Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

Isolamento e Cultura de Células Papila fungiforme Humanos Taste

doi: 10.3791/3730 Published: May 17, 2012

Summary

Nosso objetivo foi desenvolver um protocolo reprodutível para isolar e manter a longo prazo culturas de células humanas fungiformes papilas gustativas. As células de humano papilas fungiformes obtidos por biópsia com êxito foram mantidas em cultura durante mais de oito passagens (12 meses) sem perda de viabilidade.

Abstract

Células de sabor são altamente especializados, com únicas histológicos, características moleculares e fisiológicas que permitem a detecção de uma ampla gama de estímulos simples e moléculas químicas complexas contidos nos alimentos. Em humanos papilas fungiformes, individual contêm de zero a até 20 papilas gustativas. Não há protocolo estabelecido para a cultura de células humanas de sabor, embora a capacidade de manter as células sabor papilas em cultura durante vários ciclos celulares seria de utilidade considerável para caracterizar as propriedades moleculares, regenerativa, e funcional destas células únicas sensoriais. Estudos anteriores de células gustativas ter sido feito usando recém células isoladas em cultura primária, as culturas de explante de roedores, ou gomos semi-intactas gosto em fatias de tecido 1,2,3,4. Embora cada uma destas preparações tem vantagens, o desenvolvimento de culturas a longo prazo teria fornecido benefícios significativos, particularmente para os estudos de gosto a proliferação celular e diferentiation. Vários grupos, inclusive o nosso, têm sido interessados ​​no desenvolvimento e estabelecimento de modelos de cultura de células gustativas. A maioria das tentativas de células gustativas cultura relataram viabilidade limitada, com células normalmente não duradouros além d 3-5 5,6,7,8. Nós recentemente relatado em um método de sucesso para a cultura prolongada de células de roedores gustativas 9. Nós relatamos aqui pela primeira vez o estabelecimento de um sistema de cultura in vitro de células humanas isoladas fungiformes papilas gustativas. As células de humano papilas fungiformes obtidos por biópsia com êxito foram mantidas em cultura durante mais de oito passagens (12 meses) sem perda de viabilidade. Células exibido muitas características moleculares e fisiológicos característicos de células sabor maduros. Gustducin e fosfolipase C β2, (PLC-β2) ARNm foram detectados em muitas células por reacção em cadeia da polimerase com transcriptase reversa e confirmado por sequenciação. Análise imunocitoquímica demonstrou a presença de rajadaducin e PLC-β2 expressão em células gustativas cultivadas. Culturas de células de fungiformes humanos também exibiram aumentos na concentração de cálcio intracelular em resposta a concentrações apropriadas de estímulos de sabor, indicando que vários receptores de sabor e pelo menos algumas das vias de sinalização estavam presentes. Estes resultados indicam que as células suficientes sabor a partir de seres humanos adultos pode ser gerado e mantido durante pelo menos oito passagens. Muitas das células retêm as características fisiológicas e bioquímicas de células agudamente isoladas a partir do epitélio sabor adulto para apoiar a sua utilização como um sistema modelo gosto. Este sistema irá permitir estudos mais detalhados de os processos envolvidos na diferenciação, proliferação e função das células receptoras de mamíferos sabor num na preparação in vitro.

Papilas fungiformes gosto humano utilizado para estabelecer cultura de células humanas fungiformes foram doados para pesquisa após consentimento informado apropriado ao abrigo de protocolos de pesquisa que foram analisadase aprovado pelo comitê de IRB. O protocolo (# 0934) foi aprovado por Schulman Associates Institucional Review Board Inc., Cincinnati, OH. Protocolo escrito abaixo é baseado em parâmetros publicados relatados por Ozdener et al. 2011 10.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Obtenção de Papilas gustativas humanas fungiformes

  1. Remover 4-8 papilas gosto humano fungiformes a partir da superfície dorsal da porção anterior da língua usando microtesoura mola curvos.
  2. Colocar-se imediatamente para uma solução de isolamento (26 mM de NaHCO3, 2,5 mM de NaH 2 PO 4, 20 mM de glucose, 65 mM de NaCl, 20 mM de KCl, 1 mM de EDTA e dissolvido em água livre de nuclease e esterilizado por filtração).

2. Digestão humana fungiformes Papilas Taste

Human papilas fungiformes célula gosto pode ser dissociada usando dois diferentes protocolos de digestão enzimática com ligeiras diferenças.

  1. Incubar papilas fungiformes em solução de isolamento com pronase (1 mg / ml, Sigma Aldrich) e elastase (1 mg / ml Sigma Aldrich) à temperatura ambiente durante 30-45 min (protocolo 1).
  2. Incubar papilas fungiformes com colagenase tipo I (550 U / mL, a partir de Worthington) + elastase (10 U / mL, a partir de Worthington) + inibidor de tripsina (0,9 mg / mL, a partir de Worthington) em 2 ml de solução de Ringer de cálcio livre em 35 ° C Método banho de água com circulação durante 30 minutos e oxigenação suave com 95% O2 / 5% de CO 2. (Alternativa para digestão, o protocolo 2)
  3. Após a incubação, lavar papilas com campainha e triturar as papilas com fogo polido pipeta Pasteur de vidro por 10 vezes.
  4. Centrifugar durante 3 minutos a 2500 rpm à temperatura ambiente e remover a solução de isolamento e adicionar 1 ml de meio de cultura de células sabor.
  5. Transferência digerido papilas fungiformes em prato de vidro.
  6. Dissecar papilas fungiformes suavemente com lâmina cirúrgica.
  7. Adicionar 250 ul de papilas dissecado em cilindro de clonagem para rato lamela colágeno tipo rabo-1 revestido.
  8. Adicionar 1 ml de meio de cultura de células sabor em cada poço.

3. A cultura de células humanas fungiformes Papila Gosto

  1. Incubar em placas a 36 ° C numa atmosfera húmidaincubadora contendo 5% de CO 2.
  2. Colocar numa incubadora em repouso durante 2 dias antes da primeira mudança de meio completo. Células gustativas acabará por se ligar à lamela revestida, embora possa não ser claramente visíveis em 1 a 3 dias.
  3. Remover cilindro de clonagem a partir de chapa e meio completamente e adicionar 1 ml de meio de células sabor em cada poço.
  4. Substitua 1/3 da média a cada 6-7 dias. Não altere médio com mais freqüência e / ou completamente.
  5. Verifique o crescimento de células ao microscópio em dias alternados. A maioria das novas células crescem por baixo agrupamentos de células. Agrupamentos de células normalmente separar após 2-3 semanas em cultura deixando as células recém-gerado.
  6. Uma vez que 40-50% do cilindro de clonagem é coberto na expansão de células sabor, trypsinize células usando 0,25% w / v de tripsina / EDTA durante 2-3 minutos a 36 ° C.
  7. Transferir as células a partir de poços em 15 ml tubos, adicionar 3 volumes de sabor meio de cultura celular, seguido por centrifugação a 3000 rpm durante 5 minutos a têmpera quartotura.
  8. Remover sobrenadante e ressuspender as células com 1 ml de meio de células sabor.

4. Propagação de células Papila fungiforme Humanos Taste

  1. Transferir as células em placa de T25 e adicionar 4 ml de meio de sabor célula (passagem 0). Manter as células a 36 ° C numa incubadora humidificada contendo 5% de CO 2.
  2. Substituir 1/3 do meio a cada 6-7 dias até que as células cultivadas de sabor atingiram confluência de 100%. Neste momento, para permitir que as células sabor para a colheita, lavar as células uma vez com PBS estéril, em seguida, trypsinize células usando 0,25% w / v de tripsina / EDTA durante 2-3 minutos a 36 ° C.
  3. Após centrifugação como descrito acima, ressuspender em meio completo e as células sabor célula de transferência para frescos T-75 frascos (passagem 1).
  4. Substitua 1/3 da média a cada 6-7 dias. Não altere médio com mais freqüência e / ou completamente.
  5. Repita o passo 4,3 e 4,4 quando as células atingiram perto de 100% de confluência. Dividir as células a não mais do que a diluição de 1:4 em um balão T75para manter o crescimento adequada das células ao longo do tempo.

5. Congelamento e descongelamento humanas cultivadas fungiformes Células Papila Gosto

  1. Para congelar estoques de células gustativas primárias, após tripsinização (passo 4.2), adicionar 3 ml de meio de célula completa gosto e transferir as células para estéreis 15 ml tubos de centrífuga cônicos. Centrifugar a 2500 rpm durante 5 min à temperatura ambiente.
  2. Cuidadosamente remover as células sobrenadante e ressuspender suavemente com um volume adequado de meio de congelação contendo 95% de soro fetal bovino (FBS) e DMSO a 5%.
  3. Transferência de células para rotulado estéril criotubos, cap, firmemente, e coloque em um recipiente de congelamento contendo isopropanol. Colocar num congelador -80 ° C durante pelo menos um dia antes de transferir indefinidamente para azoto líquido.
  4. Para descongelar um frasco de congelados humanas primárias fungiformes células sabor, papilas lugar a 37 ° C banho de água até que apenas descongelado (aproximadamente 1 minuto), enquanto que a trabalhar numa cultura de células de fluxo laminarcapa.
  5. Transferir as células e meio de congelamento a um 15 ml estéril tubo de centrífuga cónico e adicionam-se 5 ml de meio de cultura de células sabor.
  6. Centrifugar células a 2500 rpm durante 5 min à temperatura ambiente. Com cuidado, elimine o sobrenadante, as células Volte a suspender suavemente com completa meio de cultura de células gosto, e transferir para um frasco estéril cultura T-25 dos tecidos.
  7. Continuar a células de cultura de acordo com o Passo 3 a 4.

6. Os resultados representativos

Tentativas para crescer em cultura de sabor biópsias foram bem sucedidos 90% do tempo. Alguns dias após a biópsia e dissociação, as células tipicamente começou a crescer e migrar para o exterior a partir dos pedaços de tecido dissecado fungiformes que permaneceram após o procedimento de dissociação. Embora as células individuais eram visíveis 24-48 hr após o plaqueamento (Figura 1A), as células cresceram até 2-3 semanas sob agrupamentos de células ligadas, ocasionalmente gerar células filhas (Figura 1B). De biópsiaing 4-8 humana papilas fungiformes, isolados iniciais de células humanas primárias fungiformes papilas gustativas atingem aproximadamente 2000 - 8000 células em 4 semanas em cultura. Expansão em frascos de cultura de células T25 (passagem 0) para 3-4 semanas adicionais irá resultar em ter humanos fungiformes células papilas gustativas em cultura adaptado (Figura 1C). Humanas primárias fungiformes células papilas gustativas podem ainda ser expandidas em cultura para se obter para cima de pelo menos um milhão de células por passagem-1 em 3-4 semanas (Figura 1D). Células gustativas primárias continuará a crescer para mais de 8 passagens.

A morfologia das células humanas cultivadas fungiformes gustativas papilas em cultura foi semelhante à cultura de células quimio descrito anteriormente 11,12 .. A maioria humanas cultivadas fungiformes células papilas gustativas mantiveram a sua aparência original compacto de corpos celulares, com ou sem um ou mais processos até 15-30 dias. Depois de terem atingido confluência a maior parte do ce cultivadasLLS tinha uma aparência polarizada-alongada. Células gustativas maduros composto de vários diferentes subtipos histológicos e características apresentam sabor celulares específicos. Aqui nós mostramos que as células dentro destas culturas exibir muitas características moleculares e fisiológicos característicos das células gustativas maduros. Gustducin e fosfolipase C - β2, (PLC-β2) ARNm foram detectados por reacção em cadeia da polimerase com transcriptase reversa e produtos confirmados por sequenciação (Figura 2). Expressão de gustducin e PLC-β2 foi detectada imunocitoquimicamente indicando a presença de tipo II-, como as células (Figura 3 B e D, respectivamente). A prevalência e padrões de expressão relativa de gustducin e PLC-β2 refletindo vias celulares de sinalização e tipos de células não reflectir exactamente observada in vivo. Os factores que regulam a distribuição relativa dos diferentes tipos de células dentro de um botão de sabor são desconhecidos, e não pode ser replicado nas condições de cultura. Portanto, b oth as semelhanças e diferenças entre as células cultivadas e seus homólogos em vivo proporcionam uma oportunidade para examinar a regulamentação destas características em um nível molecular, em condições que podem ser manipulados e monitorados.

Um critério importante para um sistema modelo é a presença de relevantes propriedades funcionais. Células de cultura também exibiram aumentos robustos no cálcio intracelular em resposta a concentrações apropriadas de estímulos de sabor vários (Figura 4). Nestes estudos, o estímulo doce e amargo eliciar um aumento de cálcio intracelular, que pode corresponder a uma despolarização. Estas células, como gosto propriedades das células cultivadas dar apoio à afirmação de que o sistema modelo que descrevemos aqui será um recurso valioso para estudos das vias de transdução ea capacidade regeneradora das células gustativas humanas.

fig1.jpg "/>
Figura 1. Apego e morfologia de células humanas cultivadas fungiformes papilas gustativas. Humanas primárias fungiformes gustativas culturas papilas de células cultivadas em placas de colagénio tipo-1 revestidos foram fotografadas após 2 dias (a). Humanos fungiformes células papilas gustativas cresceu para até 4 semanas em grupos de células unidas, que pareciam dar origem a células-filhas. As células cresceram até à confluência tipicamente dentro de quatro semanas (B), e (C e D) representa dias 2 e 4 semanas após a colheita e reseeding respectivamente. Células de cultura continuou a crescer durante pelo menos 8 meses. Barra de escala = 50 nm. Parte da Figura 1 foi também apresentado na Ozdener et. ai. 10.

A Figura 2
Figura 2. RT-PCR, os resultados demonstraram a presença de células específicas de sabor mRNAs de biomarcadores (gustducin e PLC-β2,). RNA total de cultura de células humanas fungiformes foi transc reversoribed utilizando o Sistema de Síntese Superscript Primeiro Strand para RT-PCR (Invitrogen) e usado para a PCR, amplificando com primers específicos concebidos para a detecção de gustducin e PLC-β2. Os iniciadores (Tabela 1) foram escolhidos para abranger um ou mais intrões. Cada mRNA foi detectada em culturas de células humanas fungiformes gustativas papilas de passagem 4 ou 5 com produtos de amplificação do tamanho esperado, confirmado por sequenciação. MRNA específico não foi detectada em experiências de controlo sem transcriptase reversa indicando que não há contaminação de ADN genómico. Os produtos de PCR foram separados em géis de agarose a 2% e os produtos amplificados no gel foram excisadas com uma lâmina de barbear. O DNA foi extraído a partir do gel utilizando QIAquick Gel Extraction Kit (Qiagen). Os produtos de PCR foram sequenciados na Universidade de instalações Pensilvânia de sequenciação. C-PCR e C-RT são experiências de controlo para a PCR e transcriptase reversa, respectivamente. Parte da Figura 2 foi também apresentado na Ozdener et. ai.

A Figura 3
Figura 3. Imunocoloração de culto fungiformes gosto humano papilas passagem células 4 ou 5 mostrou a presença de biomarcadores celulares gosto. Humanas cultivadas fungiformes células sabor papilas (5 dias de idade) foram fixadas com paraformaldeído a 4%, e incubados com anticorpos primários (Tabela 2) durante a noite a 4 ° C. As imagens foram adquiridas com um SCT-SP2 confocal Leica microscópio de varredura por laser. Aproximadamente, 60% de culturas de células fungiformes papilas gustativas foram marcadas com gustducin (B) e 20-30% com PLC-β2 (D). Imagens de transmissão de células correspondentes são mostradas (A e C). Para os controlos, imunocoloração com anticorpo específico de imunoglobulina demonstraram a ausência de reactividade imuno inespecífica (dados não mostrados). Barra de escala = 50 nm. Parteda Figura 3 foi também apresentado na Ozdener et. ai. 10.

A Figura 4
Figura 4. Humanas cultivadas células gustativas fungiformes papilas de passagem 4 ou 5 respondem a estímulos diferentes. Humanas cultivadas fungiformes células sabor papilas (4-5 dias de idade) foram carregados com 1 mM de Fura-2 AM (Molecular Probes) e 10 mg / ml de Pluronic F127 (Molecular Probes). Alterações nos níveis de cálcio intracelular ([Ca 2 +] i) em culturas de células humanas fungiformes papilas gustativas foram medidos usando técnicas de imagem padrão manuais. As células foram visualizadas utilizando um microscópio invertido de fluorescência em comprimentos de onda de excitação de 340 nm e 380 nm e um comprimento de onda de emissão estabelecido por um filtro passa banda centrada a 510 nm. Os estímulos foram dissolvidos em solução do banho e, em seguida, o pH ea osmolaridade reajustado, se necessário. Humanas cultivadas células papilas gustativas fungiformes respondeu a estímulos doce e amargo. Graphs ilustram as respostas representativas de [2] i Ca níveis em células individuais durante a exposição a (A) denatónio (2 mM), (B) A sucralose (1 mM). Cada traço representa únicas células individuais.

Gene Seqüência Condição PCR O tamanho esperado
(Pb)
Referência
β-Actina GGACTTCGAGCAAGAGATGG
AGCACTGTGTTGGCGTACAG
7 min
45 seg
45 seg
45 seg
7 min
95
94
53
72
72
234 NM_001101.3
Gustducin TCTGGGTATGTGCCAAATGA
GGCCCAGTGTATTCTGGAAA
7 min
45 seg
45 seg
45 seg
7 min
95
94
53
72
72
386 NM_001102386
PLC-β2 GTCACCTGAAGGCATGGTCT
TTAAAGGCGCTTTCTGCAAT
3 min
30 seg
30 seg
60 seg
7 min
95
94
53
72
72
333 NM_004573

Tabela 1. Primers e condições utilizadas para a detecção de moléculas de sabor específico.

O anticorpo primário Fonte Anfitrião Diluição Anticorpo secundário Fonte Anfitrião Diluição
Gustducin Santacruz Coelho 1:500 Anti-IgG de coelho Alexa 633 Molecular Probes Cabra 1:500
PLC-2 β Santacruz Coelho 1:500 Anti-IgG de coelho Alexa 633 Molecular Probes Cabra 1:500

Anticorpos Tabela 2. Utilizado para detecção da expressão de moléculas específicas.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Temos mantido células obtidas a partir de papilas humano fungiformes sabor durante mais de 8 passagens, abrangendo um período de 12 meses. Estas culturas gerar novas células, muitos dos quais amadurecem in vitro para a fase em que expressam vários marcadores de maduros gustativas tipos de células da gema, para além de chave propriedades moleculares e fisiológicos de células receptoras gustativas. A presença de gustducin e PLC-β2 imunorreactividade em subconjuntos de células de cultura é consistente com esta conclusão. Mais importante ainda, algumas células responderam aos pedidos de estímulos sabor doce e amargo com aumentos transitórios na concentração de cálcio intracelular, que é uma característica de células sabor dissociados 5, as células em fatias de sabor de gema 3 e humanos cultivadas e as células sabor de ratos 19,10. Isto indica não só que algumas das células em cultura expressa receptores moleculares para doce e amargo, mas que tinham o suficiente da cascata de transdução de proteína G acoplada para gerar calcihum respostas.

A longo prazo de culturas de células primárias, muitas vezes não é possível manter o tecido original e estrutura da célula e factores celulares que podem desempenhar um papel na função fisiológica de células. Ao estabelecimento de longo prazo de sucesso humano fungiformes cultura de células gosto papilas, um grande progresso foi feito ainda, uma série de limitações deve ser mencionado. O primeiro deles é que cada lote de células primárias de cultura pode variar devido a diferenças na população inicial de células utilizadas para iniciar a cultura. Culturas de células primárias, muitas vezes perca a organização do tecido original e estrutura e factores de crescimento que desempenham um papel na função fisiológica de células. As células são muitas vezes não sempre e inteiramente em contacto com outras células, como culturas nunca são crescidas até à confluência de 100%. Em geral, as células primárias são também sujeitos a desdiferenciação, e instabilidade cromossômica, caracterizada por perda ou ganho de cromossomas durante a replicação celular em contínuo de células lines, pode ser outro problema 13,14,15. A comparação de culturas de células humanas com células fungiformes nontaste cultas da língua precisa ser explorado. Estas questões vão exigir o uso de muitas abordagens experimentais e sistemas de modelo antes de nossa compreensão é completa.

Em conclusão, este protocolo descrito aqui permite manter os humanos fungiformes papilas gustativas células in vitro, pelo menos, 8 passagens (12 meses), sem perder as características relevantes de células-fisiológicos e moleculares. O desenvolvimento desta cultura a longo prazo primária irá fornecer um sistema modelo para estudos de proliferação e diferenciação, a especificidade do estímulo, conversa cruzada e propriedades de adaptação de células sabor humanos receptores, bem como regeneração de tecidos. Além disso, os efeitos das condições que prejudicam a função de células sabor tal como a infecção, os medicamentos, radiação, exposição a toxinas ou química pode ser examinada ao nível molecular e fisiológico.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Não há conflitos de interesse declarados.

Acknowledgments

Agradecemos Aimee Myers e Quayson Esi de competências técnicas e de ajuda. Este trabalho foi apoiado em parte pela NSF 0216310 e Inc Givaudan subvenção (NER).

References

  1. Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia. J. Comp. Neurol. 377, 324-340 (1997).
  2. Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells. Neurosci. Lett. 277, 13-16 (1999).
  3. Caicedo, A., Jafri, M. S., Roper, S. D. In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells. J. Neurosci. 20, 7978-7985 (2000).
  4. Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. A reliable method to obtain cells of taste buds from fungiform papillae of mice. Acta Histochem. 112, 107-112 (2010).
  5. Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. A method for isolating and patch-clamping single mammalian taste receptor cells. Brain Res. 503, 326-329 (1989).
  6. Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes. Neuroscience. 106, 217-225 (2001).
  7. Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. Maintenance of rat taste buds in primary culture. Chem. Senses. 26, 861-873 (2001).
  8. Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. Analysis of cell lineage relationships in taste buds. J. Neurosci. 22, 4522-4529 (2002).
  9. Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. Characterization and long-term maintenance of rat taste cells in culture. Chem. Senses. 31, 279-290 (2006).
  10. Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. Characterization of Human Fungiform Papillae Cells in Culture. Chem. Senses. 36, 601-612 (2011).
  11. Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. Characteristics of odorant elicited calcium changes in cultured human olfactory neurons. J. Neurosci. Res. 62, 737-749 (2000).
  12. Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. Continuous culture of neuronal cells from adult human olfactory epithelium. J. Mol. Neurosci. 3, 137-146 (1992).
  13. Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro. Physiol. Genomics. 17, 179-192 (2007).
  14. Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population. Stem Cells Dev. 17, 1109-1121 (2008).
  15. Sandow, S. L., Grayson, T. H. Limits of isolation and culture: intact vascular endothelium and BKCa. Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).
Isolamento e Cultura de Células Papila fungiforme Humanos Taste
Play Video
PDF DOI

Cite this Article

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).More

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter