Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Laboratuvar konut, turkuaz Killifish (Nothobranchius furzeri) için bir iletişim kuralı

doi: 10.3791/57073 Published: April 11, 2018

Summary

Laboratuvar muhafazasını turkuaz ev ve verimli bir şekilde standart Zebra balığı özellikleri için kullanılan aynı altyapı istihdam Merkezi su filtrasyon sistemi, bireysel balık binlerce yükseltmek killifish ölçeklendirilecektir. Burada verimli killifish bakım izin standart yordamların listesini ayrıntılı.

Abstract

Deneysel amaçlar için kullanılan modeli laboratuvar balık yetiştiriciliği uygulamaları geliştirme modeli sistemleri, Zebra balığı ve medaka gibi başvuru balık kurulması büyük ölçüde yararlanmıştır. Son yıllarda ortaya çıkan bir balık-turkuaz killifish (Nothobranchius furzeri) – alanları araştırma grupları Biyoloji yaşlanma ve ekoloji, giderek artan sayıda tarafından kabul edilmiştir. Esir bir yaşam süresi 4-8 ay ile bu tür shortest-lived omurgalılar esaret kaldırdı ve yaşlanma oranı ve yaşam beklentisi değişikliklere yol açabilir testinde – kısa bir süre – deneysel müdahaleler bilimsel topluluk sağlar. Embriyonik diapause tarafından karakterize bu tür benzersiz Biyoloji verilen patlayıcı cinsel olgunlaşma, işaretlenmiş morfolojik ve davranış cinsel dimorfizm - ve onların nispeten kısa yetişkin yaşam süresi - özel yetiştirme uygulamaları içinde acil vardır isteğe bağlı. Bu iletişim kuralı en iyi turkuaz killifish laboratuvar Bakımı, etkinleştirme bu tür güçlü laboratuvar hayvan modeli olarak benimsemeye bilimsel topluluk izin anahtar yetiştirme önlemleri kümesini raporlar.

Introduction

Hızlı yaşam döngüsü ve kısa yaşam süresi göz önüne alındığında, turkuaz killifish Biyoloji1,2,3' te bir umut verici yeni model organizma olarak hızla büyüyor. Bu tür benzersiz bir yaşam döngüsü embriyonik diapause, hızlı cinsel olgunlaşma ve bir genişletilmiş post-reproductive hayat sahne4,5oluşan bir teleost için karakterizedir. Son iş bu tür Biyoloji hem tutsak hem de vahşi6,7elucidating için katkıda bulunmuştur. Turkuaz killifish live mevsimlik taze su organları oluşturan Zimbabve ve Mozambik Afrika savana yağışlı sezon sırasında. Kuru sezonunda embriyo su diapause denilen bir stres dayanıklı hayat sahne sayesinde yokluğunda kuru çamur içinde hayatta kalmak.

Genetik haritalar bu tür için oluşturulan8,9edilmiş ve son zamanlarda onların genom sıralı ve monte10,11oldu. Birkaç doğuştan laboratuvar balık suşları geliştirdik ve transgenesis ve CRISPR/Cas9 yolu ile düzenleme genom elde edilebilir içinde bu tür, turkuaz killifish rekabetçi laboratuvar omurgalı model organizma teşvik fiili haline gelmiştir 12,13,14.

Her ne kadar bu tür15için yayımlanmış bir laboratuvar protokol, mevcut protokolünde biz özellikle yaşlanma ve hayatta kalma araştırmak Etüdleri amaçlayan deneysel laboratuvar kuralları kapsamlı bir listesi geliştirmek. Mevcut Protokolü araştırmacılar Zebra balığı ve medaka yetiştiriciliği ile zaten tanıdık turkuaz killifish çiftçiliği anahtar ayarlamalar en az sayıda benimseyerek usta olmak için sağlar. Aynı zamanda, araştırmacılar balık yetiştiriciliği gerekli araçları ile deneyiminiz olmadan gelişen bir turkuaz killifish koloni yükseltmek için bu iletişim kuralı sağlar.

Protocol

Balık bir su devridaim sistemi 28 ° C'de kaldırdı (bkz: su parametreleri), % 10-20 günlük su bertaraf ile. Üç farklı tank boyutu önerilir: 0, 8 L, 2.8 L ve 9,5 L. Her tank 2 mL/sn sürekli su akışı alır.

1. reaktifler hazırlık (malzeme dahil değildir)

Not: Afrika turkuaz killifish (Nothobranchius furzeri) bir kurulan laboratuvar stoktan sağlanabilir. Yıllık killifish kuruma dayanıklı embriyo posta ile gönderilebilir. Embriyo 8-30 ° C sıcaklık aralığında sevk etmek önemlidir.

  1. HÜMİK asit (kuluçka) çözüm sisteminde 1 g/L Hümik asit çözülerek su hazırlamak. Basınçlı kap ve stok ilâ 10 hafta için 4 ° C'de.
  2. HUFA Artemia zenginleştirme hazırlamak için tuzlu su karides hatcher tuzlu karides çözeltinin konsantrasyonu 500 µL/M, günlük HUFA zenginleştirme ekleyin.
  3. Metilen mavisi çözüm 100 µL/M Metilen mavisi hisse senedi çözüm daha önce autoclaved sistem suda çözülerek hazırlayın. Metilen mavisi ışığa duyarlı olduğu için çözüm karanlık şişelerde tutmak veya folyo ile kapatın. Mağazada RT.
  4. Hindistan cevizi lifi katı substrat embriyo kuluçka için hazır olun. Alternatif olarak, bir filtre kağıdı (bakınız Bölüm 1.5) kullanın.
    1. Hindistan cevizi fiber distile su ile presoak. Basınçlı kap ve 4 ° C ilâ 5 hafta boyunca dükkanda.
    2. Embriyo transferi günü, Petri kabına nemli Hindistan cevizi lifi ile hazırlayın.
    3. Hindistan cevizi fiber duman başlık altında ve kirlenme mantar ve bakteri azaltmak için bir alev yanında 90 mm çap Petri kabına doldurun.
    4. Hindistan cevizi lifi steril doku ile 1 cm yüksekliği için kompakt. Nem çoğu Hindistan cevizi fiber bir kağıt havlu kağıt fazla suyu absorbe izin plaka üstüne basarak kaldırın. Metal bir kaşık ateşte ve Hindistan cevizi lifi tüm yüzey üzerinde bastırın. Bu Hindistan cevizi lifi mantar/bakteriyel kontaminasyon engeller.
  5. Filtre kağıt embriyo kuluçka için sağlam bir substrat hazırlayın.
    1. Embriyo transferi günü, 90 mm Petri kabına uygun filtre kağıdı disklerin 3 kat yerleştirin. 5 mL nem tutmak için Hümik asit çözeltisi ekleyin.

2. üreme

  1. Turkuaz killifish zorlanma bakım için ıslahı
    Not: bu protokolü sonrası tarama ve verimlilik tepeler arasında 7-9 hafta ~ 4 haftalıkken cinsel olgunluğa ulaşılır. Verimlilik besleme frekans ve gıda kalitesi bağlı olduğuna dikkat edin önemlidir; Bu nedenle, tank doğurmak başına günde en az iki besleme embriyo verim (bakınız Bölüm 5.6) artırmak için önerilir
    1. 9,5 L üreme tank kurulum. Sistem su ile doldurun ve bir erkek ve iki kadın balık ekleyin.
    2. Erkek Afrika turkuaz killifish kadın taciz için yol açabilecek, çiftleşme sırasında egemenlik görüntüleme gibi bir erkek dişi Çiftleşme stresi azaltmak ve üreme çıkış artış daha biraz daha küçük vücut boyutu seçin. 5-hafta-yaşlı erkek 6/7-hafta-yaşlı kadın ile ayarlayın.
    3. Plastik konteyner (10 x 10 x 5 cm) son ~ 2-3 cm derinliğe ulaşan autoclaved kum ile doldurun ve kum kutu üreme tank ortasına yerleştirin.
    4. Killifish sürekli olarak doğurmak ve embriyo haftada embriyo kuluçka için hasat Turkuaz izin.
      Not: Kum substrate kullanımı Merkezi filtrasyon sistemleri için zorluklar teşkil etmektedir ve alternatif yöntemlerle gelecekte değiştirilmesi gerekir. Olası alternatifler tankları damızlık Zebra balığı kullanımı olabilir.
  2. Üremek için transgenesis
    Not: embriyo enjeksiyonlar için kullanmak için bir-cep-aşamada eşitlenmesi gerekir, ve bu döllenme hemen ardından toplanan gerektirir.
    1. Enjeksiyon ve transgenik satırlarının üretimi için kullanılacak bir hücre aşamalı embriyo hasat için bir erkek ve iki kadın balık (aynı aynı derecede 2.1.) üreme tankla ayarlayın.
    2. İki gün önce embriyo koleksiyonu, erkek bireysel bir tank yalıtmak ve erkek yetişkin kadın ile görsel temas içinde tutmak.
    3. Toplama günü, erkek ve bir kum kutusu üreme deposuna eklemek ve onları için 2 h spawn.

3. embriyo yetiştiriciliği

  1. Embriyo koleksiyonu
    Not: Embriyo koleksiyonu eleme ve embriyo kum kutusundan hasat tarafından gerçekleştirilir. Normal şartlar altında 200 embriyolar için 30'dan itibaren her kum kutusu içermelidir.
    1. Toplama günü, kum kutu üreme tankından kaldırın. Bir süzgeç (~0.9 mm baskı boyutu) kum kutusu boş ve sistem su ile durulayın. Bu kum ısıyla için toplamak için a büyük tank üzerinde yapılabilir.
    2. Kısmen süzgeç sistem suya daldırın ve yavaşça, ortasında gruplamak için embriyo icar girdap.
    3. Embriyo 10 mL Pasteur pipet ile toplamak.
    4. 90 mm ~ 40 mL sistem su kabında embriyo transfer edin.
    5. Embriyo Petri kabına bir ışık stereomicroscope altında incelemek ve rüptüre koryon ve hasarı belirtileri göstermek kaldırın.
    6. Doğrudan embriyo ağartmadevam edin.
      Not: Her zaman potansiyel çapraz-zorlanma embriyo contaminations önlemek için balık zorlanma başına bir süzgeç kullanın.
  2. Ağartma embriyo
    Not: Embriyo ağartma mikroorganizmaların kuluçka medya kirletici içindebalık tank mevcut engeller.
    1. Beyazlatma önce tek kullanımlık bir Pasteur pipet sistem su toplanan embriyo içeren Petri kabına kaldırmak için kullanın.
    2. İstenmeyen mantar ve bakteri büyüme engellemek için toplanan embriyo 50 mL taze hazırlanmış H2O2 (%1 autoclaved sistem su v/v) ekleyin.
    3. 50 mL solüsyon içinde 90 mm Petri yemeklerinde düşük bir hızda embriyo 5 min için salla.
    4. H2O2 çözüm tek kullanımlık Pasteur pipet ile kaldırın ve embriyo 5 min ile 50 mL Metilen mavisi çözüm için üç kez yıkayın. Metilen mavisi çözüm kaldırın.
    5. H2O2 (%1 autoclaved sistem su v/v) 50 mL embriyolar için ekleyin ve 5 min için çalkalanır.
    6. H2O2 çözüm kaldırmak ve 50 mL Metilen mavisi solüsyon ile 5 min için üç kez yıkayın.
    7. Embriyo 28 ° C'de zaman uyumlu embriyo geliştirme, 90 mm 40 mL Metilen mavisi çözeltisi kabında başına 100 embriyo maksimum yoğunluğu artırmak için kuluçkaya.
      Not: embriyo kuluçka beyazlatma çözümünde uzatmak değil. Bu yumurta koryon zarar ve embriyo ölümleri artırmak. Embriyo ağartma büyük fiziksel-kimyasal değişiklikler değiştirilmiş koryon fizyolojisi ve başarı kuluçkalık neden olabilir yumurta koryon neden olabilir.
  3. Embriyo kuluçka Metilen Mavili
    Not: Sıvı kuluçka Metilen mavisi çözümde parazit büyüme engeller ve ölü embriyo ve döllenmemiş yumurta olarak algılanmasını sağlar.
    1. Canlı sağlıklı embriyoların yaşama etkileyen mantar ve bakteri kontaminasyonu önlemek için Petri kabına (Metilen mavisi tarafından mavi lekeli) herhangi bir ölü embriyo kaldırma inkübe embriyo bakarak kontrol edin.
    2. Eski Metilen mavisi çözüm kaldırın ve taze çözüm ile değiştirin.
    3. Petri kabına 28 ° C İnkübatör (şekil 1A) döndürür. 7-10 gün içinde geliştirilen embriyolar görünür siyah gözleri göstermek emin olun. Bu embriyolar transfer Hindistan cevizi lif veya filtre kağıdı katı substrat orta (şekil 1B).
    4. Metilen mavisi gelişmemiş embriyo korumak, her gün izlemek ve siyah gözleri geliştirdik katı substrat ortamına aktarmak.
    5. Embriyo görünür siyah gözlerin kadar adımları 3.3.1-3.3.3 her gün tekrarlayın.
      Not: Embriyo sürekli maruz kalma Metilen mavisi yetişkin balık fizyolojisi uzun vadeli değişiklikler neden olabilir.
  4. Filtre kağıt embriyo transferi
    Not: Turkuaz killifish embriyoların doğal koşulları recapitulating bir kuru yüzey üzerinde gelişebilir. Ayrıca, Kuru embriyo kuluçka araştırmacılar ve onları aynı günde yumurtadan embriyo senkronize sağlar.
    1. Geliştirilen embriyolar görünür siyah gözleri 7-10 gün içinde olacak gibi önceden hazırlanmış filtre kağıdı plaka üzerine Metilen mavisi çözümden embriyo transfer etmek için bir tek kullanımlık Pasteur pipet veya ince kavisli cımbız kullanın.
    2. 90 mm plaka (şekil 1B) başına 100 embriyolar kadar Forseps ile embriyo ~ 5 mm apart yaymak.
    3. Petri kabına parafilm ile kapatın.
    4. 2-3 hafta, onlar tamamen altın süsen geliştirdik ve (şekil 1 c) tarama için hazır kadar embriyo 28 ° C'de kuluçkaya.
      Not: kuluçka hazır kapak embriyo canlılığı önemli ölçüde azaltılmış olacak gibi 2 hafta daha uzun süre uzatmak değil.
  5. Embriyo transferi için Hindistan cevizi lifi
    Not: Autoclaved, steril Hindistan cevizi fiber (veya organik torf yosun) katı substrat kuluçka için geçerli bir alternatif aracı olarak kullanılabilir.
    1. Metilen mavisi çözüm kullanıma hazır Hindistan cevizi lif levha üzerine embriyo transfer için bir tek kullanımlık Pasteur pipet veya ince kavisli cımbız kullanın.
    2. Embriyo ~ 5 mm ayrı, 90 mm plaka (şekil 1B) başına 100 embriyolar kadar yayıldı.
    3. Petri kabına parafilm ile kapatın.
    4. 2-3 hafta, onlar tam olarak (örneğin, şekil 1 c) altın süsen geliştirdik kadar embriyo 28 ° C'de kuluçkaya.
      Not: (en çok bir yıl) uzun süreli depolama için embriyo 3 gün sonrası koleksiyonu Metilen mavisi çözümlerinden 17 ° C'de bir katı substrat tabak transfer Onlar siyah gözleri geliştirmek kadar embriyo kuluçkaya.

4. turkuaz Killifish çıkım

Not: Turkuaz killifish embriyo başarıyla Hümik asit solüsyonu14' te yumurtadan.

  1. İnce kavisli cımbız kullanarak, transfer dikkatle 50-100 embriyo 4 ° C'de Hümik asit solüsyonu ile dolu tarama kutusu Gelişmiş HÜMİK asit solüsyonu sistem suda 1 g/L Hümik asit oluşur. Basınçlı kap ve stok ilâ 10 hafta için 4 ° C'de. Tüm embriyoların tamamen batırma vardır emin olun. HÜMİK asit solüsyonu sığ, 2 cm daha derin olması gerekir.
    Not: Tarama Hümik asit solüsyonu düşük sıcaklık artırır ve embriyoların çözüm Komple daldırma eşitlenmiş tarama sağlar.
  2. Tarama kutusunu 28 ° C kuluçka kuluçka yerleştirin. Damızlık kutu kapak ile örtmek. Yeterli havalandırma tedarik boru hava kaynağı ile tarafından tarama kutusu bağlayın.
    Not: Kuluçka sırasında yetersiz havalandırma sonuçları fry gaz mesane doldurmak mümkün değil yüksek oranda ("göbek-kaymak" fenotip, bölümünde 5.1 nota bakın)
  3. Tarama, ertesi gün kuluçka kutusunun yeterli su kalitesini korumak için autoclaved sistem su oranı 1:1, günde bir kez son 2 cm derinliğe tutmak ekleyin.
  4. Geri katı substrat kuluçkaya embriyo transfer ve bir hafta sonra yumurtadan girişimi.
    Not: Tarama, turkuaz killifish alımı için kolayca yeteneğine sahiptirler ve canlı gıda tüketmek. Optimal büyüme için günde iki kez fry aşırı taze taranmış tuzlu karides (Artemia salina) ile beslenir. Tam doyma Fry turuncu renkli abdomens 10-15 dk sonra her beslenme işaretidir. Pasteur pipet günlük olarak kullanarak aşırı, yenmeyen ve ayrıştırılmış tuzlu karides dışarı sifon.

5. çocuk ve yetişkin balık yetiştirme

  1. Beş gün sonrası kuluçkalık, gençlere su yeniden dolaşım sistemi için hareket. Tek kullanımlık plastik Pipetler (ya da plastik kaşık), dikkatli bir şekilde kullanarak transfer beş gençlere başına 0, 8 L tank 400 µm fry ekran (Şekil 2) ile donatılmıştır.
    Not: Bu Juvenil killifish bir kısmını şiddetli malformasyonlar neden değil doğru yüzdürme ulaşan, onları sürekli yüzmek zorunda balık tarafından karakterize bir tipik "göbek-kaymak" fenotip, sonuçlanan gaz mesane dolu değil ki mümkündür yetişkin balık. Bu balıklar hayatta kalma deneyleri için veya verimli ıslah için kullanılamaz ve sansür gerekiyor.
  2. Gençlere günde iki kez fazla taze taranmış tuzlu su karidesli 14 gün öncesine kadar sonrası kuluçkalık besleme. Enkaz her tank altından dışarı günlük sifon.
  3. Yaş 14 gün transferi çocuksu balık 2.8 L tank için bir 850 µm fry ekran formatına sahip. Bu noktadan itibaren her tank balık kimlikli, kapağı Tarih, zorlanma bilgi, Balık cinsiyet ve balık kimlik numarası (şekil 3) gösteren etiket. Hayatta kalma deneyleri için tek tek her balık, bu noktadan itibaren tek tanklarında ev.
  4. Aşağıdaki 7 gün için günde iki kez gençlere ~ 2 mL tuzlu karides balık başına ile beslenir. Bu aşamada balık 1-3 canlı kan solucanlar ile takıma girebilir (kan solucan larva balık için çok büyük olduğu durumlarda bir tıraş bıçağı ile daha küçük parçalara doğrayın). Su kalite bozulmasını önlemek için yenmeyen gıda ve haftada iki kez ek atık dışarı sifon.
  5. 3 hafta sonra tarama sonra fry ekran tank arkasından kaldırmak ve ~ 2 mL tuzlu karides ve 0.5 mL kan solucan günde iki kez her Balık beslemek başlamak. Bu aşamada, gençlere 1 cm vücut büyüklüğüne ulaşmış olmanız gerekir ve tam boyutlu kan solucan sindirerek yeteneğine sahip olmalıdır.
  6. 4 haftalıkken ~ 2 mL tuzlu karides ve 1 mL kan solucan günde iki kez her balık yemi. Kadın bir yoğunluğu 2.8 L tank başına 3 kadın, ortak barındırılıyor olabilir.
  7. Bu aşamada balık tam cinsel olgunlaşma ulaşmak emin olun. Renklendirme erkeklerde belirtileri ile büyük dorsal, anal ve caudal fins varlığı için kontrol ve abdomens içinde dişi yumurta dolu yuvarlak.
    Not: hayatta kalma kohort çalışmaları için bireysel tankları yetişkin balık yetiştirme olumsuz balık davranış ve sağlık etkileyebilir. Ancak, grup konut hayatta kalma kohort çalışmaları için sıkı sosyal hiyerarşileri için önde gelen sosyal hakimiyet ve erkek bölgede kurulması nedeniyle önemli karıştırıcı faktörlerin ekler.

6. besleme

Not: Laboratuvar turkuaz killifish-ebilmek var olmak fed bebek brine karides (Artemia salina nauplii) ve kan solucan (Chironomus spp. larva) birleşimidir. Turkuaz killifish fry sadece bebek brine karides beslenir. Çocuk ve yetişkin balık günde iki kez beslenen tuzlu karides ve kan solucan (Şekil 2). İdeal olarak, balık-ebilmek var olmak fed günde birden çok kez, 2 feedings aşan bu protokol için gösterilir.

  1. Tuzlu su karides kültür
    1. 10 L Ters Ozmos (RO) su ve 350 g Kızıldeniz tuz tuzlu karides hatcher ekleyip bir havalandırma tüpü ile havalandırma tarafından çözülür.
    2. Kültür çok doymamış yağ asidi (HUFA) 5 mL ile zenginleştirmek.
    3. Tuzlu su karides kistler 20 g tarama çözüm ekleyin. Tuzlu su karides kistler suyun üzerinde yüzer yapmak ve uygun oksijen ve kan dolaşımı kültür sağlamak bakarak kontrol edin.
      Not: Kuru tuzlu karides kistlerin günlük aliquots 4 ° C'de saklanabilir
    4. Öğleden sonra ertesi gün, kültürü ile 5 mL HUFA de başka bir aliquot kaynağı.
  2. Taranmış tuzlu karides hasat
    Not: başlangıç ile Kültür ~ 36 h sonra tuzlu su karides (biçim II faz) hasat için hazırsınız demektir.
    1. Hatcher altındaki musluk kullanarak bir kap içinde kültürünün 5 L toplamak ve 10 dakika oturup bekleyin.
    2. 10 dk sonra tuzlu su karides kabuğu (kahverengi renk) 5 L konteyner en baştan çıkarmak ve bir ağ üzerinden taranmış tuzlu karides (turuncu renk) filtre. Sigara yumurtadan yumurta ve ölü tuzlu karides içerdiğinden konteyner alt kısmında bulunan tortu dışlamak için dikkat edin.
    3. 2 lt konteyner içine taranmış tuzlu karides RO su ile durulama ve 10 dakika oturup bekleyin.
    4. 10 dakika sonra tekrar bir kafes ile tuzlu su karides filtre ve 2 L RO su toplamak.
    5. Tuzlu su karides çözüm sigara yumurtadan kistler ve tuzlu su karides kabukları boşalana kadar önceki üç adımı yineleyin.
    6. Tuzlu su karides 2 L kapsayıcıdan beslenme için sıkmak şişe içine aktarın.
      Not: tuzlu karides kültürü oldukça sağlam ve güvenilir. Ancak, tuzlu su karides başarısız çıkım durumunda sıkıntısı önlemek için daha küçük (500 mL) yedek tekneleri kullanılabilir.
  3. Yedek hatcher kurma
    1. Kırmızı deniz tuzu RO su 500 ml 17,5 g Havalandırma tarafından çözülür.
    2. Kültür HUFA 500 µL ile zenginleştirmek.
    3. Tuzlu su karides kistlerin 2 g ekleyin.
    4. 18-24 saat sonra bir kez daha HUFA 500 µL ile Kültür kaynağı.
      Not: tuzlu karides ~ 24 h sonra hasat hazırdır.
  4. Canlı kan solucan hazırlanması
    1. Hemen besleme önce uygun bir miktar kan solucanın RO su kullanarak bir süzgeç aracılığıyla filtre.
      Not: Canlı kan solucan 4 ° C de 7-10 gün boyunca saklanır.
    2. Plastik bir kaba RO su küçük bir miktar kan solucanı durulayın.
    3. Bir plastik Pasteur ile pipet (dar uç) kaldırıldı, beslenme için kan solucan karışımı hallet.
      Not: Laboratuvar killifish kolonileri canlı gıda ile un kontrollü kaynaklardan besleme dış contaminations için bir risk parazitler ve potansiyel patojenik mikrobiyal topluluklar ekler. Gelecekte, bir geçici steril balık besleme geliştirilmelidir.

7. killifish laboratuvar zorlanma Genotipleme

Not: kullanılan9 (Tablo 1) belirli genetik (microsatellite) işaretleri de seks her zorlanma içinde belirlemek için turkuaz killifish suşları arasında ayırt etmek için olabilir.

  1. Örnekleme
    1. Balık içinde ıslak sünger üst kısmında bir ağ güvenli tutmak.
    2. Operculum balık vücuttan pamuk temizleme bezi kullanarak Kaudal fin için 2-3 ölçekten temizle.
    3. Pamuklu çubuk ölçekten almak ve 2-3 ölçekler NaOH solüsyon içeren 1 mL tüp içinde transfer (200 µL 0,5 mol/M NaOH, % 1 β-Mercaptoethanol ve % 0,5 polivinil pirolidon).
    4. PCR tüpleri 15 için spin s ölçekler tamamen NaOH çözümde batırma vardır emin olun.
  2. Genomik DNA izolasyon
    1. Örnek 95 ° C'de 20 dk için kuluçkaya
    2. Serin RT, Örnek 1 hacmi 1/10 ile nötralize M Tris-HCl, pH 8.0.
    3. Örnek için tam hızda 5 dk santrifüj kapasitesi.

8. su parametreleri

Not: Hayvancılık kullanım amacı olan yetişkin fenotipleme olduğunu organizmaların yaşam süresi boyunca son derece kararlı yetiştirme şartları hedef türler gerektirir. Bu nedenle, turkuaz killifish gibi su organizmalar kültür su parametreleri sıkı denetim gerektirir. Ek 4-adımlar ile su devridaim filtrasyon su, bütün tankları ile aynı su şartları zamanla sağlayan su parametreleri üzerinde kontrol ulaşmak için sağlam bir temel sağlar. Bu sistem su ticari deniz tuz ve sodyum bikarbonat ile eklendi Ters Ozmos (RO) sudan reconstitute için tavsiye edilir.

  1. Su sirkülasyon sistem düzeni: ilk olarak, atık-balık sudan tüm un yenmiş gıda artıkları ve daha büyük parçacıkları yakalar katı parçacıklar metal filtre akar tankları. Metal Filtreler haftada üç kez durulanır; İkinci olarak, ilk mekanik filtrasyon su büyük karterleri iletti ve sonra nerede bakteri nitrites ve nitrat amonyak dönüştürmek bir biyolojik pompalanır; Üçüncü olarak, biyolojik daha hassas boyut parçacıklar tuzak 25 µm filtre kollu için su pompalanır. Son olarak, su bakteri ve virüsler sterilize ultraviyole (UV) lambaları ile su akar. Aşağıdaki dört adımları, balık tank için filtrelenmiş su verir.
  2. Mikroorganizma büyüme Tanklardaki azaltmak, nitrat birikimi önlemek ve azaltmak için genel olarak tuzluluk, 10-%20-in sistem su üstünde a günlük temel atıldı.
  3. Su sıcaklığı sabit 28 ° c, su pH sabit 7.0-7,5 Aralık içinde korumak.
  4. Oodinosis, önlemek için çeşitli tuzluluk Killifish tahammül rağmen iletkenlik aralığı 650-710 mikro-Siemens içinde korumak. Bir yıl süren 12 h ışık/karanlık döngü koloni sağlık ve verimlilik sağlar.
    Not: Killifish su iletkenliği 1500 mikro-Siemens kadar dayanabilir.

Representative Results

Medyan sağkalım GRZ zorlanma (örneğin şekil 4A) haftada 12-18 arasında değişen turkuaz killifish uygun hayvancılık sonuç. Medyan sağkalım varyasyonları frekans beslenme ve sıcaklık koşullarında konut rejime bağlıdır. Zavallı yetiştiriciliği hayatta kalma eğriler sunmak sonuçlarında erken mortalite ve birkaç dönüm noktaları (şekil 4B) tarafından karakterize yaşam boyunca zaman, tekrarlayan, ani damla arttı.

Figure 1
Şekil 1: temsilcisi embriyonik gelişim dönemleri ile ilgili kuluçka substrat. (A) taze embriyolar, metilen mavisi çözüm kuluçka 28 ° C'de inkübe toplanan (B) embriyo katı ortamına aktarılması hazır ya kağıt veya Hindistan cevizi lif filtre. (C) embriyo yumurtadan için tipik altın süsen görüntüleme hazır. Ölçek çubuğu 1 mm. için eşit olan Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2: turkuaz killifish sonrası gelişim çıkım dönemlerinde. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: temsilcisi balık ID etiket 3üncü itibaren balık için. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4: 70 erkek turkuaz killifish için temsilcisi sağkalım eğrisi. (A) turkuaz killifish laboratuvar kaldırdı için tipik bir hayatta kalma eğrisi. Hayatta kalma eğrileri karşılaştırılması (B) elde edilen balık en uygun yetiştirme koşullarında (siyah) kaldırdı ve zavallı yetiştiriciliği (kırmızı ve mavi). Kesikli kırmızı yatay çizgi % 50 hayatta kalma, ortalama yaşam süresi (x ekseni üzerinde belirtilir), kesişen yaşam eğrisi gösterir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

KİMLİĞİ İleri astar Ters astar Boyut aralığı (bp)
* NfuSU0007 GGCTAAGCCTTGCTGACAGA CAGGGAGCTGAAAACCTCAG 166 - 214
* NfuSU0010 CGCAGTCTGATCAAATCGTGT TGTTTGAAGGTTCACATTCATTATC 220 - 272
NfuSU0016 CATGGCTAAACCGTGATGAA GAAGGACGCCAGCTATGAAG 209 - 240
NfuSU0022 AACACAGCTCTCGTAAGGAGGTA TTCAGACTTGTCTTACTACCATGTTT 198 - 238
NfuSU0027 TCCAGCTGAATCGGTAATGA AAACTCGAGGGTGCAATCTG 164 - 226
NfuSU0049 CTGGACAAAGTGCCAATCAC CTCCCACAGTCCCAAAACAT 196 - 197
NfuSU0050 CCAGAATGAACAATACTCAGATCAA GCAGCTTAGTTTAATGATATCACAATG 252 - 295
NfuSU0060 CTAGCCACTCCCCTGGTTTA CCGTCACGATGTGCTGATAC 216 - 248
NfuFLI0030 CAGAAGCTAAAGGCCAGACG GGGAAACAATAGGGAACCAC 174 - 205
* NfuFLI0091 ACGCTGACTCTACCCAGTC CTGCCTGCTACTGACAATG 355 - 373
* - belirlenmesi işaretleri seks

Tablo 1: Genotipleme astar zorlanma tanımlama için.

Discussion

Biz laboratuvar embriyo koleksiyonu, kuluçka gibi yetişkin balık konut, dahil olmak üzere turkuaz killifish kültür için bir protokol tarif doğurmak ve besleme. Bizim iletişim kuralı özellikle yetişkin balık, özellikle deneysel araştırmalar yaşlanma ve yaşam süresi üzerinde duruldu araştırma laboratuvarları hedeflenmektedir. Turkuaz killifish bir çift Zebra balığı tesisi yükseltilebilir; Ancak, standart Zebra balığı bakımı16' dan killifish yetiştiriciliği önemli yönleri farklı. Bu ayarlamalar erken bir tuzlu su-karides sadece diyet bir diyet protein açısından zengin kan solucan gibi kuru ve sıvı kuluçka aşaması oluşan embriyo kuluçka belirli adımları ile takıma geçiş içerir.

İletişim kuralına kritik adımlar 8-30 ° C sıcaklık aralığında sevkiyat embriyo içerir. Yetiştirme durumunda, sıklık ve gıda kalitesi besleme verimlilik bağlıdır; Bu nedenle, embriyo verim (bakınız Bölüm 5.6) artırmak için tank doğurmak başına günde en az iki besleme önerilir. Embriyo beyazlatma sırasında embriyo kuluçka beyazlatma çözüm genişletmeniz değil. Bu yumurta koryon ve artan embriyo ölümleri hasara neden olabilir. Metilen mavisi ile embriyo kuluçka zaman kuluçka hazır kapak embriyo canlılığı önemli ölçüde azaltılmış olacak gibi 2 hafta daha uzun süre uzatmak değil. Turkuaz killifish kuluçkalık için Hümik asit solüsyonu düşük sıcaklık tarama artırır ve embriyoların çözüm Komple daldırma eşitlenmiş tarama sağlar. Fry gaz mesane doldurmak mümkün değil yüksek oranda kuluçka sonuçlarında sırasında yetersiz havalandırma ("göbek-kaymak" fenotip, bkz: Notlar bölümünde 5.1).

Sınırlama-in doğurmak için protokol hangi pozlar sorunlar için filtrasyon sistemleri Merkezi ve alternatif yöntemlerle gelecekte değiştirilmesi gerektiğini kum substrate kullanımını içerir. Olası alternatifler tankları damızlık Zebra balığı kullanımı olabilir. Embriyo ağartma büyük fiziksel-kimyasal değişiklikler değiştirilmiş koryon fizyolojisi ve başarı kuluçkalık neden olabilir yumurta koryon neden olabilir. Embriyo sürekli maruz kalma Metilen mavisi yetişkin balık fizyolojisi uzun vadeli değişiklikler neden olabilir. Hayatta kalma kohort çalışmaları için bireysel tankları yetişkin balık yetiştirme balık davranış ve sağlık olumsuz yönde etkileyebilir. Ancak, grup konut hayatta kalma kohort çalışmaları için sıkı sosyal hiyerarşileri için önde gelen sosyal hakimiyet ve erkek bölgede kurulması nedeniyle önemli karıştırıcı faktörlerin ekler. Bu nedenle, yalıtım sağkalım Etütleri erkek balık makul bir uzlaşma olduğuna karar. Beslenme laboratuvar killifish kolonileri un kontrollü kaynaklardan gelen canlı gıda ile dış contaminations için bir risk parazitler ve potansiyel patojenik mikrobiyal topluluklar ekleyin. Gelecekte, bir geçici steril balık besleme geliştirilmelidir.

Bu iletişim kuralı için gelecekteki iyileştirmeler hala 3-4 hafta içinde cinsel olgunlaşma tamamlamak için yol bir kontrollü, Sigara-live diyet ele alınacak. Özet olarak, bizim iletişim kuralı turkuaz killifish laboratuvar için geniş bilimsel bir topluluk kültür erişilebilirlik sunmaktadır.

Disclosures

Tüm yazarlar hiçbir rakip mali ve mali olmayan ilgi bildirin.

Acknowledgments

Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar ve Valenzano laboratuvar tüm üyeleri Max Planck Enstitüsü, biyoloji yaşlanma için farklı yönleri için katkıda bulunduğunuz için teşekkür ediyoruz Geçerli killifish yetiştiriciliği protokolü ile yıl içinde.

Materials

Name Company Catalog Number Comments
Probe calibration buffer solution pH=7.0 Roth A518.1 1L buffer solution pH=7.0 to calibrate water system pH-electrode
Probe calibration buffer solution pH=4.0 Roth P712.1 1L buffer solution pH=4.0 to calibrate water system pH-electrode
Conductivity standard VWR 83607.260 500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode
Easy Strips Test 6in1 JBL 2533900 Test strips for determination chlorine values of system water
Ammonia Test JBL 2536500 Test to determine ammonia content of system water
Red Sea Salt Red Sea 22 kg bucket
Sodium hydrogen carbonate VWR 27780.360
Humic acid Sigma- Aldrich 53680-50G
New HUFA Artemia enrichment ZM Systems UK 75g bottle
Methylene blue Roth AE64.1
Hydrogen peroxide solution Sigma- Aldrich 31642-1L 30% (w/w)
Coconut fiber Dragon ZCS010
Whatman paper GE healthcare 3030-690
Ethanol pure VWR 20821.467 100%
Silica sand local pet shop
Artemia Eggs Premium Grade Sanders
Bloodworm local distributor Poseidon Aquakultur Germany
dNTPs solution mix Biolabs N04472 10mM
Taq DNA polymerase Invitrogen 18038-042 5U/uL
PCR 10x Buffer Invitrogen 18038-042
MgCl2 Invitrogen 18038-042 50mM
NaOH Sigma- Aldrich S8045-500g 50mM
Tris-HCl, pH=8.0 solution Sigma- Aldrich T2694-1L 1M
HCl 37% Sigma- Aldrich H1758-500mL
Fish tanks Aquaneering volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids
Orbital shaker VWR 89032-100 model 5000
Microbiological incubator Thermo Scientific, Heratherm 50125882 model IMC18; for storage embryos in the liquid phase, set to t=27-28°C
Cooling Incubator Binder 9020-0209 model KT115; for storage embryos in the solid phase, set to t=27-28°C
Hatching incubator Thermo Scientific, Heratherm 51028114 model OGS180; for embryos hatching, set to t=27-28°C
Stereomicroscope Leica model M80
Breeding sand/hatching boxes Roth 1598.1 1000mL
Petri dish Sarstedt 82.1473 92x16mm
50 mL Conical tube Sarstedt 62.547.254
15 mL Conical tube Sarstedt 62.554.002
Disposable Plastic Pasteur pipette Roth EA71.1 2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter
Serological pipette Sarstedt 86.1689.001 50mL
Syringe Henke Sass Wolf 4100-000V0 10mL
Metal strainer fineness <1mm; for embryos collection
Tweezers Dumont 0508-5/45-PO type5/45; for embryos transfer
25 L Brine shrimp hatcher Aquaneering ZHBS25 main hatcher
500 mL Brine shrimp hatcher JBL 6106100 model Artemio 1; backup hatcher
Narrow-mesh fish nets JBL
Sand beaker VWR BURK7102-5000 5000mL
Brine shrimp separation beaker VWR BURK7102-2000 2000mL
Plastic zipper bag Roth P279.2 for dead fish storage
Pipetboy Integra 155000 model Pipetboy acu2
Parafilm P-Lab P701605
Air tubing www.zajac.de AQ380 4-6 mm diameter
1 L Glass bottle VWR 215-1595
2 L Glass bottle VWR 215-1596
500 mL Squeeze bottle Roth K665.1 for fish feeding with brine shrimp
120-μm brine shrimp strainer Florida Aqua Farms BB-PC2 for brine shrimp/bloodworm collection
Finish filter socks Aquaneering MFVB025C 25-μm
Central filtration fish housing system Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz

DOWNLOAD MATERIALS LIST

References

  1. Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. Non-canonical aging model systems and why we need them. EMBO J. 36, (8), 959-963 (2017).
  2. Harel, I., Brunet, A. The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane. Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).
  3. Smith, P., et al. Regulation of life span by the gut microbiota in the short-lived African turquoise killifish. Elife. 6, (2017).
  4. Cellerino, A., Valenzano, D. R., Reichard, M. From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology. Biol Rev Camb Philos Soc. 91, (2), 511-533 (2016).
  5. Kim, Y., Nam, H. G., Valenzano, D. R. The short-lived African turquoise killifish: an emerging experimental model for ageing. Dis Model Mech. 9, (2), 115-129 (2016).
  6. Blazek, R., et al. Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient. Evolution. 71, (2), 386-402 (2017).
  7. Terzibasi, E., et al. Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri. PLoS One. 3, (12), e3866 (2008).
  8. Kirschner, J., et al. Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research. Aging Cell. 11, (2), 252-261 (2012).
  9. Valenzano, D. R., et al. Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri. Genetics. 183, (4), 1385-1395 (2009).
  10. Reichwald, K., et al. Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish. Cell. 163, (6), 1527-1538 (2015).
  11. Valenzano, D. R., et al. The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan. Cell. 163, (6), 1539-1554 (2015).
  12. Harel, I., et al. A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate. Cell. 160, (5), 1013-1026 (2015).
  13. Valenzano, D. R., Sharp, S., Brunet, A. Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging. G3. 1, (7), Bethesda. 531-538 (2011).
  14. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nat Protoc. 11, (10), 2010-2028 (2016).
  15. Polacik, M., Blazek, R., Reichard, M. Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri. Nat Protoc. 11, (8), 1396-1413 (2016).
  16. Avdesh, A., et al. Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction. J Vis Exp. (69), e4196 (2012).
Laboratuvar konut, turkuaz Killifish (<em>Nothobranchius furzeri</em>) için bir iletişim kuralı
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).More

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter