Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

Isolering och kultur mänskliga papiller Fungiform smak celler

doi: 10.3791/3730 Published: May 17, 2012

Summary

Vi syftade till att utveckla en reproducerbar protokoll för att isolera och bibehålla långsiktiga kulturer av mänskliga papiller fungiform smak celler. Celler från mänsklig fungiform papiller som erhållits genom biopsi framgångsrikt upprätthölls i kultur under mer än åtta passager (12 månader) utan förlust av livskraft.

Abstract

Smak celler är mycket specialiserade, med unika histologiska och molekylära och fysiologiska egenskaper som medger detektering av ett brett spektrum av enkla stimuli och komplexa molekyler kemiska finns i livsmedel. I human, individuell fungiform papiller innehåller från noll till så många som 20 smaklökar. Det finns ingen etablerat protokoll för odling av humana smak celler, även om förmågan att upprätthålla celler smak papiller i kultur för flera cellcykler skulle vara av stor användbarhet för att karakterisera de molekylära, regenerativ och funktionella egenskaperna hos dessa unika sensoriska celler. Tidigare studier smak celler har gjorts med hjälp nybakade isolerade celler i primär kultur, explantatodlingarna från gnagare, eller semi-intakta smaklökar i vävnadssnitt 1,2,3,4. Även om vart och ett av dessa preparat har fördelar, skulle utvecklingen på lång sikt kulturer har gett betydande fördelar, särskilt för studier av smak celltillväxt och differentiation. Flera grupper, inklusive vår, har varit intresserade av utvecklingen och inrättandet av kultur smak cellmodeller. De flesta försök till celler kultur smak har rapporterat begränsad viabilitet, med celler normalt inte varar längre än 3-5 d. 5,6,7,8. Vi rapporterade nyligen om en framgångsrik metod för förlängd odling av celler gnagare smak 9. Vi rapporterar här för första gången inrättandet av ett in vitro odlingssystem för isolerade humana papiller fungiform smak celler. Celler från mänsklig fungiform papiller som erhållits genom biopsi framgångsrikt upprätthölls i kultur under mer än åtta passager (12 månader) utan förlust av livskraft. Celler visade många molekylära och fysiologiska egenskaper som kännetecknar mogna smak celler. Gustducin och fosfolipas C β2, (PLC-β2)-mRNA detekterades i många celler genom omvänd transkriptas-polymeras kedjereaktion och bekräftades genom sekvensering. Immunocytokemi analys påvisade närvaron av vindstötensducin och PLC-β2 uttryck i odlade celler smak. Odlade humana fungiform celler uppvisade också ökningar i intracellulärt kalcium som svar på lämpliga koncentrationer av flera smak stimuli som indikerar att smakreceptorer och åtminstone en del av de signalvägar var närvarande. Dessa resultat räcker indikerar att smak celler från vuxna människor kan skapas och upprätthållas under minst åtta passager. Många av cellerna behåller fysiologiska och biokemiska egenskaper hos akut isolerade celler från vuxna smaken epitelet för att stödja deras användning som en modell smak system. Detta system kommer att möjliggöra ytterligare studier av de processer som ingår i proliferation, differentiering och funktion av däggdjursceller smak receptor i en in vitro beredning.

Human fungiform smak papiller som används för att fastställa den mänskliga kulturen fungiform cell donerade för forskning efter vederbörligt informerat samtycke i enlighet med forskning protokoll som har granskatsoch godkänts av IRB utskottet. Protokollet (# 0934) godkändes av Schulman Associates Institutional Review Board Inc., Cincinnati, OH. Skriftligt protokoll nedan är baserad på publicerade parametrar som rapporterats av Ozdener et al. 2011 10.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Skaffa Human papiller Fungiform Taste

  1. Avlägsna 07:56 humant papiller fungiform smak från den dorsala ytan av den främre delen av tungan med användning krökt fjäder mikrosax.
  2. Rum omedelbart in i en isolerad lösning (26 mM NaHCOs 3, 2,5 mM NaH 2 PO 4, 20 mM glukos, 65 mM NaCl, 20 mM KCl och 1 mM EDTA upplöstes i nukleas-fritt vatten och filtersteriliseras).

2. Human Fungiform Smak papiller Digerering

Human fungiform smaken cellen papiller kan skiljas med hjälp av två olika enzymatisk spjälkning protokoll med små skillnader.

  1. Inkubera fungiform papiller isolerat lösning med pronas (1 mg / ml, Sigma Aldrich) och elastas (1 mg / ml Sigma Aldrich) vid rumstemperatur under 30-45 min (protokoll 1).
  2. Inkubera fungiform papiller med kollagenas typ I (550 U / ml, från Worthington) + elastas (10 U / ml, från Vörtenshington) + trypsin-inhibitor (0,9 mg / ml, från Worthington) i 2 ml kalcium fri Ringer-lösning i 35 ° C vattenbad med cirkulation under 30 minuter och varsam syresättning med 95% O2 / 5% CO2. (Alternativ metod för matsmältningen, protokoll 2)
  3. Efter inkubation tvättas papiller med Ringer och mal sönder papiller med eld polerat glas Pasteur pipett för 10 gånger.
  4. Centrifugera det för 3 minuter vid 2500 rpm vid RT och ta bort isolering lösning och tillsätt 1 ml av smak cellodlingsmedium.
  5. Överför ned fungiform papiller i glasskål.
  6. Dissekera fungiform papiller försiktigt med kirurgiska rakkniv.
  7. Tillsätt 250 ul av de dissekerade papiller kloning cylindern på råttsvanskollagen typ-1 belagd täckglas.
  8. Tillsätt 1 ml smak cellodlingsmedium i varje brunn.

3. Odling av mänskliga papiller Fungiform smak celler

  1. Inkubera plattan vid 36 ° C i en fuktadinkubator innehållande 5% CO2.
  2. Placera i en inkubator ostört i 2 dagar före den första ändringen av komplett medium. Smak celler kommer så småningom att binda till den belagda täckglaset, även om det kanske inte tydligt i 1 till 3 dagar.
  3. Ta bort kloning cylinder från plattan och medelstora helt och tillsätt 1 ml av smak cellmedium i varje brunn.
  4. Byt 1/3 av medium var 6-7 dagar. Ändra inte på medellång oftare och / eller helt.
  5. Kontrollera celltillväxt under mikroskop varannan dag. De flesta av de nya cellerna växa under cell kluster. Cellkluster bort vanligen efter 2-3 veckor i kultur lämnar nyligen genererade cellerna.
  6. Gång 40-50% av den klonings-cylindern är täckt av expanderande smak celler, Trypsinisera celler med användning av 0,25% vikt / vol trypsin / EDTA under 2-3 minuter vid 36 ° C.
  7. Överföra celler från brunnar i 15 ml rör, tillsätt 3 volymer smak cellodlingsmedium följt av centrifugering vid 3000 rpm under 5 minuter vid rumstemperaturenperatur.
  8. Avlägsna supernatanten och resuspendera cellerna med 1 ml av smak cellmedium.

4. Förökning av mänskliga papiller Fungiform smak celler

  1. Överför celler i T25 plattan och tillsätt 4 ml av smak cell medium (passage 0). Bibehålla cellerna vid 36 ° C i en fuktad inkubator innehållande 5% CO2.
  2. Byt 1/3 av medium var 6-7 dagar tills odlade smak celler har nått 100% konfluens. Vid denna tidpunkt, för att möjliggöra smak celler till skörd, tvätta cellerna en gång med steril PBS Trypsinisera därefter celler med användning av 0,25% vikt / vol trypsin / EDTA under 2-3 minuter vid 36 ° C.
  3. Efter centrifugering såsom beskrivits ovan, återsuspendera i komplett smak cellmedium och celler överföring till färska T-75 flaskor (passage 1).
  4. Byt 1/3 av medium var 6-7 dagar. Ändra inte på medellång oftare och / eller helt.
  5. Upprepa steg 4,3 och 4,4 när cellerna har nått nästan 100% konfluens. Dela celler till ej mer än 1:4 spädning i en T75-flaskaför att upprätthålla adekvat tillväxt av cellerna med tiden.

5. Frysning och upptining Odlade mänskliga Fungiform celler Taste papiller

  1. Att frysa lager av primära smak celler, efter trypsinisering (steg 4,2), tillsätt 3 ml komplett medium smak cell och celler överföring till sterila 15 ml koniska centrifugrör. Centrifugera vid 2500 rpm under 5 min vid rumstemperatur.
  2. Noggrant avlägsna supernatanten och försiktigt återsuspendera cellerna med lämplig volym av frysning-medium innehållande 95% fetalt bovint serum (FBS) och 5% DMSO.
  3. Överför celler märkta, steril kryokärl, mössa tätt och placera i en frys behållare som innehåller isopropanol. Ställe i en -80 ° C frys under minst en dag före överföring på obestämd tid för att flytande kväve.
  4. För att tina en flaska frysta primära humana papiller fungiform smak celler, plats vid 37 ° C vattenbad tills precis upptinade (cirka 1 minut), medan du arbetar i ett laminärt flöde cellodlinghuva.
  5. Överföra celler och frysmedium till en steril 15 ml koniskt centrifugrör och tillsätt 5 ml smak cellodlingsmedium.
  6. Centrifugera cellerna vid 2500 rpm under 5 min vid rumstemperatur. Försiktigt kassera supernatanten försiktigt Återuppslamma celler med komplett smak cellodlingsmedium, och överföring till en steril T-25 vävnadsodlingskolv.
  7. Fortsätter att odla celler enligt steg 3 till 4.

6. Representativa resultat

Försök att odla smak biopsier i odling var framgångsrika 90% av tiden. Några dagar efter biopsi och dissociation, började cellerna vanligtvis växa och migrera utåt från bitar av dissekerade fungiform vävnad som förblev efter dissociation proceduren. Även om enskilda celler var synliga 24-48 timmar efter plätering (Figur 1A) växte celler för upp till 2-3 veckor under bifogade cellkluster ibland generera dotterceller (Figur 1B). Från biopsiIng 4-8 människa fungiform papiller, första isolat av primära humana papiller fungiform smak celler når ca 2000 - 8000 celler i 4 veckor i kultur. Expansion i T25 cellodlingsflaskor (passage 0) för ytterligare 3-4 veckor kommer att resultera i att ha humana fungiform celler smak papiller i kultur anpassats (Figur 1C). Primära humana fungiform smak papiller celler kan utökas ytterligare i kultur för att ge upp om minst en miljon celler genom passage-1 i 3-4 veckor (Figur 1D). Primära smak celler kommer att fortsätta att växa i mer än 8 passager.

Morfologin hos de odlade humana papiller fungiform smak celler i odling var liknande odlade chemosensory celler som beskrivits tidigare 11,12 .. De flesta odlade humana fungiform smak papiller celler behållit sin ursprungliga kompakta utseende cellkroppar med eller utan en eller flera processer upp till 15-30 dagar. Efter att de nått sammanflödet flesta odlade ceLLS hade en polariserad-långsträckt utseende. Mogna smak celler består av flera olika histologiska subtyper och uppvisar smak cell särdrag. Här visar vi att celler i dessa kulturer uppvisar många molekylära och fysiologiska egenskaper som kännetecknar mogna smak celler. Gustducin och fosfolipas C - β2, (PLC-β2)-mRNA detekterades genom omvänd transkriptas-polymeraskedjereaktion och produkter bekräftades genom sekvensering (figur 2). Expression av gustducin och PLC-β2 detekterades immunocytokemiskt som indikerar närvaron av typ II-liknande celler (Figur 3 B och D respektive). Förekomst och relativa mönster uttryck för gustducin och PLC-β2 reflekterande cell signalvägar och celltyper inte exakt motsvarar den som ses in vivo. De faktorer som styr den relativa fördelningen av olika celltyper i en smak linda är okända, och får inte reproduceras i de odlingsbetingelser. Därför, b OTH likheter och skillnader mellan de odlade cellerna och deras in vivo motsvarigheter ger en möjlighet att undersöka regleringen av dessa egenskaper på molekylär nivå, under förhållanden som kan manipuleras och övervakas.

Ett viktigt kriterium för ett modellsystem är närvaron av relevanta funktionella egenskaper. Odlade celler uppvisade också robusta ökningar i intracellulärt kalcium som svar på lämpliga koncentrationer av flera smak stimuli (figur 4). I dessa studier, söta och bittra stimuli framkallar en ökning av intracellulärt kalcium som kan motsvara en depolarisation. Dessa smakar cell-liknande egenskaper hos de odlade cellerna ger stöd för påståendet att den modell system vi beskriver här kommer att bli en värdefull tillgång för fortsatta studier av transduktion vägar och förnyelseförmåga av mänskliga smak celler.

fig1.jpg "/>
Figur 1. Fastsättning och morfologin hos odlade humana papiller fungiform smak celler. Primära humana fungiform smak papiller cellkulturer odlade på kollagen typ-1-belagda plattor, försågs med bild efter 2 dagar (a). Mänskliga fungiform smak papiller celler växte upp till 4 veckor under bifogade cell kluster, som verkade ge upphov till dotterceller. Cellerna växte normalt till sammanflytning inom fyra veckor (B) och (C och D) representerar dag 2 och 4 veckor efter skörd och återsådd respektive. Odlade celler fortsatte att växa under minst 8 månader. Skala barer = 50 nm. Delen av figur 1 har också presenteras i Ozdener et. al. 10.

Figur 2
Figur 2. RT-PCR-resultat visade på närvaron av specifika biomarkörvärdena smak cell-mRNA (gustducin och PLC-β2,). Totalt RNA från odlade humana celler fungiform var omvänd transcribed användning av Superscript första systemet strängsyntes för RT-PCR (Invitrogen) och användes för PCR-amplifiering av specifika primrar utformade för detektion av gustducin och PLC-β2. Primers (Tabell 1) valdes för att sträcka sig över en eller flera introner. Varje mRNA detekterades i odlade humana papiller fungiform smak celler från passagen 4 eller 5 med amplifieringsprodukterna av den förväntade storleken, bekräftades genom sekvensering. Specifik mRNA detekterades inte i kontrollexperiment utan omvänt transkriptas indikerar ingen genomiskt DNA-kontaminering. PCR-produkterna separerades på 2% agarosgeler och de amplifierade produkterna på gelén skars med ett rakblad. DNA extraherades från gelén med användning av QIAquick Gel Extraction Kit (Qiagen). PCR-produkter sekvensbestämdes vid University of Pennsylvania Sequencing anläggningar. C-PCR och C-RT är kontrollexperiment för PCR och omvänt transkriptas, respektive. Delen av figur 2 var också presenteras i Ozdener et. al.

Figur 3
Figur 3. Immunofärgning av odlade humana fungiform smaken papiller celler passage 4 eller 5 visade förekomst av biomarkörer smak cell. Odlade humana fungiform smak papiller celler (5 dagar gamla) fixerades med 4% paraformaldehyd och inkuberades med primära antikroppar (Tabell 2) över natten vid 4 ° C. Bilder förvärvades med en Leica TCS-SP2 konfokalt laserskanning mikroskop. Ungefär var 60% av odlade papiller fungiform smak celler märktes med gustducin (B) och 20-30% med PLC-β2 (D). Överförings bilder av motsvarande celler visas (A och C). För kontroller immunfärgning med antikropp specifik immunglobulin visat att ingen icke-specifik immuno-reaktivitet (data ej visade). Skala barer = 50 nm. Deli figur 3 också presenterades i Ozdener et. al. 10.

Figur 4
Figur 4. Odlade mänskliga fungiform smak papiller celler från passage 4 eller 5 reagera på olika stimuli. Odlade humana fungiform smak papiller celler (4-5 dagar gamla) laddades med 1 mM Fura-2 AM (Molecular Probes) och 10 mg / ml Pluronic F127 (Molecular Probes). Förändringar i intracellulära kalciumhalter ([Ca 2 +] i) i odlade humana papiller fungiform smak celler mättes med användning av standardtekniker manuella avbildning. Cellerna visualiserades med användning av ett inverterat fluorescens-mikroskop vid exciteringsvåglängder på 340 nm och 380 nm och en emissionsvåglängd som fastställs av ett bandpassfilter centrerat vid 510 nm. Stimuli löstes i badlösningen och sedan pH och osmolaritet justeras om det behövs. Odlade humana fungiform smak papiller celler svarade på söta och bittra stimuli. Graphs illustrerar representativa responser av [Ca 2] i-nivåer i individuella celler under exponering för (A) denatonium (2 mM), (B) Sukralos (1 mM). Varje spår representerar enstaka enskilda celler.

Gen Sekvens PCR-villkor Förväntade storleken
(Bp)
Hänvisning
β-aktin GGACTTCGAGCAAGAGATGG
AGCACTGTGTTGGCGTACAG
7 min
45 sek
45 sek
45 sek
7 min
95
94
53
72
72
234 NM_001101.3
Gustducin TCTGGGTATGTGCCAAATGA
GGCCCAGTGTATTCTGGAAA
7 min
45 sek
45 sek
45 sek
7 min
95
94
53
72
72
386 NM_001102386
PLC-β2 GTCACCTGAAGGCATGGTCT
TTAAAGGCGCTTTCTGCAAT
3 min
30 sek
30 sek
60 sek
7 min
95
94
53
72
72
333 NM_004573

Tabell 1. Primers och villkor som används för att detektera smak specifika molekyler.

Primär antikropp Källa Host Utspädning Sekundär antikropp Källa Host Utspädning
Gustducin SantaCruz Kanin 1:500 Anti-kanin IgG Alexa 633 Molecular Probes Get 1:500
PLC-β 2 SantaCruz Kanin 1:500 Anti-kanin IgG Alexa 633 Molecular Probes Get 1:500

Tabell 2. Antikroppar som används för att detektera uttryck av specifika molekyler.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vi har behållit celler från människa fungiform smak papiller i över 8 passager, som spänner över en period på 12 månader. Dessa kulturer genererar nya celler, av vilka många förfaller in vitro till det stadium där de uttrycker flera markörer för mogna celler smaklökar typer förutom viktiga molekylära och fysiologiska egenskaper hos celler smak receptor. Närvaro av gustducin-och PLC-β2 immunoreaktivitet i underuppsättningar av odlade celler är i överensstämmelse med denna slutsats. Viktigast svarade några celler för tillämpningar av söta och bittra smak stimuli med övergående ökningar i intracellulärt kalcium, vilket är en del av dissocierade smak celler 5, celler i skivor smaklökar 3 och odlade mänskliga och råttceller smak 19,10. Detta tyder inte bara att vissa av cellerna i kultur uttryckte molekylära receptorer för söt och bitter, men att de fått nog av G-proteinet kopplade transduktion kaskad att generera Calcium svar.

Långsiktiga primära cellkulturer ofta inte kan bibehålla den ursprungliga vävnaden, och cellstruktur och cellulära faktorer som kan spela en roll i den fysiologiska funktionen av celler. Av framgångsrika på lång sikt inrätta mänskliga fungiform smaken papiller cellodling har stora framsteg gjorts ännu, måste ett antal begränsningar nämnas. Främst bland dessa är att varje sats av primära odlade celler kan variera beroende på skillnader i den initiala populationen av celler som används för att starta kulturen. Primära cellodlingar missar ofta den ursprungliga vävnaden organisation och struktur och tillväxtfaktorer som spelar en roll i den fysiologiska funktionen av celler. Celler är ofta inte alltid och uteslutande i kontakt med andra celler, såsom kulturer aldrig får växa till 100% konfluens. I allmänhet primära celler är också föremål för dedifferentiering och kromosomala instabilitet, som kännetecknas av förluster eller vinster av kromosomer under cellreplikation i kontinuerlig cell lines, kan vara ett annat problem 13,14,15. Jämförelsen av odlade humana fungiform celler med odlade nontaste celler tungan måste utforskas. Dessa frågor kommer att kräva användning av många experimentella metoder och system modell innan vår förståelse är klar.

Sammanfattningsvis beskrev detta protokoll här gör att upprätthålla mänskliga fungiform celler smak papiller in vitro i minst 8 passager (12 månader) utan att förlora relevanta cell-fysiologiska och molekylära egenskaper. Den fortsatta utvecklingen av detta långsiktiga primär kultur kommer att ge ett modellsystem för studier av proliferation och differentiering, stimulans specificitet, cross-talk och egenskaper anpassning av mänskliga celler smak receptor samt vävnadsregenerering. Dessutom kan effekterna av förhållanden som försämrar funktionen smak cell, såsom infektion kan mediciner, strålning, giftiga eller kemisk exponering skall undersökas vid molekylär och fysiologisk nivå.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Inga intressekonflikter deklareras.

Acknowledgments

Vi tackar Aimee Myers och ESI Quayson för tekniska färdigheter och hjälpa. Detta arbete stöddes delvis av NSF 0216310 och Givaudan Inc bidrag (NER).

References

  1. Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia. J. Comp. Neurol. 377, 324-340 (1997).
  2. Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells. Neurosci. Lett. 277, 13-16 (1999).
  3. Caicedo, A., Jafri, M. S., Roper, S. D. In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells. J. Neurosci. 20, 7978-7985 (2000).
  4. Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. A reliable method to obtain cells of taste buds from fungiform papillae of mice. Acta Histochem. 112, 107-112 (2010).
  5. Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. A method for isolating and patch-clamping single mammalian taste receptor cells. Brain Res. 503, 326-329 (1989).
  6. Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes. Neuroscience. 106, 217-225 (2001).
  7. Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. Maintenance of rat taste buds in primary culture. Chem. Senses. 26, 861-873 (2001).
  8. Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. Analysis of cell lineage relationships in taste buds. J. Neurosci. 22, 4522-4529 (2002).
  9. Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. Characterization and long-term maintenance of rat taste cells in culture. Chem. Senses. 31, 279-290 (2006).
  10. Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. Characterization of Human Fungiform Papillae Cells in Culture. Chem. Senses. 36, 601-612 (2011).
  11. Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. Characteristics of odorant elicited calcium changes in cultured human olfactory neurons. J. Neurosci. Res. 62, 737-749 (2000).
  12. Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. Continuous culture of neuronal cells from adult human olfactory epithelium. J. Mol. Neurosci. 3, 137-146 (1992).
  13. Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro. Physiol. Genomics. 17, 179-192 (2007).
  14. Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population. Stem Cells Dev. 17, 1109-1121 (2008).
  15. Sandow, S. L., Grayson, T. H. Limits of isolation and culture: intact vascular endothelium and BKCa. Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).
Isolering och kultur mänskliga papiller Fungiform smak celler
Play Video
PDF DOI

Cite this Article

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).More

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter