולהוסיף 4 מ"ל של מדיום טעם תא (מעבר 0). לשמור על התאים על 36 מעלות צלזיוס חממה humidified המכיל 5% CO 2.
  2. להחליף 1/3 של 6-7 ימים עד בינוני בכל התאים בתרבית הטעם הגיעו למפגש 100%. בשלב זה, כדי לאפשר לתאי הטעם כדי הקציר, לשטוף את התאים פעם עם סטרילית PBS אז trypsinize תאים באמצעות 0.25% w / v טריפסין / EDTA במשך 2-3 דקות על 36 מעלות ג
  3. לאחר צנטריפוגה כמתואר לעיל, resuspend במדיום הסלולרי מלא טעם תאים העברה ל-T-75 צלוחיות טריים (קטע 1).
  4. להחליף 1/3 של 6-7 ימים בינוניים לכל דבר. אל תשנה בינוני לעיתים קרובות יותר ו / או לחלוטין.
  5. חזור על שלב 4.3 ו - 4.4 כאשר תאים הגיעו קרוב ל 100% המפגש. פיצול תאים לא יותר דילול 01:04 בבקבוק T75לשמירה על צמיחה נאותה של התאים לאורך זמן.

5. הקפאה מפשירים אדם בתרבית תאים בחוש הטעם Fungiform גבשושיות

  1. להקפיא את מלאי התאים הטעם העיקרי, אחרי trypsinization (שלב 4.2), להוסיף 3 מ"ל הטעם המלא תא בינוני תאים העברת עד 15 צינורות סטריליים מ"ל צנטריפוגות קוניים. סרכזת בסל"ד 2500 5 דקות בטמפרטורת החדר.
  2. מוציאים בזהירות את התאים supernatant ו resuspend בעדינות עם נפח מתאים של המדיום מקפיא המכיל 95% בסרום שור עוברית (FBS) ו DMSO 5%.
  3. העברת התאים שכותרתו, כובע, cryovials סטרילית היטב, ומכניסים לכלי הקפאה המכיל isopropanol. המקום לתוך המקפיא -80 ° C למשך יום אחד לפחות לפני העברת לנצח כדי חנקן נוזלי.
  4. להפשיר בקבוקון של קפואים העיקריים אדם הטעם fungiform התאים גבשושיות, במקום על 37 מעלות צלזיוס המים באמבטיה עד מופשר רק כ (1 דקה), תוך כדי עבודה בתרבות למינרית זרימת התאמכסה המנוע.
  5. העברת תאים בינוניים מקפיא כדי צינור סטרילי מ"ל 15 צנטריפוגות חרוטי ולהוסיף 5 מ"ל של מדיום התא טעם ותרבות.
  6. סרכזת תאים בסל"ד 2500 5 דקות בטמפרטורת החדר. בזהירות לבטל supernatant, תאים resuspend בעדינות עם תא שלם בינוני התרבות טעם, והעברה בקבוק תרבות סטרילית T-25 רקמות.
  7. ממשיכים התאים תרבות פי שלב 3 עד 4.

6. נציג תוצאות

ניסיונות לגדל ביופסיות הטעם בתרבות הצליחו 90% מהזמן. כמה ימים לאחר הביופסיה ודיסוציאציה, התאים בדרך כלל החל לגדול ולהעביר החוצה מן פיסות הרקמה fungiform גזור שנותרו אחרי הליך ניתוק. למרות תאים בודדים נראו 24-48 שעות לאחר ציפוי (איור 1 א), התאים גדלו עד 2-3 שבועות תחת אשכולות תאים מחוברים, לפעמים יצירת לתאי הבת (1B איור). מן הביופסיהing 4-8 האנושי fungiform גבשושיות, מבודד הראשונים של ראשוניים בתאים אנושיים הטעם fungiform גבשושיות להגיע לכ 2000 - 8000 תאים 4 שבועות בתרבות. התרחבות T25 תרבות צלוחיות סלולריים (מעבר 0) של 3-4 שבועות נוספים יביא אדם בעל טעם fungiform התאים גבשושיות בתרבות מותאמת (איור 1 ג). ראשיים אדם הטעם fungiform התאים גבשושיות ניתן להרחיב עוד יותר בתרבות להניב כלפי מעלה של לפחות מיליון תאים על ידי מעבר-1 ב 3-4 שבועות (1D איור). תאים הטעם ראשיים ימשיך לגדול במשך יותר מ 8 קטעים.

המורפולוגיה של אדם בתרבית תאים גבשושיות הטעם fungiform בתרבות דומה תאים בתרבית chemosensory שתואר קודם לכן 11,12 .. בתרבית רוב האדם הטעם fungiform התאים גבשושיות שמרו מראה קומפקטי המקורית של גופי התא עם או בלי אחד או יותר תהליכים עד 15-30 ימים. לאחר שהגיעו מפגש רוב לספירה תרבותיתlls היה מראה מקוטב, מוארך. תאים בוגרים הטעם מורכב מכמה תת היסטולוגית שונים טעם התערוכה סלולריים תכונות ספציפיות. כאן אנו מראים כי תאים אלה בתוך התרבויות להציג תכונות מולקולריות ופיזיולוגיים רבים האופייניים לתאי הטעם בוגרים. Gustducin ו phospholipase C - β2, (PLC-β2) mRNA התגלו על ידי תגובה transcriptase-פולימראז הפוך שרשרת מוצרי אישרו על ידי רצף (איור 2). ביטוי gustducin ו PLC-β2 התגלה immunocytochemically המעידים על נוכחות של סוג II דמויי תאים (איור 3 B ו-D בהתאמה). השכיחות היחסית של דפוסי הביטוי gustducin ו PLC-β2 המשקף המסלולים התא איתות סוגי תאים לא בדיוק משקפים כי ראיתי in vivo. הגורמים הקובעים את החלוקה היחסית של סוגי תאים שונים בתוך ניצן הטעם אינם ידועים, ולא יכול להיות משוכפל התנאים תרבות. לכן, ב oth את הדומה והשונה בין תאים בתרבית ו שלהם עמיתיהם ב vivo לספק הזדמנות לבחון את הרגולציה של מאפיינים אלה ברמה המולקולרית, בתנאים שבהם ניתן להשפיע פיקוח.

קריטריון חשוב עבור מערכת מודל היא הנוכחות של תכונות פעילות הרלוונטיים. תאים בתרבית גם הציגו עליות חזקות של סידן תוך תאי בתגובה ריכוזים מתאימים של גירויים הטעם כמה (איור 4). במחקרים אלה, גירויים מתוק ומר לעורר עלייה סידן תוך תאי שעשויים מתאימות שלילת קוטביות. אלו תאים כמו הטעם המאפיינים של תאים בתרבית לתת תמיכה לטענה כי מערכת מודל המתואר כאן יהיה נכס בעל ערך למחקרים נוספים של המסלולים התמרה ואת יכולת ההתחדשות של תאים הטעם האנושי.

fig1.jpg "/>
באיור 1. קובץ מצורף ומורפולוגיה של אדם בתרבית תאים הטעם fungiform גבשושיות. ראשיים אדם הטעם fungiform גבשושיות תאים תרבויות גדל על צלחות קולגן מסוג 1 היו מצופים צילמו אחרי 2 ימים (א '). אדם גבשושיות fungiform תאים הטעם גדל עד 4 שבועות תחת אשכולות תאים מחוברים, שכמו להצמיח לתאי הבת. התאים בדרך כלל גדל המפגש בתוך ארבעה שבועות (ב '), ו (C ו-D) מייצג יום 2 ו 4 שבועות לאחר הקטיף ואת הזריעה המחודשת בהתאמה. תאים בתרבית המשיך לגדול לפחות 8 חודשים. ברים בקנה מידה = 50 ננומטר. חלק איור 1 הוצגה גם Ozdener et. אל. 10.

איור 2
איור 2. RT-PCR התוצאות הראו נוכחות של תאים ספציפיים הטעם mRNAs סמן ביולוגי (gustducin ו PLC-β2,). RNA הכולל בתרבית תאים fungiform אדם היה transc הפוךribed באמצעות סינתזה כתב עילי ראשית מערכת סטרנד עבור RT-PCR (Invitrogen) ונעשה בו שימוש על ידי הגברה PCR עם פריימרים ספציפיים המיועדים זיהוי של gustducin ו PLC-β2. Primers (טבלה 1) נבחרו ההיקף אחד או יותר אינטרונים. MRNA כל זוהה בתרבית תאים אנושיים הטעם fungiform גבשושיות של מעבר 4 או 5 עם מוצרים הגברה של גודל כצפוי, אושר על ידי סידור. MRNA ספציפי לא התגלה בניסויים שליטה ללא transcriptase הפוכה המציין זיהום לא הדנ"א הגנומי. מוצרי ה-PCR הופרדו על 2% agarose ג'ל והמוצרים מוגבר על ג'ל היו נכרת בסכין גילוח. ה-DNA היה שחולצו מן ג'ל באמצעות QIAquick ג'ל הפקת Kit (Qiagen). מוצרי ה-PCR היו רצף של אוניברסיטת פנסילבניה מתקני רצף. C-PCR ו-C-RT הם ניסויים בקרה PCR ו transcriptase הפוכה, בהתאמה. חלק איור 2 הוצג גם Ozdener et. אל.

איור 3
איור 3. Immunostaining של טעם תרבותי אנושי מעבר fungiform התאים גבשושיות 4 או 5 הראו נוכחות של סמנים ביולוגיים סלולריים הטעם. אדם בתרבית הטעם fungiform גבשושיות תאים (5 ימים) תוקנו עם paraformaldehyde 4% ו מודגרות עם נוגדנים ראשוניים (טבלה 2) לילה ב 4 ° C. התמונות נרכשו באמצעות מיקרוסקופ TCS-SP2 Leica confocal סריקת לייזר. כ, 60% של תאים בתרבית הטעם fungiform גבשושיות תויגו עם gustducin (ב ') 20-30% עם PLC-β2 (ד'). תמונות שידור של תאים המתאימים מוצגים (A ו-C). עבור פקדים, immunostaining עם אימונוגלובולינים נוגדנים ספציפיים הפגינו היעדר תגובתיות חיסוני ספציפי (מידע לא מוצג). ברים בקנה מידה = 50 ננומטר. חלקאיור 3 הוצג גם Ozdener et. אל. 10.

איור 4
באיור 4. אדם בתרבית הטעם fungiform גבשושיות תאים מעבר 4 או 5 להגיב לגירויים שונים. אדם בתרבית הטעם fungiform גבשושיות תאים (4-5 ימים) עמוסות 1mm פורעה, 02:00 (בדיקות מולקולריות) ו - 10 מ"ג / מ"ל ​​Pluronic F127 (בדיקות מולקולריות). שינויים ברמות סידן תוך תאי ([Ca 2 +] i) בתרבית תאים אנושיים הטעם fungiform גבשושיות נמדדו באמצעות תקן הדמיה טכניקות ידניות. התאים היו דמיינו באמצעות מיקרוסקופ פלואורסצנטי הפוך באורכי גל עירור של 340 ננומטר ו -380 ננומטר אורך גל הפליטה נקבע על ידי מסנן הלהקה לעבור מרוכז ב 510 ננומטר. גירויים היו מומסים בתמיסה אמבטיה ואז ה-pH ו osmolarity וסידרה במידת הצורך. בתרבית תאים אנושיים הטעם fungiform גבשושיות הגיב לגירויים מתוק ומר. Graphs להמחיש התגובות נציג של [Ca 2] אני רמות תאים בודדים במהלך החשיפה () Denatonium (2 מ"מ), (ב) סוכרלוז (1 מ"מ). זכר מייצגת תאים בודדים בודדים.

גן רצף PCR מצב צפוי גודל
(נ"ב)
הפניה
β-אקטין GGACTTCGAGCAAGAGATGG
AGCACTGTGTTGGCGTACAG
7 דקות
45 שניות
45 שניות
45 שניות
7 דקות
95
94
53
72
72
234 NM_001101.3
Gustducin TCTGGGTATGTGCCAAATGA
GGCCCAGTGTATTCTGGAAA
7 דקות
45 שניות
45 שניות
45 שניות
7 דקות
95
94
53
72
72
386 NM_001102386
PLC-β2 GTCACCTGAAGGCATGGTCT
TTAAAGGCGCTTTCTGCAAT
3 דקות
30 שניות
30 שניות
60 שניות
7 דקות
95
94
53
72
72
333 NM_004573

טבלה 1. Primers ותנאים המשמשים לאיתור מולקולות טעם ספציפיות.

ראשי נוגדן מקור מארח דילול משני נוגדן מקור מארח דילול
Gustducin SantaCruz ארנב 1:500 נגד ארנב IgG Alexa 633 בדיקות מולקולריות עז 1:500
PLC-β 2 SantaCruz ארנב 1:500 נגד ארנב IgG Alexa 633 בדיקות מולקולריות עז 1:500

נוגדנים לוח 2. משמש לאיתור ביטוי של מולקולות ספציפיות.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

אנו שומרים על התאים המתקבלים גבשושיות fungiform האדם טעם כבר למעלה מ 8 קטעים, פורש תקופה של 12 חודשים. תרבויות אלה לייצר תאים חדשים, שרבים מהם לפירעון במבחנה לשלב שבו הם מביעים סמנים שונים של בוגרים ניצן סוגים הטעם סלולריים, בנוסף תכונות מולקולריות ופיזיולוגיות המפתח של הקולטן בתאי הטעם. הנוכחות של gustducin ו-PLC-β2 immunoreactivity של תת קבוצות של תאים בתרבית עולה בקנה אחד עם מסקנה זו. והכי חשוב, כמה תאים הגיב יישומים של גירויים טעם מתוק ומריר עם עלייה זמנית של סידן תוך תאי, אשר היא תכונה של תאים הטעם הסתייגותם 5, תאים באבו פרוסות הטעם 3 ו אדם תרבותי הטעם תאים חולדה 19,10. זה מעיד לא רק כי חלק מן התאים בתרבית לידי ביטוי קולטנים מולקולריים של מתוק ומר, אבל היה להם מספיק מפל G-חלבון התמרה בשילוב ליצור calciאממ תגובות.

תרבויות ארוכות טווח תאים ראשוניים לעיתים קרובות לא יכול לשמור על רקמת המקורי מבנה התא וגורמים הסלולר אשר עשוי לשחק תפקיד בתפקוד הפיזיולוגי של התאים. מוסד מוצלח לטווח ארוך של התרבות האנושית fungiform גבשושיות הטעם התא, התקדמות גדולה נעשתה עדיין, מספר מגבלות יש לציין. החשוב מבין אלה הוא כי כל קבוצה של תאים בתרבית ראשוניים יכול להשתנות עקב הבדלים האוכלוסייה הראשונית של התאים להשתמש כדי להפעיל את התרבות. בתרביות תאים ראשוניים לעיתים קרובות להחמיץ את הארגון רקמות המבנה המקורי לבין גורמי גדילה תפקיד בתפקוד הפיזיולוגי של התאים. תאים הם בדרך כלל לא תמיד לגמרי במגע עם תאים אחרים, כמו תרבויות לא גדלים על מפגש 100%. באופן כללי, תאים ראשוניים נתונות אף הן dedifferentiation, וחוסר יציבות כרומוזומלית, המאופיינת הפסדים או רווחים של כרומוזומים בעת שכפול התא בתא Li רציףנס, יכול להיות בעיה נוספת 13,14,15. השוואה של התאים בתרבית fungiform אדם עם תאים בתרבית nontaste של הלשון צריכה להיות חוקרים. שאלות אלו יחייבו את השימוש של גישות ניסיוניות רבות ומערכות מודל לפני הבנתנו הושלמה.

לסיכום, פרוטוקול זה המתואר כאן מאפשר שמירה על האדם הטעם fungiform גבשושיות תאים במבחנה לפחות 8 קטעים (12 חודשים) מבלי לאבד את תכונות התא פיזיולוגיים מולקולרית הרלוונטיים. פיתוח נוסף של התרבות העיקרי לטווח ארוך זו תספק מערכת מודל מחקרי של התרבות והתמיינות, סגוליות גירוי, בין שיחת תכונות הסתגלות של האדם הקולטן בתאי הטעם, וכן התחדשות רקמות. בנוסף, תופעות של תנאים הפוגעים בתפקוד התא טעם כגון זיהום, תרופות, קרינה, חשיפות או כימיים רעילים יכולים להיבחן ברמה מולקולרית פיזיולוגית.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

אין ניגוד עניינים הצהיר.

Acknowledgments

אנו מודים איימי מאיירס Quayson ESI עבור כישורים טכניים ועזרה. עבודה זו נתמכה בחלקה על ידי NSF 0216310 ו Givaudan Inc מענק (נר).

References

  1. Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia. J. Comp. Neurol. 377, 324-340 (1997).
  2. Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells. Neurosci. Lett. 277, 13-16 (1999).
  3. Caicedo, A., Jafri, M. S., Roper, S. D. In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells. J. Neurosci. 20, 7978-7985 (2000).
  4. Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. A reliable method to obtain cells of taste buds from fungiform papillae of mice. Acta Histochem. 112, 107-112 (2010).
  5. Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. A method for isolating and patch-clamping single mammalian taste receptor cells. Brain Res. 503, 326-329 (1989).
  6. Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes. Neuroscience. 106, 217-225 (2001).
  7. Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. Maintenance of rat taste buds in primary culture. Chem. Senses. 26, 861-873 (2001).
  8. Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. Analysis of cell lineage relationships in taste buds. J. Neurosci. 22, 4522-4529 (2002).
  9. Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. Characterization and long-term maintenance of rat taste cells in culture. Chem. Senses. 31, 279-290 (2006).
  10. Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. Characterization of Human Fungiform Papillae Cells in Culture. Chem. Senses. 36, 601-612 (2011).
  11. Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. Characteristics of odorant elicited calcium changes in cultured human olfactory neurons. J. Neurosci. Res. 62, 737-749 (2000).
  12. Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. Continuous culture of neuronal cells from adult human olfactory epithelium. J. Mol. Neurosci. 3, 137-146 (1992).
  13. Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro. Physiol. Genomics. 17, 179-192 (2007).
  14. Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population. Stem Cells Dev. 17, 1109-1121 (2008).
  15. Sandow, S. L., Grayson, T. H. Limits of isolation and culture: intact vascular endothelium and BKCa. Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).
בידוד והתרבות של האדם בחוש הטעם תאים Fungiform גבשושיות
Play Video
PDF DOI

Cite this Article

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).More

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter