Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Rask og effektiv produksjon av rekombinant humant Pluripotent stamceller ved rekombinase-mediert Cassette Exchange i den doi: 10.3791/54718 Published: November 20, 2016
* These authors contributed equally

Summary

Her kan vi rapportere en rask og effektiv gen redigering metode basert på RMCE i AAVS1 locus av humane Pluripotent stamceller (hPSCs) som en forbedring av de tidligere beskrevne systemer. Ved hjelp av denne teknikken, kan isogene linjer være raskt og pålitelig generert for riktig komparative studier, tilrettelegging transgenesis-mediert forskning med hPSCs.

Abstract

Selv med revolusjonen av gene-målrettingsteknologier ledet av CRISPR-Cas9, genmodifisering av menneskelige pluripotente stamceller (hPSCs) er fortsatt tidkrevende. Komparative studier som bruker rekombinante linjer med transgener integrert i trygg havn loci kan ha nytte av tilnærminger som bruker stedsspesifikke målrettede rekombinaser, som Cre eller FLPe, som er raskere og mindre utsatt for off-target effekter. Slike fremgangsmåter er blitt beskrevet, selv om de ikke i vesentlig grad bedre resultater genet målretting i de fleste aspekter. Ved hjelp av sink-finger nukleaser, tidligere opprettet vi en master cellelinje i AAVS1 locus av hPSCs som inneholder en GFP-Hygromycin-tk uttrykke kassett, flankert av heterotypic FRT sekvenser. Her beskriver vi prosedyrene for å utføre FLPe recombinase-mediert kassettbytte (RMCE) ved hjelp av denne linjen. Hoved cell linje er transfektert med et RMCE donor vektor, som inneholder en promoterless Puromycin motstand, og med FLPe rekombinase. Bruk av både en positiv (puromycin) og negative (FIAU) utvalg programmet fører til valg av RMCE uten tilfeldige integrasjoner. RMCE genererer fullt karakteriserte pluripotente polyklonale transgene linjer i 15 d med 100% effektivitet. Til tross for den nylig beskrevet begrensningene i AAVS1 locus, den enkle systemet åpner for hPSC transgenesis i isogene innstillinger, er nødvendig for komparative studier, og muliggjør semi-high-throughput genetiske skjermer for gevinst / tap av funksjonsanalyse som ellers ville være meget tidkrevende.

Introduction

Målrettet genom rekombinasjon har tilrettelagt raske fremskritt i mange områder av forskning. I mus, har den synergien mellom genomet redigering og stamcelle forskning tillatt for en økt forståelse av den komplekse mekanismen av genfunksjon og genregulering. En slik fremgang er forventet i humane pluripotente stamceller (hPSCs) også, men for mange år siden den første isolering av humane embryonale stamceller (hESCs), og senere menneskeskapte Pluripotent stamceller (hiPSCs), genet redigering har utgjort en teknisk hinder . Nylige fremskritt i genomet teknikk ved hjelp av målrettede nukleaser-Sink Finger nukleaser (ZFNs), transkripsjon aktivator lignende effektor nukleaser (Talen), eller Gruppert regelmessig interspaced kort palindromic repetisjoner / CRISPR-assosiert protein 9 (CRISPR / Cas9) har tillatt oss å overvinne disse vanskeligheter, noe som gjør målrettet rekombinasjon en effektiv prosess 1-3.

Spesifikk loci i mOuse genomet som tillater stabil, pålitelig, og allestedsnærværende transgene uttrykk i fravær av skadelige effekter som Rosa26, Hprt1, eller Col1A1, har blitt viktige verktøy i utførelsen av genetiske studier. Safe Harbor loci tillate sammenlignbar analyse mellom ulike linjer av mus i isogene sammenhenger. Dette kan ikke oppnås ved bruk av standard tilfeldig integrasjonsmetoder, som er forbundet med kjente begrensninger som insertional mutagenese, doseavhengige effekter, eller spraglete transgene uttrykk. Gene redigering letthet og fleksibilitet i trygg havn loci økes gjennom bruk av stedsspesifikke målrettede rekombinaser som Cre eller Flippase (FLPe), som spesifikt gjenkjenner målsekvenser (loxP eller FRT, henholdsvis) og katalyserer effektiv rekombinasjon mellom identiske mål. På grunn av disse egenskaper, rekombinase-formidlet gen redigering ved hjelp av loxP eller FRT-sekvenser i preintegrated trygg havn loci er et vanlig verktøy som brukes i mus transgenesis. I tillegg til kassett innsetting eller fjerning mediert mellom identiske mål sekvenser, bruk av inkompatible loxP eller FRT nettsider tillater recombinase-mediert kassettbytte (RMCE) 4.

I human har forsøk på å identifisere sikre havne loci er blitt utført. Musen ortologe HPRT, til tross for sin tilknytning til tap-av-funksjon Lesch-Nyhan syndrom, og ROSA26 har vært målrettet i hPSCs. HPRT ble rapportert å raskt slå transgene uttrykk i ESC, og som ROSA26, dens evne til å opprettholde transgene uttrykk i terminalt differensierte celler ikke ble undersøkt 5-7. Fordi en homozygot null mutasjon av CCR5-genet ser ut til å være godt tolerert hos mennesker, ble dens verdi som trygg havn vurderes. CCR5 var målrettet og rapportert til å opprettholde stabile transgene uttrykk i ulike humane cellelinjer, inkludert ESCs 8,9. Derimot,sistnevnte ble ikke påvist i den klonale nivå ved langtidskultur, og allestedsnærværende transgen ekspresjon ble ikke påvist i differensiert avkom av de tre bakterie lag. AAVS1, den naturlige integreringssete av den Adeno Associated Virus type 2 (AAV), ble testet i hESCs også, på grunn av rapporterte motstand mot transgenet stanse 10. Senere mange grupper brukte AAVS1 locus og beskrevet stabil transgen ekspresjon i udifferensierte hPSCs, så vel som i deres differensiert avkom av alle tre bakterie lag, både in vitro og in vivo 2,8,11,12. De siste resultatene likevel nyansere disse funnene, som AAVS1 locus ble funnet å utøve variable transgenet hemming in vitro i udifferensierte hESCs og i hepatocytter avkom 13.

Andre screening studier med tilfeldige integrasjon tilnærminger og metoder for å bestemme ett eksemplar integrering forsøkte å finne genomic integrasjonssider resistente mot transgenet stanse under hPSCs ekspansjon og differensiering 14,15. Samlet sett til nå, ingen genomisk Nettstedet er fullt godkjent som en trygg havn i hPSCs og deres avkom; identifikasjon av en passende område for allestedsnærværende stabil transgen ekspresjon, ikke bare i hPSCs men også i sine differensierte progenies in vitro og in vivo, gjenstår å bli løst. Blant alle de undersøkte loci og til tross for sine begrensninger, forblir AAVS1 best-preget og mest brukte i stamcelleforskning.

RMCE har blitt utført i hPSCs i noen av disse loci 6,7,14,16, hovedsakelig ved hjelp av Cre rekombinase, selv om mye tyder på at FLPe er mer effektiv enn Cre 17. I alle disse tilfellene ble en positiv medikamentresistens kassetten anvendt for seleksjon av rekombinante kolonier. Selv vellykket, disse prosedyrene ikke utgjør en teknisk fremskritt i forhold til standard gen-redigering prosedyrer ved hjelp ZFNs, Talens eller CRISPR / Cas9, som en enkelt antibiotika utvelgelsesprosedyre utelukker ikke tilfeldige integrasjoner og krever koloni screening for å identifisere riktig målrettede kloner.

I denne prosedyren, beskriver vi metoder for å utføre RMCE i hPSCs i AAVS1 locus ved hjelp av en kombinasjon av positiv (innenfor innkommende kassett) og negative (innenfor preintegrated kassett) valg som gir mulighet for generering av polyklonale transgene linjer i ± 15 dager med 100% effektivitet og kostnads ​​tilfeldige integrering hendelser. Derfor representerer denne metoden fremgang utover tiden beskrevet RMCE teknologier i hPSCs.

Protocol

1. Klargjøring av FRT-holdige hPSC Master cellelinje for Transfeksjon

  1. Kultur hESC / IPSC mester cellelinjer i henhold til standard prosedyrer på eller av inaktiverte mus embryonale fibroblaster (iMEF) ved hjelp av hESC eller mater fritt IPSC medium, henholdsvis (tabell 1). Forbered 2 (på matere) eller 1 (mater-free) brønner av hPSCs i en seks-brønns plate for hver eksperimentell tilstand.
  2. Observer kulturer, og når cellene nå 60 - 70% konfluens plate multiresistent iMEF (iDR4). I korthet belegge de nødvendige brønnene i en 12-brønns plate med 0,5 ml 0,1% gelatinløsning og inkuber i 5 minutter ved romtemperatur. Plate 125000 iDR4s per brønn og inkuber O / N med iMEF medium (tabell 1).

2. hPSC Transfeksjon av nucleofection

  1. Den følgende dag, pre-inkubere hESC / IPSC kulturer med friskt medium, inkludert 10 uM Rho-assosiert proteinkinase (ROCK) inhibitor (Y-27632), i 1 time ved 37 ° C. Next, ta hESC transfeksjon løsning fra kjøleskapet til pre-varme til romtemperatur.
  2. Forbered 1 ml nucleofection plating medium (tabell 1) per nucleofection tilstand. Ta iMEF medium av brønnene, vask med 1 ml av romtemperatur PBS, og tilsett 500 mL av nucleofection plating medium. Overfør de andre 500 ul til sterile 1,5 ml rør og lagre dem ved 37 ° C inntil plettering. MERK: En typisk RMCE eksperiment inneholder tre forskjellige betingelser med molekylære forhold av RMCE donor: pFLPe vektorer av 2: 0, 2: 1, og 0: 1.
  3. Ta hESC / IPSC i en enkelt celle suspensjon.
    1. Ta av media, vaske den med 2 ml RT PBS, og tilsett 1 ml trypsin 0,05% eller accutase på mater eller mater fritt hPSC kulturer, henholdsvis. Inkuber i 7 (trypsin) eller og 2-5 (accutase) minutter ved 37 ° C. For Accutase behandling - celler må være løs, men vedlagt.
    2. Fjern forsiktig platen fra inkubatoren og uten enllowing cellene til å løsne, fjerne dissosiasjon agenten ved aspirasjon. Tilsett 1 ml hESC media og distansere de løse cellene ved forsiktig skylle media på tallerkenen overflaten, unngå skumming. Sørg for at cellene er i en enkelt celle suspensjon.
    3. Samle cellene i en ren og steril 15 eller 50 ml tube. Vask brønnene med 1 ml hESC media og samle cellene i den samme 15 eller 50 ml tube. Ta en 50 pl prøve for å telle (i neste trinn) ved anvendelse av en celle telleinnretning. Noter ned volumet av samlingen og beregne total celle nummer. Spinne ned cellene ved 300 xg i 5 minutter ved romtemperatur.
  4. Resuspender cellepelleten til en suspensjon av 10 6 celler / ml med PBS ved anvendelse av en 5 ml serologisk pipette og forsiktig pipettering. Unngå skumdannelse. Overfør 2 ml per eksperimentell tilstand (ca. 2 x 10 6 celler) for å rengjøre, sterile 15 ml rør.
  5. Mens sentrifugering, prePare den RMCE giver- pFLPe plasmider blander i et maksimalt volum på 10 mL.
    1. Overfør 2,5 ug pFLPe (6,5 Kb) til et rent, sterilt 1,5 ml rør. Legg til en 2: 1 molforhold av RMCE donor vektoren 13 til pFLPe vektoren. For eksempel, omtrent 10 ug av en 12 Kb RMCE donor vektor.
  6. Fortsett med nucleofection, unngå skumming i alle trinn.
    MERK: Noen hPSC transfeksjonsteknologier regler gjelder en ekstra iMEF uttømming steg før steg 2,4. Men i praksis, er iMEF en mindre cellefraksjon i ett suspensjon som ikke vesentlig endre transfeksjonseffektivitet, vil heller ikke skape forurensende rekombinante celler, siden de er ikke-proliferativ. I tillegg er det viktig å fortsette hurtig under transfeksjon prosess for å øke levedyktigheten. For disse grunner, er iMEF uttømming ikke brukt.
    1. Fjern det iDR4 plate og 1,5 ml rør med pletteringsmediumfra inkubatoren. Et rør av gangen, pipettér av PBS forsiktig uten å forstyrre cellepelleten. Fjern så mye som mulig. Resuspender pelleten med 100 ul av transfeksjon oppløsning ved forsiktig pipettering. Overfør cellesuspensjonen til 1,5 ml rør inneholdende plasmidet blander og bland forsiktig.
    2. Overfør celle DNA mix til transfektor kyvetten, betaler oppmerksomhet til ikke å innføre bobler. Introduser kyvetten i Nucleofector enheten og bruke programmet A13 (celler dyrket på matere) eller F16 (mater-fri).
      MERK: Andre transfeksjon metoder eller Nucleofector enheter krever optimalisering av disse programmene eller transfeksjon forhold.
    3. Ved utsatt kyvetten og, ved hjelp av engangsoverføring pipettene som er tilgjengelige i nucleofection kit, samle dets innhold ved påføring av 0,5 ml av pletteringsmediet og aspire hele volumet. Gjennomføre dette trinnet raskt, men forsiktig og i en bevegelse.
    4. Plate dråpevis i 12-well plate som inneholder iDR4 og 500 mL av plating medium. Gjenta trinn 2.6.1 - 2.6.4 for neste eksperimentell tilstand.
  7. Plasser kulturen fatet på en hylle i kuvøse og flytte den sakte frem og tilbake og fra side til side for å fordele cellesuspensjonen. Inkuberes det i 24 timer før det neste endring av medium for å tillate cellene å komme i nærvær av 10 pM ROCK-inhibitor (Y-27632).

3. Positiv og negativ seleksjon av celler gjennomgår RMCE

  1. Endring kulturmedier daglig (1 ml / brønn), og 2 - 3 d post-transfeksjon, starter utvalg med 100 ng / ml puromycin.
    MERK: Optimale konsentrasjoner av positive og negative seleksjons reagenser må bestemmes eksperimentelt for hver nylig genererte hPSC hovedcellelinje. Utføre en kill kurve 13, ved hjelp av mastercellelinje for å bestemme den lave dose (konsentrasjon ved hvilken minimale visuelle toksisitet er tydelig etter 7d av utvalget, men kulturen er ikke overgrodd), optimal dose (den laveste konsentrasjonen hvor alle cellene er døde etter 7 d av utvalget), og høy dose (konsentrasjon som forårsaket tydelig toksisitet, drepe alle celler etter 2-3 d) for både puromycin og Fialuridine (FIAU).
    1. Aspirer hESC medium. Vask med 1 ml PBS. Legg hESC medium med 100 ng / ml puromycin.
  2. Observer cellevekst, slik at døden og vekst er balansert. Endre media med puromycin daglig, etter trinn 3.1.1. Når veksten overgår celledød, øke puromycin konsentrasjonen i blokker på 25 - 50 ng / ml opp til et maksimum på 250 ng / ml. Fortsett puromycin utvalg for 5-7 d.
  3. 3-4 d etter start puromycin utvalg, rundt dag 6 etter transfeksjon, starter utvalg med 0,5 mikrometer FIAU. Endre media daglig og vedlikeholde FIAU for ikke mer enn 7 sammenhengende dager.

4. Utvidelse og karakterisering av RMCE Lines

Etter fullførelse av utvelgelse, rundt D14 - 15, resistente kolonier RMCE er til stede og utgjøre den nye RMCE linje. Delt i bulk i et 1: 2 forhold ved å følge standard prosedyrer (passasje 1, P1).
  • Plate 2 brønner i en 12-brønns plate (eller deaktiverer forer, avhengig av den vanlige dyrkningsforholdene i den opprinnelige master-cellelinjen). Bruk en godt for videre ekspansjon, lagring, eller eksperimentelle oppsett (ingen ekstra beskrivelse av disse prosedyrene er gjort i denne protokollen), og den andre for karakterisering.
  • Når celler fra P1 er klar til å splitte, dissosiere brønnen for å karakterisere til en enkelt cellesuspensjon som beskrevet i 2.4 og samle cellene i et 15 ml rør. MERK: Bruk celler fra hPSC WT (ingen genetisk modifisering) og mastercellelinje som negative og positive kontroller, henholdsvis for karakterisering.
  • Spinne ned ved 300 xg i 5 minutter ved romtemperatur. Resuspender i 1 ml PBS og dele prøven i to for flowcytometriog DNA-analyse 13.
  • Flowcytometri analyse 13 (300 mL):
    1. Legg føtalt kalveserum til cellene i PBS til en sluttkonsentrasjon på 5%. Overfør cellene til en ren FACS rør med en cellefilter og holde dem på is.
      MERK: Cellenes levedyktighet er høy i disse betingelser, slik at det er mulig, men ikke nødvendig, å benytte et fluorescerende flekk for ikke-levedyktige celler (for eksempel 7-AAD eller PI).
    2. Fortsett umiddelbart til analyse i et strømningscytometer celle analysator og spille inn 20.000 - 30.000 hendelser. For analyse, satt portene ovenfor GFP eller TDT bakgrunn florescence bruker WT negativ kontrollprøve.
  • DNA-analyse 13 (700 mL):
    1. Overfør cellene til et rent 1,5 ml rør. Spinne ned ved 300 xg i 5 minutter ved romtemperatur og aspirer supernatanten. Fortsett til DNA ekstraksjon ved hjelp av et kommersielt kit og følg produsentens anvisninger. Lagre den tørre pellet ved -20 ° C for later analysen.
  • Mål DNA konsentrasjon.
    1. Fremstille standard PCR reaksjonene i henhold til forholdene i figur 3 og tabell 2 13 Run PCR-prøver på en 2% agarosegel inneholdende 1 x DNA gel flekk ved 150 V i 15 -. 25 min. Analyser kjøre i en gel analysator.
  • Representative Results

    Bruke AAVS1-spesifikke ZNFs, ble fullstendig karakterisert hESC / IPSC mester cellelinjer som inneholder heterotypic FRT målsekvenser generert og beskrevet 13. De FRT-inneholdende stamcellelinjer opprettholdes pluripotency og genom integritet etter ZFN behandling og stabilt uttrykt GFP in vitro og in vivo. RMCE utføres ved kotransfeksjon av master cellelinjer med FLPe recombinase og RMCE giver vektorer (Figur 1a). RMCE vektorer inneholde identiske FRT sekvenser til de i AAVS1 mester cellelinje flankerer transgenet Figur 1B overvåker RMCE hjelp av konstitutivt uttrykte TDT PZ:.. F3-P CAGGS tdTPH-F Etter transfeksjon, hPSC danne små grupper av celler jevnt fordelt over den iDR4 MEF laget, og transfektert hPSC uttrykke både GFP samt forbigående TDT (figur 1B, D 2). Cellene får lov å komme for 2-3d etter transfeksjon før valget. Positiv utvelgelse først begynte å bruke en lav dose av puromycin for å favorisere RMCE donor innsetting. Puromycin påføres forsiktig i begynnelsen, fordi utgangs massiv celledød kan føre til enkle celler som gjennomgår rekombinasjon, noe som gjør dem ute av stand til å overleve i prosessen. I de følgende dager, må puromycin konsentrasjon til å bli hevet trinnvis opp til den optimale dosen for å tillate de rekombinante cellene til å vokse inn i små kolonier, mens de nonrecombined cellene etter hvert dø.

    3-4 d etter oppstart av positiv utvelgelse (rundt D 6 etter transfeksjon), er negativ seleksjon begynt for å velge bare for FRT-mediert rekombinasjon. RMCE fører til tap av tymidinkinase (TK) selvmordsgen og dermed følsomheten overfor Fialuridine (FIAU). Negativ seleksjon anvendt ved dette punkt, i hvilket små klynger av 2 - 4 GFP - / TdT + (RMCE) celler eri stand til å motstå optimale konsentrasjoner av FIAU (figur 1 B, D 6), hindrer tilfeldig integrasjon, fordi i slike hendelser, tk-genet i den AAVS1 locus forblir upåvirket. Forekomst av samtidig FRT-mediert og tilfeldig integrasjon er meget usannsynlig, som vist ved fravær av tilfeldige integrering hendelser senere under den karakteriseringen (figur 2B).

    Blandet RMCE GFP - / TDT + kolonier fortsetter å vokse, samtidig som de blir mer homogen, slik at ved D 9-10 etter transfeksjon, noen ikke fullt utvalgte blandede RMCE kolonier kan bli funnet (figur 1B). GFP - / TdT + RMCE kolonier er til stede bare når både RMCE donor og FLPe (2: 1) benyttes, mens RMCE ikke forekommer i fravær av FLPe (2: 0). Fullstendig utvalg med FIAU inntil dag 13-15 etter transfeksjon gir opphav til en homogen GFP - / TDT + culture. RMCE gir et gjennomsnitt på 12,8 ± 6,8 (n = 6) Puro R / FIAU R kolonier i 15 dager 13. Flowcytometri karakterisering av den nylig genererte RMCE linje (den Puro R / FIAU R RMCE kolonier kombinert i en nonclonal cellepopulasjon) bekrefter at 100% av cellene presentere RMCE GFP - / TdT + fenotypen (figur 2A). Når RMCE donorer uten konstitutiv ekspresjon av et fluorescerende reporter anvendes, er det resulterende Puro R / FIAU R RMCE hPSC linje homogent GFP -.

    PCR karakterisering av nonclonal RMCE linje viser den fulle kassett utveksling (ingen spor av kassetten av mastercellelinjen kan detekteres), og at velgerprogrammet som brukes genererer tilfeldige integrasjonsfrie linjer (begge av RMCE donor og den FLPe-uttrykk vektor) (figur 2B). Disse resultatene ble ytterligere påvist ved southern blot og, i tillegg, viste vi at RMCE linjene forblir pluripotent 13. Dette gjør det ikke lenger nødvendig å utføre enten genomet bred evaluering av tilfeldig integrering eller den pluripotency testen under rutinemessig RMCE eksperimenter. I sammendrag, ved bruk av denne protokollen, hPSC transgene cellelinjer i AAVS1 locus fri for tilfeldig integrasjon kan lett genereres i 15 d med 100% effektivitet og uten behov for omfattende karakterisering.

    Figur 1
    Figur 1: Skjematisk oversikt over RMCE (A) Tidslinje av RMCE utvalg programmet.. Venstre: master cellelinje (MCL), husing en FRT-flankert kassett (trekanter) som uttrykker GFP og Hygromycin-tk (koblet av 2A selv spalte peptider), er transfektert med nucleofection (NF) med FLPe-uttrykke vektor og den RMCE donor vektor, which inneholder en promoterless Puromycin resistensgen (spleise-akseptor - SA- Puro R) og en variabel eksperimentell kassett (X). Høyre: ny RMCE linje (RMCEL) oppnådd etter avsluttet markeringen med puromycin (rød trekant) og FIAU (blå linje). (B) RMCE ved anvendelse av en konstitutiv TdT-uttrykkende donor og forskjellige forhold mellom donor-DNA og FLPe DNA (0: 1, 2: 1, 2: 0) overvåket ved fluorescensmikroskopi (GFP - grønn fluorescens, TDT - rød fluorescens) ved forskjellig tidspunkter. D 2 og 6: skala barer representerer 100 mikrometer. D 10: skala barer representerer 200 mikrometer. Klikk her for å se en større versjon av dette tallet.

    Figur 2
    Figur 2:. Karakterisering av RMCE Lines (A) Fastsettelse av RMCE avflowcytometri. GFP og TDT uttrykk vises for WT linjen, master cellelinje (MCL), og nylig genererte RMCE kø på D 15 post-nucleofection bruker et konstituerende TdT-uttrykk vektor (CAGGS TDT), eller givere med GFP drevet av en GOOSECOID promoter (GSCp GFP, definitive endoderm markør) eller en AAT promoter (APOeAATp GFP, hepatocytter markør). (B) Bekreftelse av RMCE (5 '/ 3' JA RMCEL), fravær av master cellelinje-tallet (MCL) kassett (5 '/ 3' JA MCL), og mangel på tilfeldig integrering (5 '/ 3' / FLPe RI ) ved PCR ved anvendelse av de avbildede primerpar. DNA fra WT, MCL, RMCE linjer (1 - 5), donor RMCE vektor (+ RI), FLPe uttrykke vektor, og ingen mal kontroll (NTC) ble brukt. Figur modifisert fra (Ordovas et al., 2015) 13. Klikk her for å se en større versjon av dette tallet.

    innen-page = "1"> Figur 3
    Figur 3. Generering av RMCE-Master passende cellelinje, og sammenligning av Gene målretting med RMCE i AAVS1 Venstre:. Gene målretting stilte umodifiserte WT celler som er transfektert med en giver (kassett beskrevet i figur 1A for generering av mastercellelinjen , MCL) og spesifikke optimalisert ZFNs. Prosessen med å fullføre hele karakterisering tar opptil 3 måneder. Høyre: RMCE blir utført ved kotransfeksjon av giveren med FLPe vektorer, og en fullstendig karakterisert linje genereres på 15 d. Gene targeting effektivitet i AAVS1 er fra tidligere studier 1,2. Klikk her for å se en større versjon av dette tallet.

    ays "> Media komponenter Sluttkonsentrasjon konsentrasjon~~POS=HEADCOMP hESC medium DMEM-F12, HEPES 80% Serum erstatning medium 20% L-glutamin 146 mg / mL MEM ikke-essensielle aminosyrer Solution (100x) 1x 2-mercaptoethanol 0,1 mm Penicillin / streptomycin 0,1% Menneskelig basisk FGF 4 ng / mL iMEF dyrkingsmedium DMEM høy glukose Føtalt bovint serum (FBS) 15% Penicillin-Streptomycin 0,1% L-Glutamin 200 mM 4 mm MEM ikke-essensielle aminosyrerSyrer Solution (100x) 2x 2-mercaptoethanol 0,1 mm plating medium hESC medium 100% ROCK inhibitor (Y-27632) 10 mikrometer

    Tabell 1. Media komposisjon.

    analyse~~POS=TRUNC Framover Omvendt fragment PCR Cycle
    5'JA MCL CACTTTGAGCTCTACTGGCTTC CGTTACTATGGGAACATACGTCA 1,1 Kb 95 ºC, 5 '- [95 ºC, 30' '- 68 ºC (-0,5 ºC / syklus), 1' 30 ''] X15 - [95 ºC, 30 '' - 58 ºC, 30 '' - 72 ºC, 1 '30' '] X25 - 72 ºC, 5'
    3'JA MCL TAACTGAAACACGGAAGGAG AAGGCAGCCTGGTAGACA 1,4 Kb 95 ºC, 5 '- [95 ºC, 30' '- 68 ºC (-0,5 ºC / syklus), 1' 30 ''] X15 - [95 ºC, 30 '' - 58 ºC, 30 '' - 72 ºC, 1 '30' '] X25 - 72 ºC, 5'
    5'JA RMCEL CACTTTGAGCTCTACTGGCTTC CATGTTAGAAGACTTCCTCTGC 1,1 Kb 95 ºC, 5 '- [95 ºC, 30' '- 68 ºC (-0,5 ºC / syklus), 1' 30 ''] X15 - [95 ºC, 30 '' - 58 ºC, 30 '' -72 ºC, 1 '30' '] X25 - 72 ºC, 5'
    3'JA RMCEL TTCACTGCATTCTAGTTGTGG AAGGCAGCCTGGTAGACA 1,5 Kb 95 ºC, 5 '- [95 ºC, 30' '- 68 ºC (-0,5 ºC / syklus), 1' 30 ''] X15 - [95 ºC, 30 '' - 58 ºC, 30 '' - 72 ºC, 1 '30' '] X25 - 72 ºC, 5'
    5'RI giver GTACTTTGGGGTTGTCCAG TTGTAAAACGACGGCCAG 0,5 Kb 95 ºC, 5 '- [95 ºC, 30' '- 60 ºC, 30' '- 72 ºC, 30' '] X25 - 72 ºC, 5'
    3'RI giver CCTGAGTTCTAACTTTGGCTC ACACAGGAAACAGCTATGAC 0,5 Kb
    RI FLPe CCTAGCTACTTTCATCAATTGTG GTATGCTTCCTTCAGCACTAC 0.65 Kb 95 ºC, 5 '- [95 ºC, 30' '- 60 ºC, 30' '- 72 ºC, 30' '] X25 - 72 ºC, 5'

    Tabell 2. Primer sett som brukes til PCR Genotyping. Modifisert fra Ordovas et al., 2015 13.

    Discussion

    Gene redigering metoder i safe harbour loci forbli et viktig verktøy for å utvikle transgenesis i hPSCs. Selv om den trygge havnen karakter AAVS1 har nylig blitt avhørt for enkelte programmer 13,18, forblir dette locus for tiden det beste kjennetegnet ved humane cellelinjer utvunnet. Bevissthet om sine begrensninger i hPSCs kan bidra til å få pålitelige data. Derfor er AAVS1 fortsatt forventes å være et nyttig nettsted, for eksempel for gevinst-og tap-av-funksjon studier eller induserbar / konstituerende uttrykk for faktorer som krever en isogen sammenheng i og mellom bestemte genetiske bakgrunn.

    Den AAVS1 locus har blitt angrepet av mange grupper som bruker ZFNs, TALEN eller CRISPR / Cas9 1,2,19. Disse nukleaser i betydelig grad øke effektiviteten av homolog rekombinasjon i en bestemt locus. Imidlertid er prosessen skjermen og fullstendig karakterisering korrekt rettet kloner, fri for tilfeldig integrasjon og å opprettholde pluripotency og genom integritet kan ta opptil 3 måneder (med optimaliserte genet redigeringsverktøy) (figur 3). De to sistnevnte kan være forårsaket av mulige mutasjoner som genereres av off-target nukleaseaktivitet. Den RMCE system som brukes her, men tilbyr en rask, effektiv og elegant metode for å oppnå dette målet i bare to uker, når rekombinase spesifikke mål sekvenser preintegrated inn i AAVS1 locus. Bruk av positiv / negativ seleksjon og et passende utvalg program er de viktigste faktorene som bidrar til forenkling av genet redigering i AAVS1 locus av RMCE.

    Genotypisk karakterisering av de nye transgene linjer er betydelig redusert (ikke klonal screening er nødvendig), og karakterisering forbundet til off-target nukleaseaktivitet er gjengitt unnværlig på grunn av spesifisiteten av FLPe for FRTs. Karakteriseringen kan også reduseres i rutine RMCE eksperimenter ved å demonstrerefullstendig tap av GFP uttrykk fra master-cellelinjen (figur 2A), fordi fullstendig kassett utveksling og mangel på tilfeldig integrering er allerede tilstrekkelig måte ved hjelp av PCR (figur 2B), og Southern blot-13. Bruk av positiv / negativ seleksjon utgjør også den største forskjellen med tidligere rapporter. Flere grupper som tidligere er beskrevet RMCE i hPSCs, enten i AAVS1 eller andre loci, anvendes kun en enkelt positiv seleksjonstrinnet 7,14,16. Dette utgjør ikke et vesentlig teknisk fordel overfor gen redigering utført med nukleaser, fordi koloniscreening må være likt utført for å demonstrere riktig integrering og fravær av tilfeldig integrering på den klonale nivå.

    Bruk av dette system RMCE i flere hESC / IPSC linjer krever preintegration av den beskrevne FRT-inneholdende kassett i AAVS1 locus av hver uavhengig linje. Imidlertid, når generert,sin hurtighet og enkelhet gjør det mulig å utvikle semi-high throughput genetiske skjermer i definerte isogene innstillingene for programmene som er nevnt ovenfor som ellers ville være teknisk svært tidkrevende. I tillegg er alle RMCE vektorer konstruert innenfor PZ AAVS1 genet målretting vektor brukt til å målrette locus med ZFNs, men Talens eller CRISPR / Cas9 ble også rapportert. Den RMCE vektor sin dualitet er svært nyttig å generere flere linjer for en bestemt transgen i hPSCs med eller uten FRT. For eksempel, en hit demonstrert vellykket i en bestemt genetisk skjerm utføres av RMCE ville ideelt trenger å bli testet i flere hPSC linjer for å bekrefte resultatene. I fravær av multiple RMCE-passende mester cellelinjer, kan direkte genet målretting av trykk ved hjelp av nukleaser utføres. Nytten av den doble karakter av RMCE vektorer har blitt bevist av vår gruppe 20. I denne studien ble genet korreksjon utført i pasient-avledetFrontotemporal demens (FTD) iPSCs som bærer en mutasjon som forårsaker PROGRANULIN (PGRN) uttrykk mangel. Gene komplementering av ZFNs-mediert innføring i AAVS1 locus av en kassett som restaurert PGRN nivåer, korrigeres den defekte fenotypen i corticogenesis assosiert med tilstedeværelse av mutasjonen. I tillegg ble en tilsvarende linje som genereres ved RMCE i WT hESCs å bli brukt som kontroll for eksogen PGRN ekspresjon.

    I fravær av rekombinante kolonier, kontrollerer transfeksjonseffektiviteten av RMCE donor-vektoren. Transfeksjonseffektiviteter overlegne i forhold til 30% gi de resultater som er angitt ovenfor. Lavere transfeksjonseffektiviteter redusere rekombinasjon effektivitet. Endelig har RMCE system blitt generert i den AAVS1 locus, men det kan anvendes for en hvilken som helst annen locus.

    Materials

    Name Company Catalog Number Comments
    DR4 Mouse Embryonic Fibroblasts (MEF) AMS bio GSC-6204G hPSC culture on feeders
    CF-1 MEF, mitomycin-C treated AMS Bio GSC-6001M
    EmbryoMax 0.1% Gelatin Solution Millipore ES-006-B iMEF plating
    DMEM/F-12, HEPES Gibco 31330-038
    KnockOut Serum Replacement

    Gibco 10828-028
    L-Glutamine Sigma Aldrich G8540 For hESC medium
    L-Glutamine, 200 mM Gibco 25030-081 For iMEF medium
    2-Mercaptoethanol, 50 mM Gibco 31350-010
    MEM Non-Essential Amino Acids Solution (100x) Gibco 11140-035
    Penicillin-Streptomycin (10,000 U/mL) Gibco 15140122
    Human basic FGF Peprotech 100-18C
    Y-27632 in Solution VWR 688001-500
    DMEM High Glucose Gibco 41965-039 
    Fetal Bovine Serum (FBS) Sigma Aldrich F7524
    Trypsin-EDTA (0.05%), phenol red Gibco 25300-054 hPSC culture on feeders
    Matrigel, hESC qualified VWR 734-1440
    mTeSR1 complete medium kit Stem cell technologies 05850 For Feeder-free culture
    StemPro Accutase Cell Dissociation Reagent Gibco A1110501 For feeder-free culture
    Y-27632 in solution VWR 56726
    Human Stem Cell Nucleofector Kit 2 Lonza VVPH-5022
    Puromycine Dihydrochloride Gibco A11138-03
    FIAU (Fialuridine) ABX 2910
    Hygromycin B Sigma Aldrich H3274
    pFLPe Modified to from pCAGGS-FLPe (MES4488, Open Biosystems) to remove puromycin
    RMCE donors - - Modified from pZ donor AAVS1 puromycin vector (PZD0020-1KT, Sigma Aldrich)13
    5 mL Round Bottom Polystyrene Test Tube, with Cell Strainer Falcon 352235
    PureLink Genomic DNA kit Invitrogen K182001
    GoTaq Flexi DNA Polymerase Promega M8298
    Agarose Sigma A9539
    SYBR Safe DNA Gel Stain Invitrogen S33102
    Nucleofector 2b Device Lonza (Amaxa) AAB-1001
    NucleoCounter NC-100 Chemometec NC-100
    BD FACS Canto BD Biosciences 337175
    NucleoCassette Chemometec 941-0002

    DOWNLOAD MATERIALS LIST

    References

    1. Hockemeyer, D., et al. Genetic engineering of human pluripotent cells using TALE nucleases. Nat. Biotechnol. 29, (8), 731-734 (2011).
    2. Hockemeyer, D., et al. Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nat. Biotechnol. 27, (9), 851-857 (2009).
    3. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
    4. Baer, A., Bode, J. Coping with kinetic and thermodynamic barriers: RMCE, an efficient strategy for the targeted integration of transgenes. Curr. Opin. Biotechnol. 12, (5), 473-480 (2001).
    5. Sakurai, K., et al. Efficient integration of transgenes into a defined locus in human embryonic stem cells. Nucleic Acids Res. 38, (7), e96 (2010).
    6. Irion, S., et al. Identification and targeting of the ROSA26 locus in human embryonic stem cells. Nat. Biotechnol. 25, (12), 1477-1482 (2007).
    7. Di Domenico, A. I., Christodoulou, I., Pells, S. C., McWhir, J., Thomson, A. J. Sequential genetic modification of the hprt locus in human ESCs combining gene targeting and recombinase-mediated cassette exchange. Cloning Stem Cells. 10, (2), 217-230 (2008).
    8. Lombardo, A., et al. Site-specific integration and tailoring of cassette design for sustainable gene transfer. Nat. Methods. 8, (10), 861-869 (2011).
    9. Lombardo, A., et al. Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery. Nat. Biotechnol. 25, (11), 1298-1306 (2007).
    10. Simth, J. R., et al. Robust , Persistent Transgene Expression in Human Embryonic Stem Cells Is Achieved with AAVS1-Targeted Integration. Stem Cells. 26, 496-504 (2008).
    11. DeKelver, R. C., et al. Functional genomics, proteomics, and regulatory DNA analysis in isogenic settings using zinc finger nuclease-driven transgenesis into a safe harbor locus in the human genome. Genome Res. 20, (8), 1133-1142 (2010).
    12. Qian, K., et al. A simple and efficient system for regulating gene expression in human pluripotent stem cells and derivatives. Stem Cells. 32, (5), 1230-1238 (2014).
    13. Ordovás, L., et al. Efficient Recombinase-Mediated Cassette Exchange in hPSCs to Study the Hepatocyte Lineage Reveals AAVS1 Locus-Mediated Transgene Inhibition. Stem Cell Reports. 5, (5), 918-931 (2015).
    14. Du, Z. -W., Hu, B. -Y., Ayala, M., Sauer, B., Zhang, S. -C. Cre recombination-mediated cassette exchange for building versatile transgenic human Embryonic Stem Cells lines. Stem Cells. 27, 1032-1041 (2009).
    15. Papapetrou, E. P., et al. Genomic safe harbors permit high β-globin transgene expression in thalassemia induced pluripotent stem cells. Nat. Biotechnol. 29, (1), 73-78 (2011).
    16. Ramachandra, C. J., et al. Efficient recombinase-mediated cassette exchange at the AAVS1 locus in human embryonic stem cells using baculoviral vectors. Nucleic Acids Res. 39, (16), e107 (2011).
    17. Takata, Y., Kondo, S., Goda, N., Kanegae, Y., Saito, I. Comparison of efficiency between FLPe and Cre for recombinase-mediated cassette exchange in vitro and in adenovirus vector production. Genes to Cells. 16, (7), 765-777 (2011).
    18. Mizutani, T., Li, R., Haga, H., Kawabata, K. Transgene integration into the human AAVS1 locus enhances myosin II-dependent contractile force by reducing expression of myosin binding subunit 85. Biochem. Biophys. Res. Commun. 465, (2), 270-274 (2015).
    19. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
    20. Raitano, S., et al. Restoration of progranulin expression rescues cortical neuron generation in an induced pluripotent stem cell model of frontotemporal dementia. Stem Cell Reports. 4, (1), 16-24 (2015).
    Rask og effektiv produksjon av rekombinant humant Pluripotent stamceller ved rekombinase-mediert Cassette Exchange i den<em&gt; AAVS1</em&gt; Locus
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ordovás, L., Boon, R., Pistoni, M., Chen, Y., Sambathkumar, R., Helsen, N., Vanhove, J., Berckmans, P., Cai, Q., Vanuytsel, K., Raitano, S., Verfaillie, C. M. Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus. J. Vis. Exp. (117), e54718, doi:10.3791/54718 (2016).More

    Ordovás, L., Boon, R., Pistoni, M., Chen, Y., Sambathkumar, R., Helsen, N., Vanhove, J., Berckmans, P., Cai, Q., Vanuytsel, K., Raitano, S., Verfaillie, C. M. Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus. J. Vis. Exp. (117), e54718, doi:10.3791/54718 (2016).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter