Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

अलगाव और मानव कवकरूप की स्वाद Papillae सेल की संस्कृति

doi: 10.3791/3730 Published: May 17, 2012

Summary

हम अलग और बनाए रखने के मानव कवकरूप स्वाद papillae कोशिकाओं की लंबी अवधि के संस्कृतियों के लिए एक प्रतिलिपि प्रस्तुत करने योग्य प्रोटोकॉल विकसित करने के उद्देश्य से. से मानव कवकरूप papillae कक्ष बायोप्सी द्वारा प्राप्त सफलतापूर्वक आठ से अधिक अंश (12 महीने) के लिए संस्कृति में व्यवहार्यता की हानि के बिना बनाए रखा.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. मानव कवकरूप स्वाद Papillae प्राप्त

  1. चार से आठ जीभ के पूर्वकाल भाग घुमावदार वसंत microscissors के का उपयोग कर के पृष्ठीय सतह के से मानव कवकरूप के स्वाद papillae के निकालें.
  2. एक अलग समाधान में तुरंत जगह (26 मिमी 3 NaHCO, 2.5 मिमी नः 2 4 पीओ, 20 मिमी ग्लूकोज, 65 मिमी NaCl, 20 मिमी KCl, और 1 मिमी EDTA के nuclease मुक्त पानी में भंग और निष्फल फिल्टर).

2. लिए मानव कवकरूप स्वाद Papillae पाचन

मानव कवकरूप स्वाद कोशिका papillae के वियोजित मामूली अंतर के साथ दो अलग enzymatic पाचन प्रोटोकॉल का उपयोग कर सकते हैं.

  1. (1 मिलीग्राम / एमएल, सिग्मा Aldrich) pronase और 30-45 मिनट (1 प्रोटोकॉल) के लिए कमरे के तापमान पर (1 मिलीग्राम / एमएल सिग्मा Aldrich) इलास्टेज के साथ अलगाव समाधान में सेते हैं कवकरूप papillae.
  2. सेते हैं कवकरूप में Collagenase प्रकार मैं (550 / यू एमएल वोर्थिन्ग्तों से) के साथ papillae + (इलास्टेज 10 यू / एमएल पौधा से,hington) + 2 में 35 मिलीग्राम कैल्शियम मुक्त घंटी समाधान में trypsin अवरोध करनेवाला (0.9 मिलीग्राम / एमएल वोर्थिन्ग्तों से) डिग्री सेल्सियस 30 मिनट और 95% 2 हे / 5% सीओ 2 के साथ कोमल oxygenation के लिए संचलन के साथ पानी के स्नान (के लिए वैकल्पिक विधि पाचन, प्रोटोकॉल 2)
  3. ऊष्मायन के बाद, घंटी के साथ papillae धोने और 10 बार के लिए आग पॉलिश कांच पाश्चर विंदुक के साथ papillae महीन चुर्ण बनाना.
  4. यह आरटी पर 2500 rpm पर 3 मिनट के लिए और अपकेंद्रित्र अलगाव समाधान निकालने और स्वाद सेल संस्कृति माध्यम के 1 मिलीलीटर जोड़ें.
  5. गिलास पकवान में पचा कवकरूप papillae के स्थानांतरण.
  6. कवकरूप papillae धीरे काटना शल्य रेजर के साथ.
  7. चूहे की पूंछ कोलेजन टाइप 1 लेपित coverslip पर क्लोनिंग सिलेंडर में विच्छेदित papillae की 250 μl जोड़ें.
  8. एक अच्छी तरह स्वाद सेल संस्कृति माध्यम के 1 मिलीग्राम में जोड़ें.

3. मानव कवकरूप की स्वाद Papillae सेल का संवर्धन

  1. Humidified में 36 ° C पर थाली सेते हैंइनक्यूबेटर 5% सीओ 2 से युक्त.
  2. एक undisturbed इनक्यूबेटर में 2 पूरी मध्यम पहला परिवर्तन करने से पहले दिन के लिए रखें. स्वाद कोशिकाओं अंततः लेपित coverslip करने के लिए बाध्य होगा, हालांकि यह स्पष्ट रूप से 1 से 3 दिन में दिखाई नहीं हो सकता.
  3. प्लेट और मध्यम से क्लोनिंग सिलेंडर पूरी तरह से निकालें और एक अच्छी तरह के में स्वाद सेल माध्यम के 1 मिलीग्राम जोड़ने.
  4. हर मध्यम 6-7 दिन के 1/3 बदलें. क्या अधिक बार और / या पूरी तरह से बदल नहीं मध्यम.
  5. खुर्दबीन के नीचे हर दूसरे दिन सेल के विकास की जाँच करें. नई कोशिकाओं के अधिकांश सेल समूहों के नीचे हो जाना. सेल समूहों को आम तौर पर 2-3 सप्ताह संस्कृति में नव सृजित कोशिकाओं छोड़ने के बाद अलग.
  6. एक बार क्लोनिंग सिलेंडर की 40-50% स्वाद कोशिकाओं के विस्तार में शामिल किया गया है, 0.25% का उपयोग कर w / v trypsin / EDTA के 36 में 2-3 मिनट के लिए में कोशिकाओं trypsinize डिग्री सेल्सियस
  7. 15 मिलीलीटर ट्यूब में कुओं से कोशिकाओं को हस्तांतरण करने के लिए, स्वाद सेल संस्कृति माध्यम के 3 खंडों कमरा गुस्सा कम 5 मिनट के लिए 3000 rpm पर centrifugation के बाद जोड़ature.
  8. स्वाद सेल मध्यम के 1 मिलीग्राम के साथ कोशिकाओं resuspend सतह पर तैरनेवाला और निकालें.

4. मानव कवकरूप की स्वाद Papillae सेल के प्रसार

  1. T25 थाली में कोशिकाओं स्थानांतरण और स्वाद सेल मध्यम (0 बीतने) 4 मिलीलीटर जोड़ने. 36 ° humidified इनक्यूबेटर में सी सीओ 2 5% से युक्त कोशिकाओं को बनाए रखने.
  2. हर मध्यम 6-7 दिन के 1/3 बदलें जब तक सभ्य स्वाद कोशिकाओं 100% संगम तक पहुँच चुके हैं. इस समय, फसल के लिए स्वाद कोशिकाओं को सक्षम करने के लिए, कोशिकाओं बाँझ पीबीएस के साथ एक बार धोने फिर 2-3 मिनट के लिए 36 में 0.25% w / v trypsin / EDTA का उपयोग कोशिकाओं डिग्री सेल्सियस trypsinize
  3. Centrifugation के बाद के रूप में ऊपर वर्णित है, पूरा स्वाद सेल मध्यम और हस्तांतरण की कोशिकाओं में ताजा टी-75 बोतल (1 बीतने) resuspend.
  4. हर मध्यम 6-7 दिन के 1/3 बदलें. क्या अधिक बार और / या पूरी तरह से बदल नहीं मध्यम.
  5. दोहराना 4.3 और 4.4 कदम जब कोशिकाओं को 100% के करीब संगम तक पहुँच चुके हैं. 01:04 कमजोर पड़ने से कोई एक T75 कुप्पी में कोशिकाओं को विभाजितसमय के साथ कोशिकाओं की पर्याप्त वृद्धि को बनाए रखने के लिए.

5. बर्फ़ीली और विगलन संवर्धित मानव कवकरूप के स्वाद Papillae कक्ष

  1. प्राथमिक स्वाद कोशिकाओं के शेयरों को फ्रीज करने के लिए, trypsinization के बाद (4.2 कदम), 3 मिलीग्राम पूरा स्वाद सेल मध्यम और बाँझ 15 मिलीलीटर शंक्वाकार अपकेंद्रित्र ट्यूबों करने के लिए स्थानांतरण की कोशिकाओं को जोड़ने. कमरे के तापमान पर 5 मिनट के लिए 2500 rpm पर अपकेंद्रित्र.
  2. ठंड मध्यम युक्त 95% भ्रूण गोजातीय सीरम (FBS) और 5% DMSO के की उचित मात्रा के साथ ध्यान से सतह पर तैरनेवाला और धीरे resuspend के कोशिकाओं को हटाने.
  3. लेबल, बाँझ cryovials, कसकर टोपी, और एक ठंड isopropanol युक्त कंटेनर में जगह के लिए कोशिकाओं स्थानांतरण. कम से कम एक दिन पूर्व तरल नाइट्रोजन को अनिश्चित काल के हस्तांतरण के लिए के लिए एक -80 डिग्री सेल्सियस फ्रीजर में रखें.
  4. 37 में जमे हुए प्राथमिक मानव कवकरूप स्वाद papillae कोशिकाओं, जगह की एक शीशी पिघलना डिग्री सेल्सियस पानी स्नान अभी तक (लगभग 1 मिनट), thawed लामिना का प्रवाह सेल संस्कृति में काम करते हुएहुड.
  5. एक बाँझ 15 मिलीलीटर शंक्वाकार अपकेंद्रित्र ट्यूब कोशिकाओं और ठंड मध्यम स्थानांतरण और स्वाद सेल संस्कृति माध्यम के 5 मिलीलीटर जोड़ें.
  6. 2500 rpm पर कमरे के तापमान पर 5 मिनट के लिए कोशिकाओं अपकेंद्रित्र. ध्यान से पूरा स्वाद सेल संस्कृति माध्यम, और एक बाँझ ऊतक टी 25 संस्कृति फ्लास्क हस्तांतरण के साथ सतह पर तैरनेवाला, धीरे resuspend है कोशिकाओं त्यागने.
  7. संस्कृति कोशिकाओं के लिए चरण 3 से 4 के अनुसार जारी रखें.

6. प्रतिनिधि परिणाम

संस्कृति में स्वाद बायोप्सी बढ़ने का प्रयास सफल समय के 90% थे. बायोप्सी और पृथक्करण के बाद कुछ दिन, कोशिकाओं को आमतौर पर विकसित करने के लिए और विच्छेदित कवकरूप ऊतक के टुकड़े है कि हदबंदी प्रक्रिया के बाद बने रहे से बाहर की ओर पलायन करने लगे. हालांकि व्यक्ति की कोशिकाओं दिखाई चढ़ाना (चित्रा 1 ए) के बाद 24-48 घंटा थे, कोशिकाओं संलग्न सेल समूहों के तहत 2-3 सप्ताह के लिए बढ़ा है, कभी कभी बेटी कोशिकाओं (चित्रा 1 बी). बायोप्सी सेसंस्कृति में 4 सप्ताह में 8000 के कोशिकाओं आईएनजी 4-8 मानव कवकरूप papillae, प्राथमिक मानव कवकरूप के स्वाद papillae कोशिकाओं के प्रारंभिक आइसोलेट्स लगभग 2000 तक पहुँचने. अतिरिक्त 3-4 सप्ताह के लिए T25 सेल संस्कृति बोतल (0 बीतने) में विस्तार संस्कृति में मानव कवकरूप के स्वाद papillae कोशिकाओं अनुकूलित (चित्र 1C) में परिणाम होगा. प्राथमिक मानव कवकरूप के स्वाद papillae कोशिकाओं आगे संस्कृति में 3-4 सप्ताह (चित्रा 1D) में एक - पारित होने से कम से कम एक लाख की कोशिकाओं के ऊपर उपज का विस्तार कर सकते हैं. प्राथमिक स्वाद कोशिकाओं को अधिक से अधिक 8 मार्ग के लिए बढ़ती रहेगी.

सभ्य मानव संस्कृति में कवकरूप के स्वाद papillae कोशिकाओं की आकारिकी सुसंस्कृत chemosensory कोशिकाओं के समान था पहले 11,12 वर्णित .. सबसे सुसंस्कृत मानव कवकरूप के स्वाद papillae कोशिकाओं के साथ या बिना एक या एक से अधिक प्रक्रियाओं 15-30 दिनों के लिए उनके सेल शरीर के मूल कॉम्पैक्ट उपस्थिति को बनाए रखा. के बाद वे संगम सुसंस्कृत CE के सबसे तक पहुँचऔर LLS एक polarized है - लम्बी उपस्थिति था. परिपक्व स्वाद कोशिकाओं के कई अलग histological उपप्रकारों और एक्ज़िबिट स्वाद सेल विशिष्ट सुविधाओं से मिलकर. यहां हम बताते हैं कि इन संस्कृतियों के भीतर कोशिकाओं कई आणविक और शारीरिक परिपक्व स्वाद कोशिकाओं की विशेषता सुविधाओं प्रदर्शित. Gustducin और phospholipase सी - β2 के, (पीएलसी - β2) के mRNA के रिवर्स ट्रांसक्रिपटेस - पोलीमरेज़ चेन प्रतिक्रिया और अनुक्रमण द्वारा की पुष्टि की (चित्रा 2) उत्पादों के द्वारा पाया गया. Gustducin और पीएलसी β2 की अभिव्यक्ति immunocytochemically प्रकार द्वितीय की तरह कोशिकाओं (3 चित्रा बी और डी क्रमशः) की उपस्थिति का संकेत पाया गया. प्रसार और रिश्तेदार अभिव्यक्ति पैटर्न gustducin और पीएलसी β2 सेल संकेत दे रास्ते और सेल प्रकार को दर्शाती है ठीक है कि vivo में देखा प्रतिबिंबित नहीं करता. स्वाद कली के भीतर विभिन्न प्रकार की कोशिकाओं के सापेक्ष वितरण शासी कारकों अज्ञात हैं, और संस्कृति की स्थिति में नहीं हो सकता है दोहराया. इसलिए ख, संवर्धित कोशिकाओं और vivo में समकक्षों में उनके एक आण्विक स्तर पर स्थिति है जो चालाकी से किया जा सकता है और निगरानी के तहत इन विशेषताओं के विनियमन, जांच का अवसर प्रदान करते हैं के बीच समानताएँ और मतभेदों oth.

एक मॉडल प्रणाली के लिए एक महत्वपूर्ण कसौटी प्रासंगिक कार्यात्मक संपत्तियों की उपस्थिति है. संवर्धित कोशिकाओं को भी कई स्वाद उत्तेजनाओं (चित्रा 4) के उपयुक्त सांद्रता के जवाब में intracellular कैल्शियम में मजबूत वृद्धि का प्रदर्शन किया. इन अध्ययनों में, मीठा और कड़वा उत्तेजनाओं intracellular कैल्शियम में वृद्धि हुई है कि एक विध्रुवण के अनुरूप कर सकते हैं प्रकाश में लाना. संवर्धित कोशिकाओं के गुणों ये स्वाद की तरह सेल पर जोर दिया कि मॉडल प्रणाली हम यहाँ वर्णन पारगमन रास्ते और मानव स्वाद कोशिकाओं के पुनर्योजी क्षमता की आगे की पढ़ाई के लिए एक मूल्यवान संपत्ति हो जाएगा करने के लिए समर्थन उधार दे.

/ fig1.jpg ">
चित्रा 1 अनुलग्नक और सुसंस्कृत मानव कवकरूप के स्वाद papillae कोशिकाओं की आकारिकी. प्राथमिक मानव कवकरूप स्वाद papillae सेल कोलेजन टाइप 1 लेपित प्लेट पर विकसित संस्कृतियों 2 दिन () के बाद imaged थे. मानव कवकरूप स्वाद papillae कोशिकाओं संलग्न सेल समूहों, जो कोशिकाओं बेटी को जन्म देने के लिए लग रहा था के तहत 4 सप्ताह के लिए बढ़ा. कोशिकाओं को आम तौर पर चार सप्ताह के भीतर (बी) संगम में वृद्धि हुई, और (सी और डी) कटाई और क्रमशः reseeding के बाद 2 दिन और 4 सप्ताह का प्रतिनिधित्व करता है. संवर्धित कोशिकाओं को कम से कम 8 महीने के लिए निरंतर बढ़ती रही. स्केल सलाखों = 50 एनएम. चित्रा 1 के भाग भी Ozdener एट में प्रस्तुत किया गया था. अल 10.

चित्रा 2
चित्रा 2. RT-पीसीआर परिणाम विशिष्ट स्वाद सेल biomarker के mRNAs (gustducin और पीएलसी β2,) की उपस्थिति का प्रदर्शन किया. कुल सभ्य मानव कवकरूप कोशिकाओं से शाही सेना रिवर्स transcribed और RT-पीसीआर (Invitrogen) के लिए सुपरस्क्रिप्ट पहले Strand के संश्लेषण प्रणाली का उपयोग कर विशिष्ट gustducin और पीएलसी β2 में पता लगाने के लिए डिजाइन प्राइमरों के साथ amplifying द्वारा पीसीआर के लिए इस्तेमाल किया. प्राइमरों (तालिका 1) एक या एक से अधिक इंट्रोन्स अवधि के लिए चुने गए. प्रत्येक mRNA के सभ्य मानव 4 पारित होने या उम्मीद आकार के प्रवर्धन के उत्पादों के साथ, 5 अनुक्रमण द्वारा की पुष्टि से कवकरूप स्वाद papillae कोशिकाओं में पाया गया था. विशिष्ट mRNA नियंत्रण प्रयोगों में रिवर्स ट्रांसक्रिपटेस नहीं जीनोमिक डीएनए संदूषण का संकेत के बिना नहीं पाया गया. पीसीआर उत्पादों 2% agarose जैल पर अलग हो गए थे और जेल पर परिलक्षित उत्पादों एक रेजर के साथ excised गया. डीएनए QIAquick जेल निकालना किट (क्विएज़न) का उपयोग कर जेल से निकाला गया था. पीसीआर उत्पादों पेंसिल्वेनिया अनुक्रमण सुविधाओं के विश्वविद्यालय में अनुक्रम गया. C-पीसीआर और सी आर टी पीसीआर और रिवर्स ट्रांसक्रिपटेस के लिए नियंत्रण प्रयोगों हैं, क्रमशः. चित्रा 2 के भाग भी Ozdener एट में प्रस्तुत किया गया था. अल.

चित्रा 3
चित्रा 3 सभ्य मानव कवकरूप स्वाद papillae कोशिकाओं को 4 या 5 बीतने के Immunostaining. स्वाद सेल biomarkers की उपस्थिति देखी गई. सुसंस्कृत मानव कवकरूप के स्वाद papillae कोशिकाओं (5 दिन पुरानी है) 4% paraformaldehyde के साथ तय किया गया, और प्राथमिक एंटीबॉडी के साथ incubated (तालिका 2) रात भर 4 डिग्री सेल्सियस पर छवियाँ Leica टीसीएस SP2 लेजर confocal खुर्दबीन स्कैनिंग के साथ हासिल किया गया. लगभग, सुसंस्कृत कवकरूप स्वाद papillae कोशिकाओं के 60% के (बी) gustducin और पीएलसी β2 (डी) के साथ 20-30% के साथ लेबल रहे थे. इसी कोशिकाओं के प्रसारण छवियाँ (ए और सी) दिखाए जाते हैं. नियंत्रण के लिए, एंटीबॉडी विशिष्ट इम्मुनोग्लोबुलिन के साथ Immunostaining nonspecific इम्युनो जेट (नहीं दिखाया डेटा) का अभाव का प्रदर्शन किया. स्केल सलाखों = 50 एनएम. भागचित्रा 3 भी Ozdener एट में प्रस्तुत किया गया था. अल 10.

चित्रा 4
चित्रा 4. संवर्धित मानव 4 पारित होने या 5 से कवकरूप स्वाद papillae कोशिकाओं विभिन्न stimuli करने के लिए जवाब है. का सुसंस्कृत मानव कवकरूप के स्वाद papillae कोशिकाओं (4-5 दिन) के 1mm Fura 2 (आण्विक जांच) AM और 10 मिलीग्राम / एमएल Pluronic F127 (आण्विक जांच) के साथ भरी हुई थी. का सुसंस्कृत मानव कवकरूप के स्वाद papillae कोशिकाओं में intracellular कैल्शियम का स्तर ([सीए 2 +] मैं) में परिवर्तन मानक पुस्तिका इमेजिंग तकनीक का उपयोग कर मापा गया. कोशिकाओं कल्पना उत्तेजना तरंगदैर्य पर 340 एनएम और 380 एनएम के एक औंधा प्रतिदीप्ति खुर्दबीन और एक उत्सर्जन तरंगदैर्ध्य 510 एनएम पर केंद्रित एक बैंड पास फिल्टर द्वारा निर्धारित का उपयोग कर रहे थे. उत्तेजनाओं स्नान समाधान में भंग किया गया और फिर पीएच और osmolarity पुनः समायोजन अगर जरूरत है. सभ्य मानव कवकरूप स्वाद papillae कोशिकाओं मीठा और कड़वा stimuli करने के लिए प्रतिक्रिया व्यक्त की. जीraphs [2 सीए] के प्रतिनिधि प्रतिक्रियाओं का उदाहरण देकर स्पष्ट करने के लिए जोखिम (ए) Denatonium (2 मिमी), (बी) Sucralose (1 मिमी) के दौरान मैं व्यक्ति की कोशिकाओं में स्तर. प्रत्येक का पता लगाने के एक व्यक्ति की कोशिकाओं का प्रतिनिधित्व करता है.

जीन अनुक्रम पीसीआर हालत की उम्मीद आकार
(बीपी)
संदर्भ
β-Actin GGACTTCGAGCAAGAGATGG
AGCACTGTGTTGGCGTACAG
7 मिनट
45 सेकंड
45 सेकंड
45 सेकंड
7 मिनट
95
94
53
72
72
234 NM_001101.3
Gustducin TCTGGGTATGTGCCAAATGA
GGCCCAGTGTATTCTGGAAA
7 मिनट
45 सेकंड
45 सेकंड
45 सेकंड
7 मिनट
95
94
53
72
72
386 NM_001102386
PLC-β2 GTCACCTGAAGGCATGGTCT
TTAAAGGCGCTTTCTGCAAT
3 मिनट
30 सेकंड
30 सेकंड
60 सेकंड
7 मिनट
95
94
53
72
72
333 NM_004573

तालिका 1 प्राइमर्स और शर्तों स्वाद विशिष्ट अणु का पता लगाने के लिए इस्तेमाल किया.

प्राथमिक एंटीबॉडी स्रोत मेजबान मन्दन माध्यमिक एंटीबॉडी स्रोत मेजबान मन्दन
Gustducin सांताक्रूज खरगोश 1:500 विरोधी खरगोश आईजीजी 633 एलेक्सा आणविक जांच बकरी 1:500
पीएलसी β-2 सांताक्रूज खरगोश 1:500 विरोधी खरगोश आईजीजी 633 एलेक्सा आणविक जांच बकरी 1:500

तालिका 2. एंटीबॉडी विशिष्ट अणुओं की अभिव्यक्ति का पता लगाने के लिए इस्तेमाल किया.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

हम 8 से अधिक मार्ग के लिए मानव कवकरूप स्वाद papillae से प्राप्त कोशिकाओं को बनाए रखा है, 12 महीने की अवधि फैले. इन संस्कृतियों नई कोशिकाओं, जिनमें से कई चरण के लिए इन विट्रो में परिपक्व जहां वे परिपक्व स्वाद कली सेल प्रकार के कई मार्करों स्वाद रिसेप्टर कोशिकाओं के प्रमुख आणविक और शारीरिक गुणों के अलावा, व्यक्त उत्पन्न करते हैं. की उपस्थिति gustducin और PLC β2 संवर्धित कोशिकाओं के उपसमुच्चय में immunoreactivity. इस निष्कर्ष के साथ संगत है. सबसे महत्वपूर्ण बात है, कुछ कोशिकाओं intracellular कैल्शियम में क्षणिक वृद्धि के साथ मीठा और कड़वा स्वाद उत्तेजनाओं के आवेदन करने के लिए जवाब है, जो अलग स्वाद 5 कोशिकाओं, स्वाद कली 3 स्लाइसें और सुसंस्कृत मानव और चूहे स्वाद कोशिकाओं 19,10 में कोशिकाओं की एक विशेषता है. यह न केवल इंगित करता है कि संस्कृति में कोशिकाओं के कुछ मीठा और कड़वा के लिए आणविक रिसेप्टर्स व्यक्त की है, लेकिन है कि वे जी प्रोटीन युग्मित पारगमन झरना के लिए पर्याप्त था calci उत्पन्नप्रतिक्रियाओं उम.

लंबी अवधि के प्राथमिक सेल संस्कृतियों अक्सर मूल के ऊतकों और सेल संरचना और सेलुलर कारक हैं जो कोशिकाओं के शारीरिक समारोह में एक भूमिका निभा सकते नहीं बनाए रख सकते हैं. सफल मानव कवकरूप स्वाद papillae सेल संस्कृति की लंबी अवधि के स्थापना के द्वारा, महान प्रगति की गई है अभी तक, सीमाओं के एक नंबर का उल्लेख किया जाना चाहिए. अग्रणी इन में से एक है कि प्राथमिक संवर्धित कोशिकाओं के प्रत्येक बैच संस्कृति शुरू किया कोशिकाओं के प्रारंभिक आबादी में मतभेद के कारण भिन्न हो सकते हैं. प्राथमिक सेल संस्कृतियों अक्सर मूल ऊतक और संगठन संरचना और वृद्धि कारक है कि कोशिकाओं के शारीरिक समारोह में एक भूमिका निभा याद आती है. कोशिकाओं अक्सर अन्य कोशिकाओं के साथ संपर्क में हैं, नहीं हमेशा पूरी तरह से के रूप में संस्कृतियों 100% संगम को कभी बड़े हो रहे हैं. सामान्य में, प्राथमिक कोशिकाओं को भी भागों का एक समभाग अवस्था में वापिस आना करने के लिए विषय है, और गुणसूत्र अस्थिरता, निरंतर सेल ली में सेल प्रतिकृति के दौरान गुणसूत्रों के नुकसान या लाभ द्वारा विशेषताnes, एक और. 13,14,15 समस्या हो सकता है. जीभ के सुसंस्कृत nontaste कोशिकाओं के साथ सुसंस्कृत मानव कवकरूप कोशिकाओं की तुलना करने के लिए पता लगाया जाना चाहिए. इन सवालों के कई प्रयोगात्मक दृष्टिकोण और मॉडल प्रणाली के उपयोग की आवश्यकता होती है हमारी समझ से पहले पूरा हो गया है.

अंत में, इस प्रोटोकॉल यहाँ वर्णित प्रासंगिक सेल शारीरिक और आणविक विशेषताओं को खोने के बिना कम से कम 8 मार्ग (12 महीने) के लिए इन विट्रो में मानव कवकरूप स्वाद papillae कोशिकाओं को बनाए रखने की अनुमति देता है. इस लंबी अवधि के प्राथमिक संस्कृति के आगे विकास के प्रसार और भेदभाव, उत्तेजना विशिष्टता, पार बात और मानव स्वाद रिसेप्टर कोशिकाओं, के रूप में अच्छी तरह से ऊतक उत्थान के अनुकूलन के गुणों के अध्ययन के लिए एक मॉडल प्रणाली प्रदान करेगा. इसके अलावा, स्थिति है कि संक्रमण के रूप में स्वाद सेल समारोह ख़राब प्रभाव, दवाओं, विकिरण, विषाक्त या रासायनिक जोखिम आणविक और शारीरिक स्तर पर जांच किया जा सकता है.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

ब्याज की कोई संघर्ष की घोषणा की.

Acknowledgments

हम एमी मायर्स और तकनीकी कौशल और मदद के लिए ईएसआई Quayson धन्यवाद. इस काम में भाग 0216310 NSF और Givaudan इंक अनुदान (एनईआर) के द्वारा समर्थित किया गया था.

References

  1. Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia. J. Comp. Neurol. 377, 324-340 (1997).
  2. Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells. Neurosci. Lett. 277, 13-16 (1999).
  3. Caicedo, A., Jafri, M. S., Roper, S. D. In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells. J. Neurosci. 20, 7978-7985 (2000).
  4. Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. A reliable method to obtain cells of taste buds from fungiform papillae of mice. Acta Histochem. 112, 107-112 (2010).
  5. Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. A method for isolating and patch-clamping single mammalian taste receptor cells. Brain Res. 503, 326-329 (1989).
  6. Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes. Neuroscience. 106, 217-225 (2001).
  7. Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. Maintenance of rat taste buds in primary culture. Chem. Senses. 26, 861-873 (2001).
  8. Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. Analysis of cell lineage relationships in taste buds. J. Neurosci. 22, 4522-4529 (2002).
  9. Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. Characterization and long-term maintenance of rat taste cells in culture. Chem. Senses. 31, 279-290 (2006).
  10. Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. Characterization of Human Fungiform Papillae Cells in Culture. Chem. Senses. 36, 601-612 (2011).
  11. Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. Characteristics of odorant elicited calcium changes in cultured human olfactory neurons. J. Neurosci. Res. 62, 737-749 (2000).
  12. Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. Continuous culture of neuronal cells from adult human olfactory epithelium. J. Mol. Neurosci. 3, 137-146 (1992).
  13. Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro. Physiol. Genomics. 17, 179-192 (2007).
  14. Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population. Stem Cells Dev. 17, 1109-1121 (2008).
  15. Sandow, S. L., Grayson, T. H. Limits of isolation and culture: intact vascular endothelium and BKCa. Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).
अलगाव और मानव कवकरूप की स्वाद Papillae सेल की संस्कृति
Play Video
PDF DOI

Cite this Article

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).More

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter