Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

פרוטוקול עבור המעבדה דיור של טורקיז דגים גמבוזיים (Nothobranchius furzeri)

doi: 10.3791/57073 Published: April 11, 2018

Summary

דיור מעבדה של טורקיז דגים גמבוזיים ניתן לשנות את בית ולגדל ביעילות אלפי דגים בודדים במערכת סינון מים מרכזי, העסקת התשתית באותו המשמש להכנת דג זברה סטנדרטי. כאן אנחנו פירוט רשימת נהלים סטנדרטיים לאפשר דגים גמבוזיים יעיל תחזוקה.

Abstract

פיתוח שיטות גידול דגים-מודל מעבדה המשמש למטרות ניסוי הרוויחה במידה רבה הנובעת מקיומן של הפניה דגים דגם מערכות, כגון דג זברה, medaka. בשנים האחרונות, דגים המתעוררים – טורקיז דגים גמבוזיים (Nothobranchius furzeri) – אומץ על ידי מספר גדל והולך של קבוצות מחקר בתחומי הביולוגיה של הזדקנות ואקולוגיה. עם תוחלת החיים בשבי של 4-8 חודשים, מין זה חוליות shortest-lived גידלה בשבי ומאפשרת לקהילה המדעית התערבויות ניסיוני מבחן – תוך זמן קצר – זה יכול להוביל שינוי קצב ההזדקנות ואת תוחלת החיים. בהתחשב הביולוגיה ייחודי של מין זה, המאופיין דיאפאוזה, התבגרות מינית נפץ, מסומן מורפולוגיים והתנהגותיים צורתיות - ו שלהם קצר יחסית למבוגרים אורך החיים - גידול אד הוק נוהלי הם בדחוף לפי דרישה. פרוטוקול זה מדווחת קבוצת מפתח בעלי אמצעים המאפשרים דגים גמבוזיים טורקיז אופטימלית טיפול מעבדה, הפיכת הקהילה המדעית לאמץ את המין הזה כמודל חיות מעבדה רב עוצמה.

Introduction

בהתחשב שלהם תוכלת חיים קצרה, מהירה מחזור חיים, דגים גמבוזיים טורקיז גדלים במהירות כ אורגניזם מודל חדש מבטיח ביולוגיה1,2,3. מין זה מאופיין על ידי מחזור חיים ייחודי עבור teleost, המורכב של דיאפאוזה, התבגרות מינית מהירה של משך חיים post-reproductive שלב4,5. העבודה האחרונה תרם שחקרתי את הביולוגיה של מין זה בשבי והן את הבר6,7. דגים גמבוזיים טורקיז חיים גופי מים טריים עונתיים טופס זה במהלך העונה הגשומה, בסוואנה האפריקנית ב זימבבואה ומוזמביק. במהלך העונה היבשה, העוברים לשרוד בבוץ יבש בהיעדר מים מכוח שלב חיים עמידים ללחץ הנקרא תרדמה ואסטרטגיה.

הגנטי מפות עבור המין הזה שנוצר8,9, לאחרונה את הגנום שלהם היה ברצף, שהורכבו10,11. פותחו זנים שונים של דגים מעבדה המפגרים, ו transgenesis ו גנום עריכה דרך CRISPR/Cas9 הופכים לזמינים במין זה, דה-פקטו קידום דגים גמבוזיים טורקיז כאורגניזם מודל חוליות תחרותי מעבדה 1213,,14.

למרות שכבר פורסמה פרוטוקול המעבדה הזה מינים15, בפרוטוקול הנוכחי אנו מפתחים רשימה מקיפה של קווים מנחים מעבדה ניסויית מכוונים במיוחד מחקרים לחקור הזדקנות והישרדות. בפרוטוקול הנוכחי מאפשר לחוקרים מוכר כבר עם גידול דג זברה, medaka הופכים שבקיאים גידול דגים גמבוזיים טורקיז על ידי אימוץ מספר מינימלי של התאמות מפתח. במקביל, פרוטוקול זה מספק חוקרים ללא ניסיון קודם בגידול דגים עם כלים חיוניים לגדל מושבה דגים גמבוזיים טורקיז משגשגת.

Protocol

דגים גדלים ב 28 ° C מערכת מחזור מים (ראה פרמטרים מים), עם סילוק מים מדי יום 10-20%. שלושה טנקים שונים גדלים מומלצים: 0.8 L, 2.8 L ו- 9.5 ל' טנק אחד מקבל זרם מים קבוע של 2 מ ל/s.

1. הכנה ריאגנטים (לא כולל חומרים)

הערה: דגים גמבוזיים טורקיז אפריקאי (Nothobranchius furzeri) יכולה להינתן במלאי הוקמה מעבדה. העוברים עמידים לייבוש השנתי דגים גמבוזיים יכול להישלח בדואר. . זה קריטי למשלוח עוברי בטווח טמפרטורה 8-30 ° C

  1. להכין רקבובי חומצה (הבקיעה) פתרון על ידי המסת 1 g/L חומצה רקבובי במערכת מים. אוטוקלב וחנות ב 4 ° C עד 10 שבועות.
  2. להכנת HUFA Artemia העשרה, להוסיף העשרה HUFA האטצ'ר ארטמיה מדי יום-ריכוז 500 µL/L של שרימפסים פתרון.
  3. להכין פתרון מתילן כחול על ידי המסת µL 100/L של מתילן כחול פתרון מלאי במים מערכת בעבר בלוק. מאחר מתילן כחול רגישים לאור, לשמור את הפתרון בבקבוקים כהים, או לכסות עם נייר כסף. החנות RT.
  4. להכין סיבי קוקוס כמו מצע מוצק העובר הדגירה. לחלופין, השתמש במסנן נייר (ראו סעיף 1.5).
    1. Presoak סיבי קוקוס עם מים מזוקקים. אוטוקלב וחנות ב 4 ° C עד 5 שבועות.
    2. ביום של השתלת, להכין צלחת פטרי עם סיבי קוקוס לחים.
    3. מלאו 90-מ מ קוטר צלחת פטרי עם סיבי קוקוס ברדס fume, ליד להבה, כדי לצמצם זיהום על ידי שמרים וחיידקים.
    4. סיבי קוקוס קומפקטי עד לגובה של 1 ס מ, עם רקמה סטרילי. הסר רוב הלחות סיבי קוקוס על ידי לחיצה על מגבת נייר על גבי הלוח, נותן את הנייר כדי לספוג את עודפי המים. מחממים כף מתכת מעל הלהבה, ולחץ על פני כולו של סיבי קוקוס. פעולה זו מונעת זיהום פטרייתי/בקטריאלי סיבי קוקוס.
  5. להכין נייר הסינון כמו מצע מוצק העובר הדגירה.
    1. ביום של העברת העוברים, מקום 3 שכבות של נייר סינון דיסקים מתאימים הפטרי 90-מ מ. הוסף 5 מ ל תמיסה חומצית רקבובי כדי לשמור על לחות.

2. גידול

  1. גידול דגים גמבוזיים טורקיז לתחזוקה זן
    הערה: בעקבות פרוטוקול זה, בגרות מינית נגיש ~ 4 שבועות לאחר הבקיעה ופוריות, פסגות בין 7-9 שבועות. חשוב לציין כי פוריות תלויה האכלה תדירות ואיכות המזון; לכן, האכלות לפחות שני ליום רבייה טנק מומלץ לגדל עוברי תשואה (ראו סעיף 5.6.)
    1. תוכנית ההתקנה מיכל רבייה 9.5 L. למלא עם מערכת מים ולהוסיף זכר אחד, שני דגים נקבה.
    2. כאשר זכר דגים גמבוזיים טורקיז אפריקאי להציג הדומיננטיות בעת ההזדווגות, אשר עלול להוביל הטרדה של נקבות, לבחור זכר בגודל הגוף מעט קטן יותר מאשר לנקבה כדי להפחית את הלחץ ההזדווגות, להגדיל את התפוקה הרבייה. הגדרת בן בשבוע-5 גברים עם נקבות 6/7-בת שבוע.
    3. מילוי מיכל פלסטיק (10 x 10 x 5 ס מ) עם חול בלוק שהגיע לעומק הסופי של ~ 2-3 ס מ ומניחים את ארגז החול במרכז המיכל הרבייה.
    4. תן טורקיז דגים גמבוזיים באופן רציף להתרבות ולקצור עוברי פעם בשבוע עבור העובר הדגירה.
      הערה: השימוש של מצע חול מציב אתגרים למערכות סינון מרכזי ולא צריך להיות מוחלף על ידי שיטות אלטרנטיביות בעתיד. חלופות אפשריות יכולה להיות השימוש של דג זברה גידול טנקים.
  2. רבייה עבור transgenesis
    הערה: העוברים לשימוש עבור זריקות צריך להיות מסונכרנים בשלב אחד-התא-, זה דורש כי הם שנאספו מיד לאחר ההפריה.
    1. הקציר חד-תא-שלבי העוברים לשימוש עבור הזרקה ויצירת קווי מהונדס, להגדיר את מיכל רבייה עם זכר אחד, שני דגים נקבה (כמו 2.1.).
    2. יומיים לפני אוסף העובר, לבודד את הזכר במיכל בודדים ולשמור הזכר בקשר עין עם נשים בוגרות.
    3. ביום של אוסף, להוסיף למיכל הרבייה הזכר וארגז חול ולתת להם להשריץ כבר שעתיים.

3. העובר גידול

  1. אוסף העובר
    הערה: אוסף העובר מתבצע על ידי ניפוי קצירת עוברי מתוך תיבת חול. בתנאים רגילים, כל תיבת חול צריך להכיל בין 30 ל 200 עוברי.
    1. ביום של אוסף, להסיר את ארגז החול מתוך הטנק הרבייה. לרוקן את תיבת חול לתוך מסננת (~0.9 מ מ זן גודל), לשטוף עם מים המערכת. ניתן לבצע זאת נגמר טנק גדול לאיסוף חול עבור autoclaving.
    2. חלקית להטביע את מסננת בתוך מערכת מים ו מערבולת בעדינות, נותן את העוברים לקבץ יחד במרכז.
    3. לאסוף את העוברים. עם 10 מ ל פסטר פיפטה.
    4. העברת העוברים 90 מ מ פטרי ב ~ 40 מ ל מים המערכת.
    5. בדיקת העוברים בתוך צלחת פטרי תחת stereomicroscope אור ולהסיר אלה מציגים chorion קרע וסימנים של נזק.
    6. המשך ישירות העובר הלבנת.
      הערה: השתמש תמיד מסננת אחת לכל זן דגים כדי למנוע מציג צלב-זן העובר פוטנציאליים.
  2. העובר הלבנת
    הערה: העובר הלבנת מונע מיקרואורגניזמים נוכח מיכלי דגים ובלחות התקשורת הדגירה.
    1. לפני הלבנה, להשתמש פיפטה פסטר חד פעמיות כדי להסיר את מערכת המים הפטרי המכיל עוברי שנאספו.
    2. כדי למנוע צמיחה פטרייתי ובקטריאליות לא רצויים, להוסיף 50 מ ל שזה עתה הוכנו H2O2 (1% v/v במים מערכת בלוק) העוברים שנאספו.
    3. לנער עוברי במשך 5 דקות במהירות נמוכה ב- 90 מ מ פטרי בפתרון 50 מ.
    4. הסרת פתרון2 2O H עם פיפטה פסטר חד פעמיות ולשטוף עוברי שלוש פעמים במשך חמש דקות עם 50 מ של פתרון מתילן כחול. הסרת פתרון מתילן כחול.
    5. להוסיף 50 מ של2O H2 (1% v/v במים מערכת בלוק) העוברים ומנערים במשך 5 דקות.
    6. הסרת H2O2 פתרון ולשטוף שלוש פעמים במשך חמש דקות עם פתרון מתילן כחול 50 מ.
    7. דגירה עוברי ב 28 ° C כדי להגדיל את התפתחות העוברים סינכרונית, ב צפיפות מקסימלית של 100 עוברי לכל 90 מ מ פטרי ב- 40 מ"ל של פתרון מתילן כחול.
      הערה: לא להרחיב את העובר הדגירה בפתרון הלבנה. זה עלול לגרום נזק chorion הביצה ולהגדיל תמותת העובר. העובר הלבנת עלול לגרום שינויים משמעותיים פיזית-כימית ב chorion ביצה אשר עלולה לגרום chorion שינו פיסיולוגיה, הבקיעה הצלחה.
  3. העובר הדגירה מתילן כחול
    הערה: הדגירה נוזלי תמיסת מתילן כחול מונע גידול הטפיל ומאפשרת זיהוי של עוברי המת וביצים מופרית.
    1. לבדוק את העוברים מתפשט, הסרת כל העוברים מת (מוכתמת כחול מתילן כחול) הפטרי למניעת זיהום פטרייתי ובקטריאליות המשפיעים על ההישרדות של העוברים בריאים בשידור חי.
    2. הסרת פתרון מתילן כחול ישן ותחליף פתרון טריים.
    3. לחזור פטרי חממה 28 ° C (איור 1 א'). בתוך 7-10 ימים, ודא כי העוברים מפותחת להראות גלוי עיניים שחורות. העברת העוברים האלה את סיבי קוקוס או המדיום מצע מוצק נייר סינון (איור 1B).
    4. שומרים על העוברים לא מפותח בצבע כחול מתילן, לפקח מדי יום, ולהעביר לבינונית מצע מוצק ברגע פיתחו עיניים שחורות.
    5. חזור על צעדים 3.3.1-3.3.3 מדי יום עד עוברי יש עיניים שחור גלויה.
      הערה: חשיפה מתמדת של העוברים מתילן כחול עלול לגרום שינוי ארוך טווח בפיזיולוגיה דגים למבוגרים.
  4. העובר העברת נייר סינון
    הערה: עוברי דגים גמבוזיים טורקיז יכול להתפתח על מצע יבש, recapitulating בתנאי הטבע. בנוסף, העובר יבש הדגירה מאפשר לחוקרים לסנכרן העוברים ושל קווקוו אותם באותו יום.
    1. כפי עוברי מפותחות יהיו עיניים שחור גלויה בתוך 7-10 ימים, השתמש פיפטה פסטר חד פעמיות או פינצטה מעוקל בסדר להעברת העוברים מהפתרון מתילן כחול על גבי צלחת נייר סינון בעבר מוכן.
    2. מורחים עוברי ~ 5 מ"מ בנפרד עם מלקחיים, עד 100 עוברי לכל צלחת 90 מ מ (איור 1B).
    3. לאטום את צלחת פטרי עם מצלמות-מיקרוסקופים.
    4. דגירה עוברי-28 מעלות צלזיוס במשך 2-3 שבועות, עד שהם פיתחו באופן מלא קשתיות הזהב והם מוכנים מאינקובטור (איור 1C).
      הערה: לא להאריך דגירה של עוברי מוכן לצוהר-יותר מ 2 שבועות כפי הכדאיות שלהם יקטן באופן משמעותי.
  5. העברת העובר סיבי קוקוס
    הערה: סיבי קוקוס בלוק, סטרילי (או כבול אורגני) יכול לשמש כאמצעי חלופי בתוקף על מצע מוצק הדגירה.
    1. השתמש פיפטה פסטר חד פעמיות או פינצטה מעוקל בסדר להעברת העוברים מהפתרון מתילן כחול על גבי צלחת סיבי קוקוס מוכן לשימוש.
    2. מורחים עוברי ~ 5 מ מ זו מזו, עד 100 עוברי לכל צלחת 90 מ מ (איור 1B).
    3. לאטום את צלחת פטרי עם מצלמות-מיקרוסקופים.
    4. דגירה עוברי-28 מעלות צלזיוס במשך 2-3 שבועות, עד שהם פיתחו באופן מלא קשתיות הזהב (למשל, איור 1C).
      הערה: לאחסון לטווח ארוך (עד שנה), להעביר עוברי שלושה ימי פוסט אוסף פתרונות מתילן כחול צלחת מוצק-המצע ב-17 מעלות צלסיוס דגירה עוברי עד שהם מפתחים עיניים שחורות.

4. אינקובטור דגים גמבוזיים טורקיז

הערה: עוברי דגים גמבוזיים טורקיז יכול להיות בהצלחה בקעו ב תמיסה חומצית רקבובי14.

  1. באמצעות פינצטה מעוקל בסדר, העברת בקפידה 50-100 פיתח עוברי לתוך התיבה הבקיעה מלא עם הפתרון חומצה רקבובי ב 4 º C. הפתרון חומצה רקבובי מורכב 1 g/L חומצה רקבובי מערכת המים. אוטוקלב וחנות ב 4 ° C עד 10 שבועות. ודא כי כל העוברים שקועים לחלוטין. הפתרון חומצה רקבובי חייב להיות רדוד, לא עמוקות יותר מ- 2 ס מ.
    הערה: טמפרטורה נמוכה של תמיסה חומצית רקבובי משפר את הבקיעה ומאפשר טבילה מלאה של העוברים בפתרון הבקיעה מסונכרן.
  2. הצב את תיבת הבקיעה לתוך החממה הבקיעה 28 ° C. מכסים את תיבת הבקיעה עם המכסה. לספק אוורור מספיק, לחבר הבקיעה תיבת על ידי צינורות עם אספקת אויר.
    הערה: לא מספיק לערבב במהלך הדגירה מתבטא שיעור גבוה של פריי לא תוכל למלא גז שלפוחית השתן ("בטן-המחוון" פנוטיפ, ראה הערה בסעיף 5.1)
  3. מהיום לאחר הבקיעה, כדי לשמור על איכות מים בתיבת הבקיעה, מוסיפים בלוק מערכת מים פעם ביום ביחס של 1:1, שמירה לעומק הסופי של 2 ס מ.
  4. העברת העוברים שטרם נבקעו! תאים בחזרה אל המצע מוצק, ניסיון הבקיעה כעבור שבוע.
    הערה: בעת הבקיעה, דגים גמבוזיים טורקיז מסוגלים בקלות כדי ספיגת, צורכים מזון חי. לצמיחה אופטימלית, להאכיל פריי פעמיים ביום עם עודף טרי המקווקו שרימפסים (Artemia salina). הסימן של satiation מלא הוא הבטן בצבע כתום של פריי אחרי 10-15 דקות של כל הנקה. לשאוב החוצה את עודף, השוקולדים המפורקת ארטמיה באמצעות פיפטה פסטר על בסיס יומי.

5. גידול דגים לנוער ומבוגרים

  1. חמישה ימים לאחר הבקיעה להעביר קטינים למערכת מחדש זרימת מים. באמצעות פיפטות פלסטיק חד פעמיות (או כפית פלסטיק), בזהירות העברה חמישה קטינים לכל 0.8 L טנק מצויד עם מסך פריי 400 מיקרומטר (איור 2).
    הערה: זה אפשרי כי חלק של דגים גמבוזיים לנוער לא מילאו את השלפוחית גז, וכתוצאה מכך טיפוסי "בטן-המחוון" הפנוטיפ, המאופיינת על ידי דגים לא להגיע ציפה נכונה, מכריח אותם לשחות ללא הרף, גרימת מומים חמורים ב דגים למבוגרים. דגים אלה לא ניתן להשתמש עבור מבחני הישרדות או להתרבות יעילה ויש צורך להיות צנזורה.
  2. להאכיל קטינים פעמיים ביום עם שרימפסים טרי המקווקו עודף עד 14 ימים לאחר הבקיעה. לשאוב החוצה פסולת מהחלק התחתון של טנק אחד מדי יום.
  3. ב 14 ימים של גיל, העברת הדגים לנוער 2.8 L מיכל מצויד עם מסך פריי 850 µm. מנקודה זו ואילך, תווית כל טנק עם דג קוד, המציין תאריך הצוהר, עומס מידע, מין דג או מספר זיהוי דגים (איור 3). עבור מבחני הישרדות, בית בנפרד כל דג במיכלים יחיד מנקודה זו ואילך.
  4. במשך 7 הימים הבאים, להאכיל קטינים פעמיים ביום עם ~ 2 מ"ל של שרימפסים לכל דג. בשלב זה דגים ניתן להשלים עם תולעים דם 1-3 (למקרה הזחלים תולעת דם גדולים מדי עבור הדגים, לחתוך אותם לחתיכות קטנות יותר עם סכין גילוח). כדי למנוע החמרה של איכות המים, לשאוב את השוקולדים מזון ופסולת נוספות פעמיים בשבוע.
  5. אחרי 3 שבועות מן הבקיעה, להסיר את המסך פריי מהחלק האחורי של הטנק ולהתחיל להאכיל כל דג פעמיים ביום ~ 2 מ"ל של שרימפסים ו- 0.5 מ של דם תולעת. בשלב זה, נוער אמורה להיעשות 1 ס מ בגודל הגוף, צריך להיות מסוגל בליעת תולעת בגודל מלא דם.
  6. רוב בגיל 4 שבועות, להאכיל כל דג פעמיים ביום עם ~ 2 מ"ל של שרימפסים, 1 מ"ל של דם תולעת. נקבות יכול להיות שותף מאילן צפיפות של עד 3 נקבות לכל טנק 2.8 L.
  7. בשלב זה להבטיח כי דגים להגיע התבגרות מינית מלאה. לבדוק נוכחות של סנפירים גדולים הגבי, אנאלי, סימטרית עם סימנים של הגיוון אצל זכרים, עגולה הבטן מלאה ביצים אצל נקבות.
    הערה: גידול דגים למבוגרים במיכלים נפרדים במחקרי עוקבה הישרדות עשוי להשפיע לרעה על דגים התנהגות ובריאות. עם זאת, קבוצת הדיור במחקרי עוקבה הישרדות מוסיף גורמים מבלבלים משמעותית עקב הקמת הדומיננטיות החברתית וטריטוריות זכר, שמוביל הירארכיות חברתיות קפדנית.

6. האכלה

הערה: דגים גמבוזיים מעבדה טורקיז יכול להיות מוזן בשילוב של התינוק שרימפסים (הדבריםArtemia salina ) עם תולעת דם (spp. ימשוש הזחלים). דגים גמבוזיים טורקיז פריי ניזונים באופן בלעדי התינוק שרימפסים. דגים לנוער ומבוגרים ניזונים פעמיים ביום ארטמיה והן תולעת דם (איור 2). באופן אידיאלי, דגים שאפשר לאכול מספר פעמים ביום, העולה על לקום 2 שצוינו בפרוטוקול זה.

  1. Culturing ארטמיה
    1. להוסיף 10 L מים אוסמוזה הפוכה (RO) ו- 350 גרם של מלח בים האדום האטצ'ר שרימפסים, לפזר על ידי לערבב עם צינור אוורור.
    2. להעשיר את התרבות עם 5 מ של חומצת שומן רוויה גבוהה (HUFA).
    3. הוסף 20 גרם של שרימפסים ציסטות בתוך תמיסת הבקיעה. בדוק כי ארטמיה ציסטות לא לצוף על פני המים, להבטיח חמצון נאות והשאלה של התרבות.
      הערה: aliquots היומי של ציסטות ארטמיה יבש שניתן לאחסן ב 4 º C.
    4. בשעות אחר הצהריים של היום הבא, לספק את התרבות עם aliquot נוספת של 5 מ של HUFA.
  2. קציר המקווקו ארטמיה
    הערה: לאחר ~ 36 h מתרבות המוצא, ארטמיה מוכן קציר (שלב II לחלל).
    1. לאסוף 5 L של התרבות במיכל באמצעות הברז על החלק התחתון של האטצ'ר ואפשר לשבת במשך 10 דקות.
    2. לאחר 10 דקות, להסיר קליפות שרימפסים (צבע חום) מהחלק העליון של המיכל 5 L ולסנן את המקווקו שרימפסים (צבע כתום) דרך רשת. שים לב כדי לא לכלול את המשקע נמצא בתחתית המיכל היא מכילה ביצים שאינם סס, ארטמיה מת.
    3. שטיפה בקעו שרימפסים עם רו מים לתוך מיכל 2 ל' ואפשר לשבת במשך 10 דקות.
    4. לאחר 10 דקות, לסנן ארטמיה שוב דרך רשת ולאסוף ב 2 ל' מים RO.
    5. חזור על השלבים הקודמים שלושה עד ארטמיה הפתרון אינו חושף שאינם סס ציסטות, ארטמיה פגזים.
    6. העברת שרימפסים מהגורם המכיל 2 ל' לתוך לסחוט בקבוקי האכלה.
      הערה: Culturing ארטמיה היא די עמיד ואמין. עם זאת, כדי למנוע מחסור ארטמיה במקרה של הבקיעה כושל, קטנים יותר (500 mL) hatchers גיבוי יכול לשמש.
  3. הגדרת את הגיבוי האצ'ר
    1. להמיס 17.5 גר' מלח בים האדום 500 מ"ל מים RO מאת לערבב.
    2. להעשיר תרבות עם 500 µL של HUFA.
    3. להוסיף 2 גר' ארטמיה ציסטות.
    4. לאחר 18-24 h, לספק את התרבות עוד פעם עם µL 500 של HUFA.
      הערה: ארטמיה מוכנים לקטיף לאחר ~ 24 h.
  4. הכנת תולעת דם
    1. מייד לפני האכלה, לסנן כמות מספקת של דם תולעת דרך מסננת באמצעות מים RO.
      הערה: תולעת דם שניתן לאחסן ב 4 מעלות צלזיוס למשך 7-10 ימים.
    2. שטוף דם תולעת עם כמות קטנה של מים RO לתוך מיכל פלסטיק.
    3. עם פסטר פלסטיק פיפטה (עצה צר הוסר), תופסים את התערובת תולעת דם האכלה.
      הערה: האכלת דגים גמבוזיים מעבדה מושבות עם מזון חי ממקורות בלתי מבוקרת מוסיף סיכון עבור מציג חיצוני טפילים וקהילות חיידקים פתוגניים פוטנציאלי. בעתיד, צריכה להיות מפותחת של מזון הדגים סטרילי אד הוק.

7. דגים גמבוזיים מעבדה זן Genotyping

הערה: כדי להבדיל בין זני דגים גמבוזיים טורקיז, כמו גם כדי לקבוע סקס בתוך כל זן, סמנים גנטיים מסוימים (microsatellite) ניתן בשימוש9 (טבלה 1).

  1. דגימה
    1. החזק את הדגים בצורה מאובטחת ברשת על ראש ספוג לח.
    2. דגימה 2-3 סולמות מהגוף דגים מן operculum לפין סימטרית באמצעות ספוגיות כותנה.
    3. לבחור סולמות מהמקלון ולהעביר 2-3 סולמות צינור 1 מ"ל המכיל פתרון NaOH (200 µL 0.5 מול/ליטר NaOH, 1% β-Mercaptoethanol ו- 0.5% פוליוויניל pyrrolidone).
    4. לסובב את המבחנות 15 s כדי לוודא כי קשקשים שקועים לחלוטין תמיסת NaOH.
  2. בידוד דנ א גנומי
    1. דגירה המדגם במשך 20 דקות ב- 95 מעלות צלזיוס.
    2. מגניב-RT, לנטרל מדגם עם 1/10 נפח של 1 מ' טריס-HCl, pH 8.0.
    3. Centrifuge המדגם במשך 5 דקות במהירות מלאה.

8. מים פרמטרים

הערה: גידול של אורגניזמים אשר השימוש המיועד הוא phenotyping למבוגרים דורש תנאי גידול יציב מאוד לאורך כל אורך החיים של המין היעד. לכן, culturing אורגניזמים מים, כגון דגים גמבוזיים טורקיז, מחייבת שליטה קפדנית של המים פרמטרים. מחזור המים, עם 4-שלבים נוספים מים סינון, מבטיחה בסיס חזקים כדי להשיג שליטה על פרמטרים מים, מתן כל הטנקים באותם תנאים מים לאורך זמן. מומלץ לחדש את המים מערכת אוסמוזה הפוכה מים (RO), נוסף עם סודה לשתייה ומלח ימית מסחרית.

  1. ערכת מערכת מחזור מים: ראשית, שפכים הדגים טנקים זורם דרך מסנן חלקיקים מוצקים מתכת הלוכד את כל פסולת לא אכלו מזון של חלקיקים גדולים יותר. מסנני מתכת הם שוטפים שלוש פעמים בשבוע; שנית, לאחר סינון מכני הראשון, הוא המובעים sumps גדולה והמים נשאבים ואז אל biofilter, שבו חיידקים להמיר אמוניה חנקניות וחנקן; שלישית, מ- biofilter, המים נשאבים אל שרוולי סינון 25-מיקרומטר, אשר ללכוד חלקיקים בגודל עדינה יותר. לבסוף, מים זורם דרך מנורות אולטרה סגול (UV) זה לחטא מים מפני חיידקים ווירוסים. בעקבות אלה ארבע מדרגות, מים מסוננים מחזיר מיכלי דגים.
  2. כדי להקטין את הצמיחה מיקרואורגניזם בטנקים, למנוע הצטברות של חנקות, ולהפחית באופן כללי מליחות, 10-20% מכמות המים מערכת מושלך על בסיס יומי.
  3. לשמור על טמפרטורה קבועה מים ב 28 ° C, מים pH קבוע בטווח 7.0 ל 7.5.
  4. למרות דגים גמבוזיים לסבול מגוון רחב של מליחות, כדי להימנע oodinosis, לשמור על מוליכות בתוך טווח 650-710 המיקרו-סימנס. מחזור/כהה h 12 לשנה מבטיח פרודוקטיביות ובריאות המושבה.
    הערה: דגים גמבוזיים יכול לסבול את מוליכות מים עד 1500 מיקרו-סימנס.

Representative Results

דגים גמבוזיים טורקיז גידול נאות תוצאות חציון ההישרדות הנע בין 12-18 שבועות בנימה GRZ (למשל איור 4A). וריאציות של חציון ההישרדות תלויה דיאטה, האכלה תדירות ודיור בתנאי טמפרטורה. תוצאות המסכן גידול בפניות הישרדות הצגת גברה התמותה המוקדמת, טיפות חוזרים, פתאומית של הישרדות לאורך זמן, המאופיינת במספר נקודות פיתול (איור 4B).

Figure 1
איור 1: נציג העובריים התפתחותית עם סובסטרט הדגירה בהתאמה. (א) טרי שנאספו עוברי, מודגרות תמיסת מתילן כחול בחממה ב 28 º C. (B) העוברים מוכנים להעביר בינוני מוצק, לסנן גם סיבי נייר או קוקוס. (ג) העוברים מוכן לתכנון, הצגת אופייני קשתיות הזהב. סרגל קנה מידה שווה ל 1 מ מ. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: שלבי דגים גמבוזיים טורקיז לאחר הבקיעה פיתוח. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: דגים נציג תג זיהוי דגים משלב 3 ואילך. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4: עקומת הישרדות נציג עבור 70 דגים גמבוזיים זכר בצבע טורקיז. (א) עקומת הישרדות אופייני לכל הרים-מעבדה דגים גמבוזיים בצבע טורקיז. (B) השוואה של הישרדות עקומות המתקבל הדג גידל תחת תנאי גידול אופטימליים (שחור) ואת בעלי המסכן (אדום וכחול). קו מקווקו אופקי אדום מציין 50% הישרדות, עקומת הישרדות מצטלבים-חציון תוחלת החיים (מסומן בציר ה-x). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

מזהה פריימר לפנים פריימר הפוכה גודל הטווח (bp)
* NfuSU0007 GGCTAAGCCTTGCTGACAGA CAGGGAGCTGAAAACCTCAG 166 - 214
* NfuSU0010 CGCAGTCTGATCAAATCGTGT TGTTTGAAGGTTCACATTCATTATC 220 - 272
NfuSU0016 CATGGCTAAACCGTGATGAA GAAGGACGCCAGCTATGAAG 209 - 240
NfuSU0022 AACACAGCTCTCGTAAGGAGGTA TTCAGACTTGTCTTACTACCATGTTT 198 - 238
NfuSU0027 TCCAGCTGAATCGGTAATGA AAACTCGAGGGTGCAATCTG 164 - 226
NfuSU0049 CTGGACAAAGTGCCAATCAC CTCCCACAGTCCCAAAACAT 196 - 197
NfuSU0050 CCAGAATGAACAATACTCAGATCAA GCAGCTTAGTTTAATGATATCACAATG 252 - 295
NfuSU0060 CTAGCCACTCCCCTGGTTTA CCGTCACGATGTGCTGATAC 216 - 248
NfuFLI0030 CAGAAGCTAAAGGCCAGACG GGGAAACAATAGGGAACCAC 174 - 205
* NfuFLI0091 ACGCTGACTCTACCCAGTC CTGCCTGCTACTGACAATG 355 - 373
* - סקס נחישות סמנים

טבלה 1: תחל Genotyping לזיהוי מתח.

Discussion

אנו מתארים עבור המעבדה culturing של דגים גמבוזיים טורקיז, כולל אוסף העובר, דגירה, כמו גם דגים למבוגרים דיור, פרוטוקול, רבייה, האכלה. פרוטוקול שלנו במיוחד לאוכלוסייה מעבדות כי התנהלות המחקר התמקד דגים למבוגרים, בפרט ללימודי ניסיוני על הזדקנות ואת תוחלת החיים. דגים גמבוזיים טורקיז יכול יגודל על מתקן דג זברה רגיל; עם זאת, היבטים חשובים של גידול דגים גמבוזיים שונים של טיפול סטנדרטי דג זברה16. התאמות אלה כוללים מעבר מיגדרי מוקדם של דיאטה רק שרימפסים דיאטה עם תולעת דם עשירים בחלבון, וכן פירוט השלבים הדגירה העובר, המורכב שלב הדגירה נוזלי ויבש.

שלבים קריטיים בתוך הפרוטוקול כוללים משלוח העוברים בטווח טמפרטורה 8-30 ° C. במקרה של גידול, פוריות תלוי האכלה תדירות ואיכות המזון; לכן, מומלץ לפחות שני בפטריה ליום רבייה טנק לגדל עוברי תשואה (ראו סעיף 5.6.). במהלך העובר הלבנת, לא להרחיב העובר הדגירה בפתרון הלבנה. זה עלול לגרום נזק chorion ביצה, העובר מוגבר לתמותה. כאשר המקננת העוברים עם כחול מתילן, לא להאריך דגירה של עוברי מוכן לצוהר-יותר מ 2 שבועות כפי הכדאיות שלהם יקטן באופן משמעותי. הבקיעה דגים גמבוזיים טורקיז, טמפרטורה נמוכה של תמיסה חומצית רקבובי משפר הבקיעה, טבילה מלאה של העוברים בפתרון מאפשר הבקיעה מסונכרן. לא מספיק לערבב במהלך בתוצאות הדגירה שיעור גבוה של פריי לא תוכל למלא גז שלפוחית השתן ("בטן-המחוון" פנוטיפ, עיין בהערות בסעיף 5.1).

הגבלה של פרוטוקול לגידול כולל את המצע חול אשר מציבה אתגרים כדי מרכזי מערכות סינון, צריך להיות מוחלף על ידי שיטות אלטרנטיביות בעתיד. חלופות אפשריות יכולה להיות השימוש של דג זברה גידול טנקים. העובר הלבנת עלול לגרום שינויים משמעותיים פיזית-כימית ב chorion ביצה אשר עלולה לגרום chorion שינו פיסיולוגיה, הבקיעה הצלחה. חשיפה מתמדת של העוברים מתילן כחול עלול לגרום שינוי ארוך טווח בפיזיולוגיה דגים למבוגרים. גידול דגים למבוגרים במיכלים נפרדים במחקרי עוקבה הישרדות עלול להשפיע לרעה דגים התנהגות ובריאות. עם זאת, קבוצת הדיור במחקרי עוקבה הישרדות מוסיף גורמים מבלבלים משמעותית עקב הקמת הדומיננטיות החברתית וטריטוריות זכר, שמוביל הירארכיות חברתיות קפדנית. לכן, אנו שופטים כי הבידוד של דג זכר ללימודי הישרדות היא פשרה סבירה. האכלה מושבות דגים גמבוזיים מעבדה עם מזון חי ממקורות בלתי מבוקרת להוסיף סיכון עבור מציג חיצוני טפילים וקהילות חיידקים פתוגניים פוטנציאלי. בעתיד, צריכה להיות מפותחת של מזון הדגים סטרילי אד הוק.

שיפורים עתידיים פרוטוקול זה יתמקד דיאטה מבוקרת, שאינם חיים, אשר עדיין מוביל השלמת התבגרות מינית בתוך 3-4 שבועות. לסיכום, פרוטוקול שלנו מציע נגישות דגים גמבוזיים טורקיז מעבדה culturing קהילה מדעית רחבה.

Disclosures

כל המחברים מצהירים אין אינטרסים מתחרים לא-כספיים ופיננסיים.

Acknowledgments

אנו מודים אלסנדרו Cellerino, טיירון Genade, סחופת אן, סברינה שארפ, מיקי פאוול, סימון Keil, קים יומי, פטריק סמית, Mathar קאי, כל חברי המעבדה Valenzano במכון מקס פלאנק על הביולוגיה של הזדקנות לתרום היבטים שונים הנוכחי דגים גמבוזיים גידול בפרוטוקול לאורך השנים.

Materials

Name Company Catalog Number Comments
Probe calibration buffer solution pH=7.0 Roth A518.1 1L buffer solution pH=7.0 to calibrate water system pH-electrode
Probe calibration buffer solution pH=4.0 Roth P712.1 1L buffer solution pH=4.0 to calibrate water system pH-electrode
Conductivity standard VWR 83607.260 500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode
Easy Strips Test 6in1 JBL 2533900 Test strips for determination chlorine values of system water
Ammonia Test JBL 2536500 Test to determine ammonia content of system water
Red Sea Salt Red Sea 22 kg bucket
Sodium hydrogen carbonate VWR 27780.360
Humic acid Sigma- Aldrich 53680-50G
New HUFA Artemia enrichment ZM Systems UK 75g bottle
Methylene blue Roth AE64.1
Hydrogen peroxide solution Sigma- Aldrich 31642-1L 30% (w/w)
Coconut fiber Dragon ZCS010
Whatman paper GE healthcare 3030-690
Ethanol pure VWR 20821.467 100%
Silica sand local pet shop
Artemia Eggs Premium Grade Sanders
Bloodworm local distributor Poseidon Aquakultur Germany
dNTPs solution mix Biolabs N04472 10mM
Taq DNA polymerase Invitrogen 18038-042 5U/uL
PCR 10x Buffer Invitrogen 18038-042
MgCl2 Invitrogen 18038-042 50mM
NaOH Sigma- Aldrich S8045-500g 50mM
Tris-HCl, pH=8.0 solution Sigma- Aldrich T2694-1L 1M
HCl 37% Sigma- Aldrich H1758-500mL
Fish tanks Aquaneering volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids
Orbital shaker VWR 89032-100 model 5000
Microbiological incubator Thermo Scientific, Heratherm 50125882 model IMC18; for storage embryos in the liquid phase, set to t=27-28°C
Cooling Incubator Binder 9020-0209 model KT115; for storage embryos in the solid phase, set to t=27-28°C
Hatching incubator Thermo Scientific, Heratherm 51028114 model OGS180; for embryos hatching, set to t=27-28°C
Stereomicroscope Leica model M80
Breeding sand/hatching boxes Roth 1598.1 1000mL
Petri dish Sarstedt 82.1473 92x16mm
50 mL Conical tube Sarstedt 62.547.254
15 mL Conical tube Sarstedt 62.554.002
Disposable Plastic Pasteur pipette Roth EA71.1 2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter
Serological pipette Sarstedt 86.1689.001 50mL
Syringe Henke Sass Wolf 4100-000V0 10mL
Metal strainer fineness <1mm; for embryos collection
Tweezers Dumont 0508-5/45-PO type5/45; for embryos transfer
25 L Brine shrimp hatcher Aquaneering ZHBS25 main hatcher
500 mL Brine shrimp hatcher JBL 6106100 model Artemio 1; backup hatcher
Narrow-mesh fish nets JBL
Sand beaker VWR BURK7102-5000 5000mL
Brine shrimp separation beaker VWR BURK7102-2000 2000mL
Plastic zipper bag Roth P279.2 for dead fish storage
Pipetboy Integra 155000 model Pipetboy acu2
Parafilm P-Lab P701605
Air tubing www.zajac.de AQ380 4-6 mm diameter
1 L Glass bottle VWR 215-1595
2 L Glass bottle VWR 215-1596
500 mL Squeeze bottle Roth K665.1 for fish feeding with brine shrimp
120-μm brine shrimp strainer Florida Aqua Farms BB-PC2 for brine shrimp/bloodworm collection
Finish filter socks Aquaneering MFVB025C 25-μm
Central filtration fish housing system Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz

DOWNLOAD MATERIALS LIST

References

  1. Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. Non-canonical aging model systems and why we need them. EMBO J. 36, (8), 959-963 (2017).
  2. Harel, I., Brunet, A. The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane. Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).
  3. Smith, P., et al. Regulation of life span by the gut microbiota in the short-lived African turquoise killifish. Elife. 6, (2017).
  4. Cellerino, A., Valenzano, D. R., Reichard, M. From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology. Biol Rev Camb Philos Soc. 91, (2), 511-533 (2016).
  5. Kim, Y., Nam, H. G., Valenzano, D. R. The short-lived African turquoise killifish: an emerging experimental model for ageing. Dis Model Mech. 9, (2), 115-129 (2016).
  6. Blazek, R., et al. Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient. Evolution. 71, (2), 386-402 (2017).
  7. Terzibasi, E., et al. Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri. PLoS One. 3, (12), e3866 (2008).
  8. Kirschner, J., et al. Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research. Aging Cell. 11, (2), 252-261 (2012).
  9. Valenzano, D. R., et al. Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri. Genetics. 183, (4), 1385-1395 (2009).
  10. Reichwald, K., et al. Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish. Cell. 163, (6), 1527-1538 (2015).
  11. Valenzano, D. R., et al. The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan. Cell. 163, (6), 1539-1554 (2015).
  12. Harel, I., et al. A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate. Cell. 160, (5), 1013-1026 (2015).
  13. Valenzano, D. R., Sharp, S., Brunet, A. Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging. G3. 1, (7), Bethesda. 531-538 (2011).
  14. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nat Protoc. 11, (10), 2010-2028 (2016).
  15. Polacik, M., Blazek, R., Reichard, M. Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri. Nat Protoc. 11, (8), 1396-1413 (2016).
  16. Avdesh, A., et al. Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction. J Vis Exp. (69), e4196 (2012).
פרוטוקול עבור המעבדה דיור של טורקיז דגים גמבוזיים (<em>Nothobranchius furzeri</em>)
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).More

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter