Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

En protokol til laboratoriet boliger af turkis Killifish (Nothobranchius furzeri)

doi: 10.3791/57073 Published: April 11, 2018

Summary

Laboratoriet boliger af turkis killifish kan skaleres op til huset og effektivt øge tusindvis af individuelle fisk i en centraliseret vand filtreringssystem, anvender den samme infrastruktur, der anvendes til standard zebrafisk faciliteter. Vi detalje her en liste over standardiserede procedurer, der giver effektiv killifish vedligeholdelse.

Abstract

Udviklingen af opdrætsmetoderne i ikke-model laboratorium fisk, der anvendes til forsøgsformål høj grad har nydt godt af etableringen af reference fisk modelsystemer, såsom zebrafisk og medaka. I de seneste år, er blevet vedtaget en nye fisk – den turkis killifish (Nothobranchius furzeri) – af en voksende række forskergrupper inden for biologi af aldring og økologi. Med en fangenskab levetid på 4-8 måneder, denne art er den yngstlevende hvirveldyr rejst i fangenskab og giver mulighed for det videnskabelige samfund til test – på kort tid – eksperimenterende indgreb, der kan føre til ændringer af den aldrende sats og levetid. I betragtning af denne art, kendetegnet ved embryonale diapause unikke biologi, markeret eksplosive seksuelle modning, morfologiske og adfærdsmæssige seksuelle dimorphism- og deres forholdsvis korte voksen levetid - ad hoc- dyrehold praksis er i akut efterspørgsel. Denne protokol rapporterer en række centrale dyrehold foranstaltninger, der giver mulighed optimal turkis killifish laboratorium pleje, gør det muligt for det videnskabelige samfund til at vedtage denne art som en kraftfuld laboratorium dyremodel.

Introduction

I betragtning af deres korte levetid og hurtige livscyklus, vokser turkis killifish hurtigt som en lovende nye model organisme i biologi1,2,3. Denne art kendetegnes ved en unik livscyklus for en teleost, bestående af embryonale diapause, hurtig seksuel modning og en udvidet post-reproductive liv fase4,5. Seneste arbejde har bidraget til at belyse biologi af denne art, såvel i fangenskab i vilde6,7. Turkis killifish live i årstidens friske vand organer at form i løbet af regntiden i den afrikanske savanne i Zimbabwe og Mozambique. I den tørre sæson overleve embryoner i den tørre mudder i mangel af vand i kraft af en stress-resistente livsstadium kaldet diapause.

Genetiske kort for denne art har været genererede8,9, og for nylig deres genom er blevet sekventeret og samlet10,11. Flere indavlede laboratorium fisk stammer er blevet udviklet, og transgenese og genom-redigering via CRISPR/Cas9 er blevet tilgængelige i denne art, de facto fremme turkis killifish som en konkurrencedygtig laboratorium hvirveldyr model organisme 12,13,14.

Selv om en laboratorium protokol er allerede blevet offentliggjort for denne art15, i denne protokol, vi udvikler en omfattende liste over forsøgslaboratorium retningslinjer, der er specifikt rettet mod undersøgelser, at undersøger aldring og overlevelse. Denne protokol giver mulighed for forskere allerede bekendt med zebrafisk og medaka dyrehold at blive velbevandret i turkis killifish dyrehold ved at vedtage et minimum antal centrale justeringer. På samme tid giver denne protokol forskere uden forudgående erfaring i fisk dyrehold med de afgørende værktøjer for at hæve en blomstrende turkis killifish koloni.

Protocol

Fisk er rejst ved 28 ° C i en vand recirkulering system (Se vandparametre), med 10-20% daglig kloakering. Tre forskellige tank størrelser er anbefalede: 0.8 L, 2,8 L og 9,5 L. Hver tank modtager en konstant vandføring i 2 mL/s.

1. reagenser forberedelse (ikke inkluderet i materialer)

Bemærk: Afrikanske turkis killifish (Nothobranchius furzeri) kan leveres fra en etableret laboratorium lager. De årlige killifish udtørring-resistente embryoner kan sendes via mail. Det er afgørende at levere embryoner inden for 8-30 ° C temperaturinterval.

  1. Forberede humusfraktionerne syre (rugeæg) løsning ved at opløse 1 g/L humusfraktionerne syre i systemet vand. Autoklave, og opbevares ved 4 ° C i op til 10 uger.
  2. For at forberede HUFA Artemia berigelse, skal du tilføje HUFA berigelse til artemia hatcher dagligt på en koncentration 500 µL/L af artemia løsning.
  3. Forberede methylenblåt ved at opløse 100 µL/L af methylenblåt stamopløsning i tidligere autoklaveres system vand. Da methylenblåt er lysfølsomt, holde løsningen i mørke flasker, eller dække med folie. Butik på RT.
  4. Forberede coconut fiber som fast substrat for embryo inkubation. Alternativt kan du bruge et filtrerpapir (Se afsnit 1.5).
    1. Presoak kokos fiber med destilleret vand. Autoklave, og opbevares ved 4 ° C i op til 5 uger.
    2. På dagen for ægoplægningen, forberede petriskål med fugtig kokos fiber.
    3. Fyld en 90 mm diameter petriskål med kokos fiber under et stinkskab og ved siden af en flamme, til reduktion af kontaminering af gær og bakterier.
    4. Kompakt kokos fiber til en højde på 1 cm, med steril væv. Fjerne det meste af fugt fra kokos fiber ved at trykke på et papir håndklæde på toppen af pladen, lade papiret for at absorbere det overskydende vand. Varm en metalske over flammen, og tryk ned på hele overfladen af kokos fiber. Dette forhindrer kokos fiber svampe/bakteriel forurening.
  5. Forberede filtrerpapir som fast substrat for embryo inkubation.
    1. Dag, hvor embryoner overførsel, placere 3 lag filterpapir diske, der passer til 90-mm petriskål. Der tilsættes 5 mL af humusfraktionerne syre til at holde fugt.

2. avls

  1. Avl turkis killifish for stamme vedligeholdelse
    Bemærk: Efter denne protokol, seksuel modenhed opnås ved ~ 4 uger efter udklækningen og frugtbarhed toppe mellem 7-9 uger. Det er vigtigt at bemærke, at frugtbarhed afhænger fodring frekvens og fødevarekvalitet; Derfor, mindst to opfodring en dag pr. avl tank anbefales at hæve embryoner udbytte (Se afsnit 5.6.)
    1. Setup en 9,5 L formering tank. Fyld med system vand og tilføje én mand og to kvindelige fisk.
    2. Som mandlige afrikanske turkis killifish vise dominans under parring, som kunne føre til chikane af kvinder, vælge en mand med en lidt mindre kropsstørrelse end den kvindelige at reducere parring stress og øge formeringsevnen. Oprettet 5 uger gamle hanner med 6/7 uger gamle hunner.
    3. Fyld en plastikbeholder (10 x 10 x 5 cm) med autoklaveres sand at nå frem til en endelig dybde af ~ 2-3 cm og placere den sandkasse i midten af avl tank.
    4. Lad turkis killifish avle kontinuerligt og høste embryoner en gang om ugen for embryo inkubation.
      Bemærk: Brugen af sand substrat udgør udfordringer for centraliseret vandfiltrering systemer og bør erstattes af alternative metoder i fremtiden. Mulige alternativer kunne være anvendelsen af zebrafisk opdræt tanke.
  2. Avl for transgenese
    Bemærk: Embryoner til brug for injektioner skal synkroniseres på én-celle-fase, og dette kræver, at de er indsamlet umiddelbart efter befrugtningen.
    1. For at høste en celle fase embryoner skal bruges til injektion og generation af transgene linjer, konfigurere en formering tank med én mand og to kvindelige fisk, (samme som 2.1.).
    2. To dage før indsamlingsstedet, isolere mand i en enkelt tank og holde mandlige i visuel kontakt med voksne hunner.
    3. På dagen for samling, tilføje mandlige og en sandkasse til avl tank og lad dem gyde i 2 timer.

3. embryo dyrehold

  1. Embryonerne blev indsamlet
    Bemærk: Embryonopsamlingsteam udføres ved sigtning og høst embryoner fra boksen sand. Under normale forhold, bør hver sandkasse indeholder fra 30 til 200 embryoner.
    1. På dagen for samling, skal du fjerne sandkasse fra avl tank. Tømme boksen sand i en si (~0.9 mm stamme størrelse) og skyl med vand fra systemet. Dette kan ske over en stor akvarium at indsamle sand til autoklavering.
    2. Delvis nedsænkes si i system vand og hvirvles forsigtigt, at lade embryoner til at gruppere i midten.
    3. Indsamle embryoner med 10 mL Pasteur pipette.
    4. Overføre embryoner til en 90 mm petriskål i ~ 40 mL system vand.
    5. Inspicere embryoner i petriskålen under en lys stereomikroskopet og fjerne dem præsentere bristet chorion og tegn på skader.
    6. Fortsætte direkte til Embryo blegning.
      Bemærk: Brug altid en trævlesi pr. fisk stamme for at undgå potentielle cross-stamme embryo forureninger.
  2. Embryo blegning
    Bemærk: Embryo blegning forhindrer mikroorganismer findes i akvarier fra forurener inkubation medier.
    1. Før blegning, brug en engangs Pasteur pipette til at fjerne system vand fra petriskålen indeholdende indsamlet embryoner.
    2. For at forhindre uønskede svampe- og bakterieinfektioner vækst, der tilsættes 50 mL af frisklavede H2O2 (1% v/v i autoklaveres system vand) til de indsamlede embryoner.
    3. Ryst embryoner i 5 min ved en lav hastighed i 90 mm petriskåle i 50 mL opløsning.
    4. Fjern H2O2 løsning med engangs Pasteur pipette og vaske embryoner tre gange for 5 min med 50 mL af methylenblåt. Fjerne methylenblåt.
    5. Der tilsættes 50 mL H2O2 (1% v/v i autoklaveres system vand) til embryoner og omrystes i 5 min.
    6. Fjern H2O2 løsning og vaskes tre gange i 5 min. med 50 mL af methylenblåt.
    7. Inkuber embryoner ved 28 ° C at øge synkron embryoner udvikling, med en maksimal tæthed på 100 embryoner pr. 90 mm petriskål i 40 mL af methylenblåt.
      Bemærk: Ikke udvider embryo inkubation i blegning løsning. Dette kan forårsage skader på æg chorion og øge embryo dødelighed. Embryo blegning kan forårsage større fysisk-kemiske ændringer i ægget chorion, der kan medføre ændret chorion fysiologi og rugeæg succes.
  3. Embryo inkubation i methylenblåt
    Bemærk: Flydende inkubation i methylenblåt forhindrer parasit vækst og giver mulighed for påvisning af døde embryoner og ubefrugtede æg.
    1. Inspicere rugede embryoner, at fjerne alle døde embryoner (farves blå af methylenblåt) fra petriskål at forhindre svampe- og bakterieinfektioner forurening, som påvirker overlevelse af levende sunde embryoer.
    2. Fjern gamle methylenblåt og erstatte med frisk løsning.
    3. Returnere petriskål til 28 ° C inkubator (figur 1A). Inden for 7-10 dage, sikre at de udviklede embryoner vise synlige sorte øjne. Overføre disse embryoner til kokos fiber eller på filtrerpapir fast substrat medium (figur 1B).
    4. Bevare ubebyggede embryoner i methylenblåt, overvåger dagligt og overføre til fast substrat medium når sorte øjne har udviklet.
    5. Gentag trin 3.3.1-3.3.3 dagligt, indtil embryoner har synlige sorte øjne.
      Bemærk: Konstant eksponering af embryoner til methylenblåt kan fremkalde langsigtede ændringer i voksne fisk fysiologi.
  4. Ægoplægning til filtrerpapir
    Bemærk: Turkis killifish embryoner kan udvikle sig på et tørt underlag, recapitulating naturforhold. Derudover tør embryo inkubation gør det muligt for forskere at synkronisere embryoner og klækker dem samme dag.
    1. Som udviklede embryoner vil have synlige sorte øjne inden for 7-10 dage, bruge en engangs Pasteur pipette eller fint buet pincet til at overføre embryoner fra methylenblåt på et tidligere tilberedt filtrerpapir tallerken.
    2. Sprede embryoner ~ 5 mm fra hinanden med pincet, op til 100 embryoner pr. 90 mm plade (figur 1B).
    3. Forsegle petriskål med parafilm.
    4. Inkuber embryoner ved 28 ° C i 2-3 uger, indtil de har fuldt udviklet gyldne iris og er klar til udrugning (figur 1 c).
      Bemærk: Ikke forlænge inkubation af klar-til-lugen embryoner i mere end 2 uger som deres levedygtighed reduceres dramatisk.
  5. Ægoplægning at kokos fiber
    Bemærk: Autoklaveres, sterile kokos fiber (eller økologisk sphagnum) kan bruges som et gyldigt alternativ medium til fast substrat inkubation.
    1. Brug en engangs Pasteur pipette eller fint buet pincet til at overføre embryoner fra methylenblåt på en klar-til-brug kokos fiber tallerken.
    2. Sprede embryoner ~ 5 mm fra hinanden, op til 100 embryoner pr. 90 mm plade (figur 1B).
    3. Forsegle petriskål med parafilm.
    4. Inkuber embryoner ved 28 ° C i 2-3 uger, indtil de har fuldt udviklet gyldne iris (f.eks. i figur 1 c).
      Bemærk: Til langtidsopbevaring (op til et år), overføre embryoner på 3 dages post samling fra methylenblåt løsninger til en solid-substrat plade på 17 ° C. Inkuber embryoner, før de udvikler sorte øjne.

4. rugeæg turkis Killifish

Bemærk: Turkis killifish embryoner og kan med held klækket i et humusfraktionerne syreopløsning14.

  1. Med fint buet pincet, udviklede overføre omhyggeligt 50-100 embryoner til klækning kassen fyldt med den humusfraktionerne syre ved 4 ° C. Den humusfraktionerne syre består af 1 g/L humusfraktionerne syre i systemet vand. Autoklave, og opbevares ved 4 ° C i op til 10 uger. Sørg for, at alle embryoner er helt nedsænket. Den humusfraktionerne syreopløsning skal være overfladisk, ikke dybere end 2 cm.
    Bemærk: Lav temperatur af humusfraktionerne syre forbedrer rugeæg og fuldstændig nedsænkning af embryoner i løsningen giver synkroniserede rugeæg.
  2. Placer boksen rugeæg til 28 ° C rugeæg inkubator. Dække klækning kassen med låg. For at levere tilstrækkelig udluftning, Tilslut klækning kassen af slangen med luftforsyning.
    Bemærk: Ikke tilstrækkelig udluftning under inkubation resulterer i høje priser af Forbundsrepublikken Jugoslavien ikke i stand til at udfylde gas blæren ("belly-skyderen" fænotype, se Note i afsnit 5.1)
  3. Fra dagen efter klækning, for at opretholde passende vandkvaliteten i boksen rugeæg, tilføje autoklaveres system vand en gang om dagen i andelen af 1:1, holde en endelig dybde 2 cm.
  4. Overføre unhatched embryoner tilbage til fast substrat og forsøger udklækning en uge senere.
    Bemærk: Efter klækning, turkis killifish i stand til let at optagelse og spiser levende foder. For optimal vækst, feed fry to gange om dagen med overskydende frisk udklækket artemia (Artemia salina). Tegnet af fuld satiation er de orange-farvede underliv af yngel efter 10-15 min for hver fodring. Sifon ud den overskydende, uspist og opløste artemia ved hjælp af Pasteurs pipette på daglig basis.

5. hæve ungfisk og voksne fisk

  1. På fem dage efter udrugning, flytte ungfisk til fornyet omsætning vandsystem. Ved hjælp af engangs plast pipetter (eller en plastikske), omhyggeligt overførsel fem yngel pr. 0,8 L tank udstyret med 400 µm fry skærmen (figur 2).
    Bemærk: Det er muligt, at en del af juvenile killifish ikke vil have fyldt gas blæren, hvilket resulterer i en typisk "belly-skyderen" fænotype, karakteriseret ved fisk ikke nå ordentlig opdrift, tvinger dem til løbende svømme, forårsager alvorlige misdannelser i voksne fisk. Disse fisk kan ikke bruges til overlevelse assays eller effektiv avlsdyr og skal blive censureret.
  2. Fodre unge to gange om dagen med frisk udklækket artemia i overskud indtil 14 dage efter udrugning. Sifon ud af snavs fra bunden af hver tank dagligt.
  3. På 14 dage gammel, overførsel ungfisk til 2,8 L tank udstyret med en 850 µm fry skærm. Fra dette punkt og fremefter, mærke hver tank med fisk-ID, der angiver klækkes dato, stamme oplysninger, fisk køn og fisk identifikationsnummer (figur 3). For overlevelse assays, individuelt hus hver fisk i enkelt kampvogne fra dette punkt og fremefter.
  4. De følgende 7 dage, fodre unge to gange om dagen med ~ 2 mL artemia pr. fisk. På dette stadium fisk kan suppleres med 1-3 live blod orm (i tilfælde af blod orm larver er for store til fisken, hugge dem i mindre stykker med et barberblad). For at undgå forringelse af vandkvaliteten, sifon ud uspist mad og ekstra affald to gange om ugen.
  5. Efter 3 uger fra udklækningen, fjerne fry skærmen fra bagsiden af tanken og begynde at fodre hver fisk to gange om dagen ~ 2mL artemia og 0,5 mL blod orm. På dette stadium, unge fugle bør have nået 1 cm i kropsstørrelse og bør være i stand til at indtage full-size blod orm.
  6. 4 uger gamle, foder hver fisk to gange om dagen med ~ 2mL artemia og 1 mL blod orm. Hunnerne kan placeres sammen med en tæthed på op til 3 hunner pr. 2,8 L tank.
  7. I denne fase sikre, at fisk når komplet seksuel modning. Check for tilstedeværelse af store dorsale, anal og halefinne er med tegn på farvning i hanner og runde underliv fuld af æg i hunner.
    Bemærk: At hæve voksne fisk i individuelle tanke for overlevelse kohorteundersøgelser kan have negativ indflydelse fisk adfærd og sundhed. Gruppe bolig for overlevelse kohorteundersøgelser tilføjer imidlertid betydelig konfunderende faktorer på grund af etablering af sociale dominans og mandlige territorier, fører til strenge sociale hierarkier.

6. fodring

Bemærk: Laboratorium turkis killifish kan fodres en kombination af baby artemia (Artemia salina nauplii) og blod orm (Chironomus spp. larver). Turkis killifish yngel fodres udelukkende barnet artemia. Unge og voksne fisk fodres to gange om dagen både artemia og blod orm (figur 2). Ideelt set angivet fisk kan fodres flere gange om dagen, overstiger de 2 fodringer i denne protokol.

  1. Dyrkning artemia
    1. Tilføje 10 L vand fra omvendt osmose (RO) og 350 g røde Hav salt til en artemia hatcher og opløses ved luftning med en luftning tube.
    2. Berige kultur med 5 mL af meget umættede fedtsyre (HUFA).
    3. Tilføj 20 g af artemia cyster i ruge-løsning. Inspicere at artemia cyster ikke flyder på overfladen af vandet og sikre korrekt iltning og omsætning af kultur.
      Bemærk: Daglig delprøver af tørre artemia cyster kan opbevares ved 4 ° C.
    4. Om eftermiddagen næste dag levering kultur med en anden alikvot af 5 mL af HUFA.
  2. Høst skraverede artemia
    Bemærk: Efter ~ 36 h fra den begyndende kultur, artemia er klar til høst (instar II fase).
    1. Indsamle 5 L af kultur i en beholder ved hjælp af tryk på bunden af hatcher og lad sidde i 10 min.
    2. Efter 10 min, fjerne artemia skaller (brun farve) fra toppen af 5 L-beholder og filtrere den skraverede artemia (orange farve) gennem en maske. Være opmærksomme på at udelukke sedimentet fundet på bunden af beholderen, da det indeholder ikke-klækket æg og døde artemia.
    3. Skyl udklækket artemia med RO vand i en 2 L beholder og lad sidde i 10 min.
    4. Efter 10 min, filtrere artemia igen gennem en maske og indsamle i 2 L af RO vand.
    5. Gentag de forrige tre trin, indtil artemia løsning er fri for ikke-udklækket cyster og artemia skaller.
    6. Overføre artemia fra 2 L beholder til squeeze flasker til fodring.
      Bemærk: Dyrkning artemia er temmelig robust og pålidelig. Men for at undgå mangel på artemia i tilfælde af forgæves rugeæg, mindre (500 mL) backup klækkemaskinerne kan bruges.
  3. Opsætning af backup hatcher
    1. 17,5 g røde Hav salt i 500 mL RO vand opløses ved luftning.
    2. Berige kultur med 500 µL af HUFA.
    3. Der tilsættes 2 g af artemia cyster.
    4. Efter 18-24 h, levere kulturen engang mere med 500 µL af HUFA.
      Bemærk: artemia er klar til høst efter ~ 24 h.
  4. Forberedelse af levende blod orm
    1. Umiddelbart før fodring, filtrere en passende mængde blod orm gennem en si benytter RO vand.
      Bemærk: Live blod orm kan opbevares ved 4 ° C i 7-10 dage.
    2. Skyl blod orm med en lille mængde af RO vand i en plastikbeholder.
    3. Med en plastik Pasteur pipette (smal spids fjernet), tage op blod orm blandingen til fodring.
      Bemærk: Fodring laboratorium killifish kolonier med levende foder fra un-kontrollerede kilder tilføjer en risiko for eksterne forureninger fra parasitter og potentielt patogene mikrobielle samfund. I fremtiden bør der udvikles en ad hoc-sterile fiskefoder.

7. killifish laboratorium stamme genotypebestemmelse

Bemærk: For at skelne mellem turkis killifish stammer, samt at bestemme sex inden for hver stamme, specifikke genetiske (microsatellite) markører kan være brugt9 (tabel 1).

  1. Prøveudtagning
    1. Hold fisken sikkert i et net øverst på våd svamp.
    2. Svaber 2-3 skalaer fra selve fisk fra laag til halefinnen ved hjælp af bomuld svaberprøver.
    3. Vælge skalaer fra svaber og overføre 2-3 skalaer i 1 mL rør indeholdende natriumhydroxidoploesning (200 µL 0,5 mol/L NaOH, 1% β-Mercaptoethanol og 0,5% polyvinyl pyrrolidon).
    4. Spin PCR rør til 15 s for at sikre, at skalaer er helt nedsænket i NaOH opløsning.
  2. Genomisk DNA isolation
    1. Inkuber prøven i 20 min. ved 95 ° C.
    2. Cool på RT, neutralisere prøve med 1/10 bind 1 M Tris-HCl, pH 8,0.
    3. Der centrifugeres prøven i 5 min på fuld hastighed.

8. vandparametre

Bemærk: Opdræt af organismer hvis anvendelsesformålet er voksen fænotyper kræver meget stabile driftsforhold i hele levetiden af målarter. Derfor nødvendiggør dyrkning vand organismer, såsom turkis killifish, strenge kontrol af vandparametre. Vand recirkulering, med yderligere fire-trin vand filtration, sikrer en robust grundlag for at opnå kontrol over vandparametre, giver alle tanke med de samme vandforhold over tid. Det anbefales at rekonstruere system vand fra omvendt osmose (RO) vand, tilsættes med kommercielle marine salt og natriumbikarbonat.

  1. Vand omløb system ordning: først, spildevand fra fisk kampvogne strømme gennem faste partikler metal filter, der fanger alle un-spist madrester og større partikler. Metal filtre skylles tre gange om ugen; Andet, efter den første mekanisk filtrering, vand er formidles i store samleroer og derefter pumpes til et biofilter, hvor bakterier konvertere ammoniak til nitrit og nitrat; For det tredje fra biofilter pumpes vand til 25-µm filter ærmer, som fælde finere størrelse partikler. Endelig, vandet løber gennem ultraviolet (UV) lamper, at sterilisere vandet fra bakterier og vira. Efter disse fire trin returnerer filtreret vand til akvarier.
  2. Reducere mikroorganisme vækst i tanke, forhindre ophobning af nitrat og reducere er samlede saltholdighed, 10-20% af vandets system bortskaffet på daglig basis.
  3. Holde vand temperatur konstant ved 28 ° C, vandet pH konstant inden for området 7,0 til 7,5.
  4. Selvom killifish tolerere bred vifte af saltholdighed, for at undgå oodinosis, vedligeholde ledningsevne i området 650-710 mikro-Siemens. Et år lange 12t lys/mørke cyklus sikrer koloni sundhed og produktivitet.
    Bemærk: Killifish kan tåle vand ledningsevne op til 1500 mikro-Siemens.

Representative Results

Turkis killifish korrekt dyrehold medfører median overlevelse spænder mellem 12-18 uger i GRZ stamme (f.eks. figur 4A). Variationer af median overlevelse afhænger af kost, fodring frekvens og temperatur boligforhold. Dårlig landbrugsdrift resultater i overlevelse kurver præsenterer øget tidlig dødelighed og gentagne, pludselige dråber af overlevelse i hele tiden, kendetegnet ved flere bøjning points (figur 4B).

Figure 1
Figur 1: repræsentative embryonale udviklingsstadier med respektive inkubation substrat. (A) frisk indsamlet embryoner, inkuberes i methylenblåt i inkubator ved 28 ° C. (B) embryoner klar til at blive overført til solid medium, enten filtrere papir eller kokos fiber. (C) embryoner er klar til at blive udklækket, viser typiske gyldne iris. Skalalinjen svarer til 1 mm. venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: turkis killifish efter udklækning udvikling faser. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: repræsentant fisk id-mærke for fisk fra fase 3 og fremefter. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: repræsentative overlevelse kurven for 70 mandlige turkis killifish. (A) typiske overlevelse kurven for laboratorium-rejst turkis killifish. (B) sammenligning af overlevelse kurver fremstillet af fisk opdrættet under optimale driftsforhold (sort) og fattige dyrehold (rød og blå). Den stiplede røde vandrette linje angiver 50% overlevelse, krydsende overlevelse kurven på median levetid (angivet på x-aksen). Venligst klik her for at se en større version af dette tal.

ID Fremad primer Omvendt primer Størrelsesområde (bp)
* NfuSU0007 GGCTAAGCCTTGCTGACAGA CAGGGAGCTGAAAACCTCAG 166 - 214
* NfuSU0010 CGCAGTCTGATCAAATCGTGT TGTTTGAAGGTTCACATTCATTATC 220 - 272
NfuSU0016 CATGGCTAAACCGTGATGAA GAAGGACGCCAGCTATGAAG 209 - 240
NfuSU0022 AACACAGCTCTCGTAAGGAGGTA TTCAGACTTGTCTTACTACCATGTTT 198 - 238
NfuSU0027 TCCAGCTGAATCGGTAATGA AAACTCGAGGGTGCAATCTG 164 - 226
NfuSU0049 CTGGACAAAGTGCCAATCAC CTCCCACAGTCCCAAAACAT 196 - 197
NfuSU0050 CCAGAATGAACAATACTCAGATCAA GCAGCTTAGTTTAATGATATCACAATG 252 - 295
NfuSU0060 CTAGCCACTCCCCTGGTTTA CCGTCACGATGTGCTGATAC 216 - 248
NfuFLI0030 CAGAAGCTAAAGGCCAGACG GGGAAACAATAGGGAACCAC 174 - 205
* NfuFLI0091 ACGCTGACTCTACCCAGTC CTGCCTGCTACTGACAATG 355 - 373
* - sex bestemmelse markører

Tabel 1: Genotypebestemmelse primere for stamme identifikation.

Discussion

Vi beskriver en protokol for laboratoriet dyrkning af turkis killifish, herunder indsamlingsstedet, inkubation, såvel som voksne fisk boliger, avl og fodring. Vores protokol er specifikt målrettet til laboratorier, der udfører forskning fokuseret på voksne fisk, især til eksperimentelle undersøgelser af befolkningens aldring og levetid. Turkis killifish kan hæves på en standard zebrafisk facilitet; vigtige aspekter af killifish dyrehold varierer dog fra standard zebrafisk pleje16. Disse tilpasninger omfatter tidlige overgangen fra en artemia eneste kost til en kost suppleret med protein-rige blod orm, samt konkrete skridt i embryo inkubation, bestående af en flydende og tør inkubation fase.

Kritiske trin i protokollen omfatter shipping embryoner inden for 8-30 ° C temperaturinterval. Ved avl afhænger frugtbarhed fodring frekvens og fødevarekvalitet; Vi anbefaler derfor, mindst to opfodring en dag pr. avl tank for at øge embryoner udbytte (Se afsnit 5.6.). I løbet af embryo blegning, ikke Udvid embryo inkubation i blegning løsning. Dette kan medføre skader på æg chorion og øget embryo dødelighed. Når inkubere embryoner med methylenblåt, ikke forlænge inkubation af klar-til-lugen embryoner i mere end 2 uger som deres levedygtighed reduceres dramatisk. Til udrugning turkis killifish, lav temperatur af humusfraktionerne syre forbedrer rugeæg og fuldstændig nedsænkning af embryoner i løsningen giver synkroniserede rugeæg. Ikke tilstrækkelig udluftning under inkubation resulterer i høje priser af Forbundsrepublikken Jugoslavien ikke i stand til at udfylde gas blæren ("belly-skyderen" fænotype, se bemærkninger i afsnit 5.1).

Begrænsning af protokollen til avl omfatter brug af sand underlaget som udgør udfordringer for centraliseret vandfiltrering systemer og bør erstattes af alternative metoder i fremtiden. Mulige alternativer kunne være anvendelsen af zebrafisk opdræt tanke. Embryo blegning kan forårsage større fysisk-kemiske ændringer i ægget chorion, der kan medføre ændret chorion fysiologi og rugeæg succes. Konstant eksponering af embryoner til methylenblåt kan fremkalde langsigtede ændringer i voksne fisk fysiologi. At hæve voksne fisk i individuelle tanke for overlevelse kohorteundersøgelser kan påvirke fisk adfærd og sundhed negativt. Gruppe bolig for overlevelse kohorteundersøgelser tilføjer imidlertid betydelig konfunderende faktorer på grund af etablering af sociale dominans og mandlige territorier, fører til strenge sociale hierarkier. Derfor, vi bedømme, isolation af mandlige fisk for overlevelse undersøgelser er et fornuftigt kompromis. Fodring laboratorium killifish kolonier med levende foder fra un-kontrollerede kilder tilføje en risiko for eksterne forureninger fra parasitter og potentielt patogene mikrobielle samfund. I fremtiden bør der udvikles en ad hoc-sterile fiskefoder.

Fremtidige forbedringer af denne protokol vil fokusere på en kontrolleret, ikke-levende kost, der stadig fører til at færdiggøre seksuelle modning inden for 3-4 uger. I Resumé tilbyder vores protokol tilgængelighed til turkis killifish laboratorium dyrkning en bred forskersamfund.

Disclosures

Alle forfatterne erklærer ikke konkurrerende finansielle og ikke-finansielle interesser.

Acknowledgments

Vi takker Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar og alle medlemmer af Valenzano lab på Max Planck Institute for biologi for aldring for at bidrage til forskellige aspekter af den nuværende killifish dyrehold protokollen gennem årene.

Materials

Name Company Catalog Number Comments
Probe calibration buffer solution pH=7.0 Roth A518.1 1L buffer solution pH=7.0 to calibrate water system pH-electrode
Probe calibration buffer solution pH=4.0 Roth P712.1 1L buffer solution pH=4.0 to calibrate water system pH-electrode
Conductivity standard VWR 83607.260 500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode
Easy Strips Test 6in1 JBL 2533900 Test strips for determination chlorine values of system water
Ammonia Test JBL 2536500 Test to determine ammonia content of system water
Red Sea Salt Red Sea 22 kg bucket
Sodium hydrogen carbonate VWR 27780.360
Humic acid Sigma- Aldrich 53680-50G
New HUFA Artemia enrichment ZM Systems UK 75g bottle
Methylene blue Roth AE64.1
Hydrogen peroxide solution Sigma- Aldrich 31642-1L 30% (w/w)
Coconut fiber Dragon ZCS010
Whatman paper GE healthcare 3030-690
Ethanol pure VWR 20821.467 100%
Silica sand local pet shop
Artemia Eggs Premium Grade Sanders
Bloodworm local distributor Poseidon Aquakultur Germany
dNTPs solution mix Biolabs N04472 10mM
Taq DNA polymerase Invitrogen 18038-042 5U/uL
PCR 10x Buffer Invitrogen 18038-042
MgCl2 Invitrogen 18038-042 50mM
NaOH Sigma- Aldrich S8045-500g 50mM
Tris-HCl, pH=8.0 solution Sigma- Aldrich T2694-1L 1M
HCl 37% Sigma- Aldrich H1758-500mL
Fish tanks Aquaneering volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids
Orbital shaker VWR 89032-100 model 5000
Microbiological incubator Thermo Scientific, Heratherm 50125882 model IMC18; for storage embryos in the liquid phase, set to t=27-28°C
Cooling Incubator Binder 9020-0209 model KT115; for storage embryos in the solid phase, set to t=27-28°C
Hatching incubator Thermo Scientific, Heratherm 51028114 model OGS180; for embryos hatching, set to t=27-28°C
Stereomicroscope Leica model M80
Breeding sand/hatching boxes Roth 1598.1 1000mL
Petri dish Sarstedt 82.1473 92x16mm
50 mL Conical tube Sarstedt 62.547.254
15 mL Conical tube Sarstedt 62.554.002
Disposable Plastic Pasteur pipette Roth EA71.1 2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter
Serological pipette Sarstedt 86.1689.001 50mL
Syringe Henke Sass Wolf 4100-000V0 10mL
Metal strainer fineness <1mm; for embryos collection
Tweezers Dumont 0508-5/45-PO type5/45; for embryos transfer
25 L Brine shrimp hatcher Aquaneering ZHBS25 main hatcher
500 mL Brine shrimp hatcher JBL 6106100 model Artemio 1; backup hatcher
Narrow-mesh fish nets JBL
Sand beaker VWR BURK7102-5000 5000mL
Brine shrimp separation beaker VWR BURK7102-2000 2000mL
Plastic zipper bag Roth P279.2 for dead fish storage
Pipetboy Integra 155000 model Pipetboy acu2
Parafilm P-Lab P701605
Air tubing www.zajac.de AQ380 4-6 mm diameter
1 L Glass bottle VWR 215-1595
2 L Glass bottle VWR 215-1596
500 mL Squeeze bottle Roth K665.1 for fish feeding with brine shrimp
120-μm brine shrimp strainer Florida Aqua Farms BB-PC2 for brine shrimp/bloodworm collection
Finish filter socks Aquaneering MFVB025C 25-μm
Central filtration fish housing system Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz

DOWNLOAD MATERIALS LIST

References

  1. Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. Non-canonical aging model systems and why we need them. EMBO J. 36, (8), 959-963 (2017).
  2. Harel, I., Brunet, A. The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane. Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).
  3. Smith, P., et al. Regulation of life span by the gut microbiota in the short-lived African turquoise killifish. Elife. 6, (2017).
  4. Cellerino, A., Valenzano, D. R., Reichard, M. From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology. Biol Rev Camb Philos Soc. 91, (2), 511-533 (2016).
  5. Kim, Y., Nam, H. G., Valenzano, D. R. The short-lived African turquoise killifish: an emerging experimental model for ageing. Dis Model Mech. 9, (2), 115-129 (2016).
  6. Blazek, R., et al. Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient. Evolution. 71, (2), 386-402 (2017).
  7. Terzibasi, E., et al. Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri. PLoS One. 3, (12), e3866 (2008).
  8. Kirschner, J., et al. Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research. Aging Cell. 11, (2), 252-261 (2012).
  9. Valenzano, D. R., et al. Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri. Genetics. 183, (4), 1385-1395 (2009).
  10. Reichwald, K., et al. Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish. Cell. 163, (6), 1527-1538 (2015).
  11. Valenzano, D. R., et al. The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan. Cell. 163, (6), 1539-1554 (2015).
  12. Harel, I., et al. A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate. Cell. 160, (5), 1013-1026 (2015).
  13. Valenzano, D. R., Sharp, S., Brunet, A. Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging. G3. 1, (7), Bethesda. 531-538 (2011).
  14. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nat Protoc. 11, (10), 2010-2028 (2016).
  15. Polacik, M., Blazek, R., Reichard, M. Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri. Nat Protoc. 11, (8), 1396-1413 (2016).
  16. Avdesh, A., et al. Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction. J Vis Exp. (69), e4196 (2012).
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).More

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter