Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Disrupção do Gene altamente eficiente de células progenitoras hematopoiéticas murino e humano por CRISPR/Cas9

doi: 10.3791/57278 Published: April 10, 2018
* These authors contributed equally

Summary

Um protocolo para rápido CRISPR/Cas9-mediada disrupção do gene no mouse e células hematopoiéticas primárias humanas é descrito neste artigo. Ribonucleoproteínas Cas9-sgRNA são introduzidas através de eletroporação com sgRNAs gerados através da transcrição em vitro e Cas9 comercial. Alta eficiência de edição é obtida com tempo limitado e custo financeiro.

Abstract

Avanços no campo de células-tronco hematopoiéticas (linfócitos) tem sido auxiliados por métodos para geneticamente células progenitoras primário, bem como modelos animais. Ablação do gene completa em linfócitos necessária a geração de ratos do KO do qual linfócitos podem ser isolados e ablação de gene em linfócitos humanos primários não foi possível. Transdução viral poderia ser usada para abordagens do knock-down, mas estas sofriam de eficácia variável. Em geral, genética de manipulação do ser humano e células hematopoiéticas do mouse foi prejudicadas por baixa eficiência e tempo extenso e compromissos de custo. Recentemente, CRISPR/Cas9 expandiu-se dramaticamente a capacidade para projetar o DNA de células de mamíferos. No entanto, a aplicação de CRISPR/Cas9 de células hematopoiéticas tem sido desafiador, principalmente devido a sua eficiência de transfeccao baixa, a toxicidade de abordagens baseadas em plasmídeo e o tempo de retorno lento de protocolos baseados em vírus.

Um método rápido para executar CRISPR/Cas9-mediada gene edição no progenitor e tronco hematopoiético murino e humano, células com eficiências de nocaute de até 90% é fornecido neste artigo. Esta abordagem utiliza uma estratégia de entrega ribonucleoprotein (RNP) com um fluxo de trabalho simplificado de três dias. O uso da RNP Cas9-sgRNA permite uma abordagem de atropelamento e fuga, não introduzindo nenhum sequências de DNA exógenas no genoma de células editadas e reduzindo efeitos fora do alvo. O método baseado na RNP é rápido e simples: não exige clonagem de sgRNAs, preparação de vírus ou modificação química de sgRNA específico. Com este protocolo, os cientistas devem ser capazes de gerar com êxito nocautes de um gene de interesse em células hematopoiéticas primárias dentro de uma semana, incluindo paradas para síntese do oligonucleotide. Esta abordagem permitirá um grupo muito mais amplo de usuários adaptar este protocolo para suas necessidades.

Introduction

O advento da CRISPR/Cas9 simplificou radicalmente edição de gene em células de mamíferos. Início CRISPR/Cas9 protocolos utilizaram plasmídeo ou entrega baseada em vírus de Cas9 proteína e sgRNA1,2,3. Essas abordagens provou ser revolucionárias para o desenvolvimento de modelos de celulares e animais e foram aplicadas também com sucesso ao primário hematopoiéticas estaminais e progenitoras células (HSPCs)4,5. No entanto, esses métodos têm um número de desvantagens. Primeiro, eficiência de disrupção do gene permanece muitas vezes abaixo de 50%4,5. Enquanto isto é suficiente para a geração de clones de nocaute (KO) em linhagens celulares, a necessidade de cultura a curto prazo faz HSPCs não passível de tal estratégia. Em segundo lugar, a exigência de clonagem limita a quantidade de sgRNAs que podem ser testados em experimentos simples e gera grande, difícil de transfect construções. Em terceiro lugar, essas abordagens forçam cientistas para diminuir os tempos de resposta.

Para ultrapassar estas limitações, nosso grupo desenvolveu e publicou recentemente uma abordagem alternativa de CRISPR/Cas9 em HSPCs usando ribonucleoproteínas Cas9-sgRNA (RNPs)-com base de entrega6. Nesta estratégia, os componentes crus de CRISPR (Cas9 proteína e in vitro transcrito sgRNA) são pre-complexado e entregues directamente em células-alvo através de eletroporação (Figura 1). Como a meia-vida do complexo RNP Cas9-sgRNA é mais curta do que o tempo que o plasmídeo ou do ácido nucleico viral é transcrito, a taxa fora do alvo é mais baixo comparada ao início abordagens7. Além disso, a abordagem da RNP adiciona o benefício de eliminar qualquer fonte de DNA exógeno, que aleatoriamente pode integrar o genoma da célula alvo levando a transformação celular.

Este protocolo é baseado em um fluxo de trabalho simplificado para experimentos de interrupção de gene baseada na RNP, conforme representado na Figura 1. O primeiro passo é projetar e ordenar primers para cada sgRNA. Estas primeiras demão é ULTILIZADO para fazer modelos de DNA sgRNA que são usados para em vitro transcrição (IVT) para obter o sgRNAs. SgRNAs purificados depois são incubados com proteína de Cas9 adquirida anteriormente, para formar Cas9-sgRNA complexos de RNP. Finalmente, pre-complexado RNPs Cas9-sgRNA são electroporated em células. Após electroporation, eficiência de edição pode ser testado e in vitro/ experiênciasna vivo podem ser iniciadas, dependendo das necessidades. Abaixo uma descrição detalhada desta inovadora abordagem experimental pode ser encontrada.

Protocol

O protocolo segue as diretrizes do Comitê de ética humana do Baylor College of Medicine. Todos os procedimentos experimentais realizados em ratos são aprovados pelo Comitê de uso e Baylor College de medicina institucional Cuidado Animal.

1. sgRNA Fwd Design

  1. Navegue até http://www.crisprscan.org/?page=track8 para começar a projetar a sgRNAs de interesse.
  2. Clique no botão "Humano", dependendo do tipo de célula de interesse ou "Mouse".
  3. Inserir o gene de interesse na caixa de pesquisa UCSC e pressione ir.
  4. Zoom e mover-se para a região do gene (isto é. um exão específico) que é de interesse para o alvo.
    Nota: Para alcançar o rompimento eficiente do gene que é recomendado visando as primeiras exon(s) presente em todas as isoformas transcritas em seu tipo específico de célula.
  5. Certifique-se de que as sequências de destino potencial sgRNA estão listadas em um "CRISPRscan previsões sobre genes (CDS)" título.
  6. Localize e clique em uma sequência do alvo com uma pontuação relativamente alta e alguns fora-alvos (realçados em verde-claro). Copie a sequência completa exibida na seção "Sequência Oligo" e colá-lo em um documento de texto. Adicione "ATAGC" à extremidade 3' da sequência. Uma vez concluído, coloque a ordem para a sequência do longa-metragem.
    Nota: Para cada sequência alvo, CRISPRscan8 fornece uma primeira demão "integrado" sgRNA para a frente que inclui o promotor T7, a sequência de protospacer (alvo) e a sequência de sobreposição de andaime universal (ver figura 1A). Uma sequência longa-metragem é feita de nucleotídeos ou 56 ou 57, dependendo do comprimento do protospacer.

2. sgRNA síntese do modelo de DNA

  1. Dissolver e diluir o sgRNA Fwd e universal primer de Rev (ver tabela 1 para a sequência completa). Para obter uma concentração final de 10 µM, siga as instruções do fabricante sobre como diluir primers para 100 µM, em seguida, fazer um 01:10 diluição com água livre de nuclease.
  2. Para executar a sobreposição PCR (ver figura 1B), mistura a seguir na faixa da polimerase: cartilha de frente sgRNA 2 µ l (10 µM), primeira demão de andaime Universal do Rev 2 µ l (HPLC purificada) (10 µM), 10 µ l: alta fidelidade: DNA polimerase: mestre-mix (2x) e água livre de nuclease 6 µ l.
  3. Executar o PCR com o seguinte programa: 95 ° C por 3 min, 98 ° C por 5 s, 60 ° C durante 5 s, 72 ° C, durante 10 s, ir para 2 para 6 ciclos, 72 ° C por 1 min, 4 ° C para sempre.
  4. Purifica o produto do PCR usando colunas de purificação de DNA (ver tabela de materiais). Siga as instruções do fabricante e eluir com 11,5 µ l de tampão de eluição.
  5. Medir a concentração dos produtos do PCR em um espectrofotômetro. Branco do instrumento com o tampão de eluição.
    Nota: A concentração de DNA deve ser entre 50 ~ e ~ 120 ng / µ l.

3. transcrição in Vitro de sgRNA

  1. Misturar os componentes a seguir em cadeia da polimerase tira (reagentes são fornecidos no kit de síntese de RNA): 4 µ l de DNA eluted, 4 µ l de dNTPs, 1 µ l de reação Buffer de 10x e 1 µ l do mix de enzima T7 RNA polimerase.
  2. Incube as amostras a 37 ° C, durante pelo menos 4 h.
  3. Aplica o agente de limpeza de RNase para remover RNase de mãos enluvadas.
  4. Trazer cada amostra de RNA até um volume total de 50 µ l com água livre de nuclease (primeira etapa de purificação de RNA, seguindo as instruções do fabricante).
  5. Prosseguir com a purificação de RNA, seguindo as instruções do fabricante e eluir em 50 µ l de fornecido pelo kit de água livre de nuclease.
  6. Medir a concentração do sgRNA eluted em um espectrofotômetro. Em branco o instrumento com água livre de nuclease.
    Nota: O rendimento esperado após a purificação é 50-80 µ g de RNA (ou seja, a concentração de 1,0-1,5 µ g / µ l).
  7. Use o sgRNA purificado imediatamente ou guarde em alíquotas de 2-4 µ l a-80 ° C para o longo prazo.

4. cultura e isolamento HSPC

  1. Cultura e isolamento de HSPCs murino
    Nota: Masculinos e femininos Ubc-GFP ratos (JAX004353) e Rosa26-LSL-tdTomato (JAX007914), cruzados com Vav-iCre (JAX008610) 2-6 meses de idade foram utilizados para obter os resultados mostrados abaixo.
    1. Eutanásia em ratos anestesiados por deslocamento cervical.
      Nota: Duas pessoas treinadas independente devem verificar bem sucedida eutanásia observando a falta de respiração e batimento cardíaco pelo menos 5 min. Retire a pele dos animais.
    2. Dissecar as tíbias, fêmures e cristas ilíacas de ratos e remover todos os músculos e tecido conjuntivo ao redor dos ossos dissecados. Coloque os ossos intactos em um prato de cultura de tecidos no gelo com HBSS suplementado com 2% FBS (HBSS +). Mover para uma capa de fluxo laminar, logo que al os ossos foram limpos e transferidos para o prato de cultura de tecidos.
    3. Transferência limpada bones para argamassa estéril, contendo 2 mL gelada HBSS + por 3 ossos. Usando o pilão, esmaga ossos em fragmentos de osso, liberando a medula de dentro. Continue pestling até ossos parem de craqueamento sob o pilão.
    4. Recolha o sobrenadante do almofariz e filtro em um tubo cônico de 50 mL, usando um coador de célula de 40 µm. Lave os restantes fragmentos de osso com 5 mL gelada HBSS + e filtro no mesmo tubo cónico 50 mL usando o mesmo filtro de 40 µm.
    5. Lave as células duas vezes por completar o tubo com HBSS gelada + e centrifugação a 400 x g durante 7 min. descartar o sobrenadante.
    6. Após a segunda lavagem Ressuspender as células em 20 mL de PBS frio gelo. Contagem de células viáveis por exclusão trypan azul9.
    7. 1 x 108 células viáveis por 1 mL de incubar HBSS gelada + com anticorpo conjugado biotina de c-kit na diluição de 1: 100 para 45 min no gelo.
    8. Lave as células com HBSS gelada + por centrifugação a 400 x g, durante 7 min e descartar o sobrenadante.
    9. Incube as células com grânulos magnéticos antibiotina, seguindo as instruções do fabricante.
    10. Isole o c-kit positivas células usando colunas magnéticas ou classificadores magnético-ativado da pilha, seguindo as instruções do fabricante. Recolha o kit c células positivas em tubos cônico de 15 mL.
    11. Lavar as células duas vezes com PBS por completar o tubo cônico de 15 mL e centrifugação a 400 x g, durante 7 min. descartar o sobrenadante. Entre as duas lavagens Calcule o número total de células viáveis por trypan azul exclusão9.
    12. Resuspenda o c-kit + células em uma concentração de até 10 viablecells6 por 100 µ l de meio de cultura para murino HSPCs suplementado com 2% FBS, fator de células-tronco de rato de ng/mL 50 (SCF), 50 ng/mL do mouse Trombopoietina (TPO), 10 ng/mL mouse IL-3 e 10 ng/mL do mouse IL-6.
    13. Incube as células a 37 ° C, 5% de CO2 pelo menos 1 h, até um máximo de 24 h antes da eletroporação.
  2. Cultura e isolamento de HSPCs humano
    Nota: Essas etapas devem ser executadas em uma capa de fluxo laminar.
    1. Filtro da medula óssea/células através de um filtro de célula de 40 µm.
    2. Dilua as filtrado medula óssea/células de 1:2 com PBS suplementado com 1 mM de EDTA (PBS/EDTA).
    3. Dispense a 15 mL do meio de gradiente de densidade em um tubo cónico de 50 mL. Despeje delicadamente 30 mL de sangue medula óssea/cordão diluído na superfície médio gradiente de densidade. Se o volume da suspensão de células é maior que 30 mL preparar tubos múltiplos.
      Nota: Certifique-se de manter a interface entre o sangue e o meio de gradiente de densidade mais nítido possível.
    4. Gire os tubos a 750 x g por 30 min com nenhuma desaceleração.
    5. Recolha a camada de células mononucleares detectável na interface do meio e a transferência de um tubo cónico de 50ml limpo. Encha o tubo com PBS/EDTA e girar as células a 280 g durante 15 min. descartar o sobrenadante.
    6. Lave as células duas vezes em PBS/EDTA girando a 400 x g, durante 7 min e descartar o sobrenadante.
    7. Incube as células mononucleares com grânulos magnético anti-CD34, seguindo as instruções do fabricante.
    8. Isole células CD34 + usando colunas magnéticas ou classificadores magnético-ativado da pilha, seguindo as instruções do fabricante. Colete células CD34 + em tubos cônico de 15 mL.
    9. Lavagem coletadas células CD34 + duas vezes por completar o tubo com PBS e girando a 400 x g durante 7 min e descartar o sobrenadante. Entre as duas lavagens Calcule o número total de células viáveis por trypan azul exclusão9.
    10. Ressuspender as células em meio de cultura suplementado com 100 ng/mL humana CCAH, 100 ng/mL humana FLT3 ligante (FLT3L), 100 ng/mL TPO humana em uma concentração de células viáveis de5 de ~2.5 x 10 / ml. cultura isolado de células CD34 + a 37 ° C, 5% CO2 por 24 h a um prelado máximo 48 h a eletroporação.
      Nota: Antes da eletroporação verificar a pureza da população CD34 + enriquecida por citometria de fluxo.

5. eletroporação

Nota: O seguinte protocolo é otimizado para 10 dicas de eletroporação µ l. Todas as etapas devem ser executadas em uma capa de fluxo laminar.

  1. Contar as células por trypan azul exclusão9. Colete 2 x 105 células viáveis por replicar (por exemplo, coletar 6 x 105 células para 3 electroporations).
  2. Células lave duas vezes com PBS, girando a 300 x g durante 7 min e cuidadosamente Retire o sobrenadante.
  3. Em paralelo, prepare-se complexos Cas9-sgRNA RNP incubando em cadeia da polimerase para 20-30 min em RT 1,5 µ g Cas9 com 1 µ g de sgRNA total para cada replicar, exceto o único controle de Cas9.
    Nota: Cas9 proteína é fornecida na concentração de 10 µ g / µ l. Para garantir a exata pipetagem, diluir 01:10 a quantidade total de proteína Cas9 necessária com água livre de nuclease (por exemplo, para 10 electroporations tomar 1 µ l de proteína Cas9 e dilui-lo com 9 µ l de água livre de nuclease e incubar 1 µ l de Cas9 diluídos por replicar. Dependendo da concentração do sgRNA, o volume total de Cas9 e sgRNA deve ser compreendido entre 1,7 e 2 µ l por replicar. Se usando dois sgRNAs incubar 500 ng de cada sgRNA por replicação; se usando 3 sgRNAs incubar 330 ng de cada sgRNA por replicar e assim por diante.
  4. Calcule o volume total de ressuspensão T Buffer necessário multiplicando o número de total 10 µ l Replica necessários (por exemplo, 30 µ l para 3 repetições). Ressuspender as células peletizadas com o volume calculado de Buffer T. Certifique-se que a concentração final da suspensão celular é de 2 x 107 células/mL.
  5. Alíquota de 10 µ l de células/replicar ressuspensão em cada tubo PCR contendo o sgRNA pre-complexado/Cas9 RNP (por exemplo, para um triplicado alíquota 30 μL da suspensão de células para um tubo de PCR contendo pre-complexado Cas9-sgRNA).
  6. Para configurar o sistema electroporation Ligue o instrumento e adicionar 3 mL de tampão E em uma cubeta de eletroporação e deslize a cubeta no suporte da cubeta.
  7. Definir as condições electroporation desejada no dispositivo: HSPCs humanos (1600 V, 10 ms, 3 pulsos) ou HSPCs de rato (1700 V, 20 ms, 1 pulso).
    Nota: Se desejar, antes de executar experimentos em CD34 + HSPCs, sgRNA eficiência pode ser testada em linhas de células de leucemia mieloide aguda (LMA) (por exemplo, HL60) usando a mesma estratégia (uso sem antibióticos médio para linhas de célula AML) com as seguintes condições de eletroporação: Tampão de R V 1350, ms 35, 1 pulso.
  8. A eletroporação é realizada com uma pipeta electroporation especial, que tem uma garra que se alimenta a ponta da pipeta eletroporação. Segurar a pipeta electroporation, estender a garra, pegue o disco dentro a ponta da pipeta e então pressione firmemente a pipeta até segura a ponta.
  9. Pipete o exemplo acima e para baixo 10 vezes para misturar. Pegue 10 µ l, certificar-se de que não há nenhuma bolha e insira a ponta da pipeta diretamente no buffer eletrolítico na cubeta de eletroporação. Tente não tocar as paredes da cubeta. Pressione "start" na tela. Depois aparece a mensagem "completa", retire a pipeta e distribuir conteúdo para poço com meio de cultura novo HSPC.
  10. Repita para todas as amostras. Pontas da pipeta de mudança entre as amostras, se necessário.

Representative Results

O objetivo do presente protocolo é executar o nocaute do gene (KO) em rato e HSPCs humanas usando RNPs Cas9-sgRNA. O fluxo de trabalho é fácil e rápido e permite a realização de experiências em menos de uma semana de design experimental para avaliação da eficiência de KO.

Em comparação com abordagens baseadas em plasmídeo ou vírus, o sucesso do nosso protocolo baseia-se se a combinação de sgRNA RNPs e eletroporação. Esta estratégia de clonagem-livre diminui significativamente o tempo necessário para obter os componentes para transfect. Além disso, electroporation permite para transfeccao de até 95% das células, maximizando a entrega do RNPs. sgRNAs pode ser synthetized no laboratório através de vitro transcrição (IVT), enquanto a proteína purified Cas9 pode ser comprada de várias empresas ( Veja o protocolo). modelos de DNA sgRNA para IVT são obtidos realizando um curta do PCR usando o sgRNA cartilha Fwd (figura 1A, B) e o universal do andaime Rev primer (figura 1B - Veja o protocolo). O produto do PCR é usado como um modelo para o IVT (Figura 1). Complexos de RNP Cas9-sgRNA são gerados incubando por 15-30 minutos, o sgRNAs e o Cas9 (Figura 1). Finalmente, sgRNA RNPs são electroporated em células. HSPCs editados então podem ser usados para realizar experiências tanto in vitro e in vivo .

Disrupção do gene em pilhas do rato

Para demonstrar a eficácia da estratégia de eletroporação RNP Cas9-sgRNA, c-kit + HSPCs isoladas de ratos ubiquitously expressando GFP ou tdTomato ter sido electroporated com sgRNA contra GFP ou tdTomato. Entre os três sgRNA projetado contra GFP, GFP sg1 executada mais eficientemente, exibindo aproximadamente 70-75% perturbação da expressão de GFP, conforme determinado pela citometria de fluxo (Figura 2A, B). Para quantificar a frequência de interrupção de gene no nível do genoma, DNA genômico das células electroporated foi isolado e foi realizada T7 endonuclease I-baseada (T7EI) simulando. Como mostrado na Figura 2, T7EI ensaio detectado até à formação da indel de 60%. Observe que T7EI ensaios tendem a subestimar as frequências de puntuais. Geramos também sgRNA contra HSPCs tdTomato e electroporated, expressando a tdTomato do locus Rosa26. Como mostrado na Figura 2D, tdTomato sg1 eficientemente retirado a expressão de tdTomato.

Interrupção de gene em células humanas

Aqui, o rompimento eficiente obtido com uma abordagem única sgRNA segmentação CD45, um marcador de superfície de célula expressado em células hematopoiéticas, é mostrado. Três sgRNAs como alvo diferentes exões de CD45 foram concebidos (CD45 sg1, sg2 e SG-3). A eficiência do sgRNAs foi testada na linha de células HL60 AML (Figura 3A). Proteína KO foi avaliada por citometria de fluxo, 5 dias após a eletroporação. CD45 sg1 foi a mais eficiente (98% KO eficiência - Figura 3A) e foi usado para novas experiências. Figura 3B mostra CD45 KO no primário humano CD34 + células progenitoras usando CD45 sg1, avaliada por citometria de fluxo 5 dias depois de eletroporação. Enquanto expressão de CD34 não foi afetada, expressão de CD45 foi perdido em cerca de 80% das células. 200,000 primárias CD34 + células editadas foram retrô-orbitally transplantadas ratos NSG 6 horas após a eletroporação. Medula óssea e baço células foram colhidos 3 meses após o transplante. As células editadas (HLA-ABC positivo, negativo CD45, destacado em vermelho) são detectáveis apenas em amostras de sgRNA Tratado e não em Cas9 únicos controles (Figura 3).

Se desejado, dois sgRNAs como alvo nas proximidades de sequências pode ser usado para gerar exclusões. Essa abordagem permite uma estimativa rápida da edição eficiência com um PCR e muitas vezes produz maior eficiência de interrupção. Figura 3D mostra a geração eficiente de uma exclusão de bp 58 no exon 10 de DNMT3A. 200,000 editadas células CD34 + foram transplantadas em ratos NSG 6 horas após a eletroporação. A exclusão de bp 58 claramente foi detectado no sangue periférico de ratos NSG engrafted 5 meses após as injeções (Figura 3E) confirmando a edição de células CD34 + com recursos a longo prazo de enxertia.

Figure 1
Figura 1: A abordagem rápida e fácil para gerar sgRNA RNPs. A) representação do sgRNA Fwd da primeira demão. A sgRNA primeira demão Fwd é um oligonucleotide de DNA contendo o promotor T7, a sequência de protospacer e uma sequência de sobreposição com o andaime de sgRNA. No 3' final, destacada em vermelho, é a sequência de "ATAGC" que precisa ser adicionado à sequência de cartilha sgRNA Fwd obtida em CRISPRscan. B) representação esquemática de sobreposição PCR realizado para obter o modelo IVT. A sobreposição entre o sgRNA Fwd primer e o primer Universal andaime Rev permite a extensão e a amplificação por PCR. C) Cartoon descrevendo a reação IVT e o sgRNA RNP pre-complexantes. O produto do PCR é purificado e usado como um modelo para o IVT. IVT gera uma quantidade elevada de sgRNAs que pode ser usado em múltiplas repetições (ver protocolo). sgRNA RNPs são gerados incubando o sgRNA purificado a partir IVT e a proteína Cas9 adquirida anteriormente. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: rompimento eficiente do gene em células progenitoras hematopoiéticas de rato. A) um sgRNA segmentação GFP (GFP sg1) juntamente com a proteína Cas9 foi electroporated em murino de c-kit + HSPCs expressando GFP e analisadas por citometria de fluxo, 24 horas depois de eletroporação. B) quantidade de GFP sg1 diferente era complexada com 1 µ g de proteína de Cas9 e electroporated. Tão pouco quanto 200 ng de GFP sg1 eficientemente ablated expressão de GFP. C) T7EI ensaio realizado no DNA genômico de isolados de células utilizadas em A-B. PCR amplicons abrangendo o local de clivagem Cas9-sgRNA foi diluído 1:4 em 1 x Buffer 2 e hibridizada lentamente em um termociclador. Hibridizadas fragmentos foram então digeridos com 1,25 U de T7 endonuclease eu durante 10 minutos a 37 ° C. Digerido fragmentos separados por eletroforese em gel de poliacrilamida. Intensidades de banda foram analisadas usando o software ImageJ plotando intensidades de banda de cada raia. clivagem % foi calculada pela relação das intensidades das bandas clivadas para bandas uncleaved. D) c-kit + HSPCs isolados de camundongos expressando tdTomato foi electroporated com proteína Cas9 complexada com sgRNA contra tdTomato. Citometria de fluxo realizada 24 horas após electroporation revelou que aproximadamente 74% das células excluído tdTomato. R26 = Rosa26. * p < 0.05, * * p < 0,01, * * * p < 0,001. Esta figura foi adaptada da Gundry et al. 6 Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: rompimento eficiente do gene em células hematopoiéticas humanas. A) três sgRNAs direcionamento CD45 (CD45 sg1, sg2 e SG-3) foram projetados e testados na linha de células HL60 AML (Veja o protocolo para condições de eletroporação). Citometria de fluxo foi realizada 5 dias depois de eletroporação. CD45 sg1 foi selecionado como o mais eficiente entre os três sgRNAs (KO eficiência 98%). B) CD45 KO em humanos primários cord sangue CD34 + HSPCs usando CD45 sg1. CD45 perda pode ser detectada em cerca de 80% das células. Observe que a expressão de CD34 é inalterada após a edição. C) HSPCs humanos editado podem eficientemente ser incorporadas em camundongos NSG. Células nucleadas humanas exibem o HLA normal + / CD45 + fenótipo em somente Cas9 engrafted ratos, Considerando que em ratos incorporados com CD45-sg1 tratados células CD34 +, HLA ambos + / CD45 + e HLA + / CD45-populações são observadas indicando a enxertia de células humanas de CD45 KO. D) gel de agarose de 2%, mostrando uma exclusão de bp 58 gerada por 2 sgRNAs (abordagem de guia dupla) no exon 10 de DNMT3A em HSPCs humanas 3 diferentes do sangue do cordão (CB1, CB2 e CB3). PCR foi realizado 3 dias depois a eletroporação. E) gel de agarose 2% demonstrando a persistência da exclusão bp 58 5 meses após o transplante em camundongos NSG. Esta figura foi adaptada da et al . Gundry 6 Clique aqui para ver uma versão maior desta figura.

Oligonucleotide Sequência de Nota
Primer universal Rev andaime gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct Universal reversa cartilha para sobreposição PCR
hCD45 sgRNA 1 taatacgactcactataGGTGCTGGTGTTGGGCGCACgttttagagctagaaatagc sgRNA sequência de cartilha Fwd para sobreposição PCR
hCD45 sgRNA 2 taatacgactcactataGGGAGCAAGTGAGGATCCTCgttttagagctagaaatagc sgRNA sequência de cartilha Fwd para sobreposição PCR
hCD45 sgRNA 3 taatacgactcactataGGGATGCTTGTTCCCTTCAGgttttagagctagaaatagc sgRNA sequência de cartilha Fwd para sobreposição PCR
hDNMT3A Ex10 sg1 taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA sequência de cartilha Fwd para sobreposição PCR
hDNMT3A Ex10 sg2 taatacgactcactataGGGTGGCCAGCAGCCGCGCGgttttagagctagaaatagc sgRNA sequência de cartilha Fwd para sobreposição PCR
Rosa26 sgRNA taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA sequência de cartilha Fwd para sobreposição PCR
GFP sg1 taatacgactcactataGGGCGAGGAGCTGTTCACCGgttttagagctagaaatagc sgRNA sequência de cartilha Fwd para sobreposição PCR
tdTomato sg1 taatacgactcactataGGGGTACAGGCGCTCGGTGGgtttaagagctagaaatagc sgRNA sequência de cartilha Fwd para sobreposição PCR

Tabela 1: Completar sequências de primers de Fwd sgRNA usados em experimentos e primer Universal Rev.

Discussion

A abordagem da RNP descrita neste protocolo detalhado permite que o nocaute do gene eficiente no rato e humanas primárias células hematopoiéticas, bem como em linhas de células de suspensão. Apesar de muito alta eficiência de KO é obtida frequentemente, várias variáveis críticas precisam ser considerados. Primeiro, escolha adequada do exon é chave para garantir que a indel eficiente incorporação corresponde ao nocaute do gene. Dois fatores importantes relacionados à escolha do exon são conservação em posição isoformas e exon dentro transcrições. Padrões de expressão isoforma variável através de tipos de célula, então se gene KO através de tipos de célula é desejada, exões que são invariantes entre célula tipos devem ser alvejados. Isoform padrões podem ser verificados usando o q-PCR ou dados de sequenciação do ARN. Para posição de exon dentro transcrições, é o melhor alvo exões precoce como mutações frameshift no terminal ou penúltima exon pode escapar a decadência mediada por absurdo10, produzindo proteínas com romance ou funções desconhecidas, ao invés de verdadeiros valores nulos.

Determinando a indel frequência é um passo crítico para estimar a eficiência de KO e interpretar corretamente o resultado biológico do experimento. Ensaios de endonucleases (por exemplo, ensaio de agrimensor) têm a vantagem de ser relativamente rápido e fácil de executar. No entanto, eles tendem a ser imprecisas devido a sinais significativos de fundo e os resultados são frequentemente difíceis de reproduzir. Além disso, eles não fornecem informações sobre a qualidade do puntuais gerado (por exemplo, o comprimento de inserções e exclusões) no experimento. Sanger sequenciamento fornece uma alternativa valiosa para ensaios de endonuclease. Plataformas como maré11 (https://tide.nki.nl/) ajudam a decompor-se vestígios de sanger e produzir estimativas precisas da eficiência de interrupção alélica, proporcionando também as frequências de puntuais individuais. A principal desvantagem é uma absoluta dependência em rastreamentos de sequenciamento de Sanger de alta qualidade. Sequenciamento do elevado-throughput amplicon supera a maioria destas questões. Amplicon bibliotecas podem ser preparadas começando com entradas de DNA muito baixas e a alta cobertura garante resultados fiáveis. Para reduzir o custo do sequenciamento de amplicons, nós geralmente spike em bibliotecas amplicon em execuções de sequenciamento maiores (por exemplo-a sequenciação do ARN) usando apenas 1 a 1,5% do total diz. Finalmente, para confirmar o nocaute bem sucedido, nós fortemente recomendo avaliar os níveis de proteína por borrões ocidentais ou fluxo cytometry, quando possível.

Como descrito anteriormente, o método apresentado aqui é rápido e simples e representa uma nova ferramenta para estudar o gene nocaute no mouse e HSPCs humanas. Enquanto nosso protocolo fornece instruções para o nocaute do gene com um sistema de baseados em ponta electroporation, outros sistemas têm demonstrados para ser altamente eficaz12,13.

Duas limitações principais precisam ser reconhecido com respeito a abordagem da RNP. Primeiro, como descrito pelo nosso grupo, a viabilidade de HSPCs electroporated com in vitro transcrito sgRNAs podem ser significativamente comprometidos por eletroporação, especialmente quando as condições não são ideais,6. Se necessário, comercialmente sintetizados sgRNAs (ou seja, eliminando em vitro transcrição) pode superar esse problema. Estes estão se tornando mais baratos com o tempo e podem ser adquiridos de vários fornecedores. Neste cenário, em vitro transcrição poderia ser usada para gerar uma piscina de sgRNA de tela para a eficácia, e então o sgRNA(s) mais eficiente pode ser selecionado para a síntese. A segunda grande limitação da abordagem RNP é a incapacidade de controlar as células transfectadas com êxito, como em abordagens baseadas em viral. No entanto, a alta eficiência de KO e edição rápida obtidos com RNPs Cas9-sgRNA podem superar estas desvantagens em muitos cenários experimentais. Nós recomendamos usar o sequenciamento de amplicons do elevado-throughput para determinar exatamente a eficiência de interrupção em cada experimento. Se o nocaute do gene de interesse é esperado para conferir um fenótipo proliferativo (ou seja, reduzido ou aumentado a proliferação em comparação com o selvagem-tipo pilhas), determinar a frequência da indel em vários pontos de tempo permite avaliar se KO células passam por enriquecimento (ou seja, indel frequência aumenta ao longo do tempo) ou são outcompeted (i. e. indel frequência diminui ao longo do tempo).

Realizar experimentos in vivo ou in vitro para entender os efeitos biológicos de perda da função do gene requer os controles apropriados. Como mencionado anteriormente, em vitro transcrito sgRNAs podem ser tóxicos para as células, especialmente primária progenitoras células6. Além disso, DNA dupla quebras causadas por Cas9 proteína podem causar gene resposta antiproliferativa independente14. Portanto, muitas vezes usamos um número de controle sgRNAs em experiências CRISPR e recomendo um marcador de superfície de célula expressado no seu tipo de célula, bem como um segundo gene do alvo que não se expressa.

Cultura de curto prazo de HSPCs humanos na presença de citocinas aumenta o gene interrupção eficiência6 e é necessária para atingir alta eficiência KO. Encontramos 36-48 horas o período ideal de cultura antes de eletroporação6. Após electroporation, as células podem ser ainda mais culta tendo em mente que quanto mais a cultura, maior será o risco de perder a capacidade de multilineage enxertia. Portanto, normalmente realizamos transplantes de 6 horas após electroporation e nunca depois de 24 horas após a eletroporação.

CRISPR/Cas9 melhorou drasticamente a capacidade dos cientistas para editar com êxito o genoma de células de mamíferos. Viabilizando mais interrupções de gene em células progenitoras hematopoiéticas primário está previsto para aumentar rapidamente o conhecimento científico no campo da HSPCs e doenças hematológicas. Importante, o protocolo descrito aqui torna também possível gerar simultaneamente vários nocautes com alta eficiência, permitindo a modelagem das paisagens genéticas complexas, muitas vezes visto em doenças leucêmicas.

Embora os protocolos descritos neste documento concentram-se na interrupção de gene, podem ser facilmente adaptadas para gene knock-em experiências. Isso pode ser feito através da entrega de co de modelos single-stranded do oligonucleotide para reparação de homologia-dirigido6,13 (HDR) ou através da transdução de células post-eletroporação com vetores AAV6 contendo o homologia modelo12. A capacidade de reparar ou introduzir mutações específicas em HSPCs irá facilitar novas estratégias terapêuticas para a terapia gênica e o estudo expandido de mutações de motorista câncer na AML e outras doenças hematológicas. Enquanto HDR em HSPCs humanas tem sido bem sucedida6,12,13, rato HSPCs ter sido difícil de editar usando esta estratégia6. Otimização dos protocolos HDR em humanos e em particular na HSPCs de rato permitirá a edição mais específico e o desenvolvimento de ferramentas para rastrear as células editadas usando marcação endógena.

Finalmente, também prevê-se que a interrupção de alelos mutantes de ganho-de-função poderia representar uma abordagem terapêutica potencial para distúrbios hematopoiéticos congênitas e adquiridas. Neste cenário, aconselha-se uma abordagem livre de DNA a fim de evitar possíveis integrações que poderiam promover a transformação. Além disso, a abordagem de "bater e correr" reduz a possibilidade de efeitos indesejados fora do alvo. É necessário mais esforço para desenvolver sistemas específicos de entrega que abriria novos caminhos para o tratamento de doenças hematológicas malignas e não-malignas.

Disclosures

Não há conflito de interesses para divulgar

Acknowledgments

Este trabalho foi apoiado pela prevenção do câncer e Instituto de pesquisa de Texas (RP160283, RP140001 e R1201), a Gabrielle Angel Foundation para pesquisa do câncer, Fundação Edward P. Evans e o NIH (DK092883, CA183252, CA125123, P50CA126752, CA193235 e DK107413). M.C.G. é suportado pelo Baylor defende a investigação por cientistas de estudante. Citometria de fluxo foi parcialmente financiada pelo NIH (National Center para concessão de recursos de pesquisa S10RR024574, Instituto Nacional de alergia e AI036211 de doenças infecciosas e o National Cancer Institute P30CA125123) para a Baylor College of Medicine Citometria e célula núcleo de classificação.

Materials

Name Company Catalog Number Comments
Tissue culture plates according to cell numbers
1.5 ml Eppendorf microtubes Sigma Z606340-1000EA
50ml Falcon tubes Corning 352070
Nuclease Free Water - DEPC treated ThermoFisher Scientific AM9915G
KAPA HiFi HotStart ReadyMix (2X) KAPA Biosystems KK2600
MinElute PCR purification Kit Qiagen 28004
RNAse Zap RNAse Decontamination Solution ThermoFisher Scientific AM9780
RNA Clean and Concentrator-25 Zymo R1017
HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs E2040S
Alt-R S.p. Cas9 Nuclease 3NLS, 100 µg IDT 1074181
40 mm Cell Strainers VWR 352340
Dulbecco's Phosphate Buffered Saline (PBS) GenDEPOT CA008-050
Fetal Bovine Serum (FBS), Regular Corning 35010CV
AutoMACS Pro Separator or MACS manual Cell Separation columns Miltenyi
Neon Transfection System Device ThermoFisher Scientific
Neon Transfection System 10mL kit ThermoFisher Scientific MPK1025 For larger numbers of cells (see protocol) Neon Transfection System 100 mL kit (# MPK10025) can be used
Name Company Catalog Number Comments
UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific 15575020 For human experiments only
Lymphoprep Stem Cell Technologies 7851 For human experiments only
CD34 MicroBead Kit UltraPure human Miltenyi Biotec 130-100-453 For human experiments only
Stem Span SFEM II Stem Cell Technologies 9605 For human experiments only
Recombinant Human SCF Miltenyi Biotec 130-096-695 For human experiments only
Recombinant Human TPO Miltenyi Biotec 130-094-013 For human experiments only
Recombinant Human FLT3L Miltenyi Biotec 130-096-479 For human experiments only
Name Company Catalog Number Comments
Mouse dissection tools For mouse experiments only
Mortar and Pestle For mouse experiments only
Hank's Balanced Salt Solution (HBSS) Gibco 14170112 For mouse experiments only
Biotin-conjugated anti c-kit antibody eBioscience 13-1171-82 For mouse experiments only
Anti-Biotin MicroBeads Miltenyi Biotec 130-090-485 For mouse experiments only
X VIVO-15, with L-Glutamine, Genatmycin and Phenol Red Lonza 04-418Q For mouse experiments only
Mouse IL-6 Peprotech 216-16 For mouse experiments only
Mouse TPO Peprotech 315-14 For mouse experiments only
Mouse IL-3 Peprotech 213-13 For mouse experiments only
Mouse SCF Peprotech 250-03 For mouse experiments only

DOWNLOAD MATERIALS LIST

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, 816-821 (2012).
  2. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  3. Sternberg, S. H., Doudna, J. A. Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell. 58, 568-574 (2015).
  4. Heckl, D., et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 32, 941-946 (2014).
  5. Mandal, P. K., et al. Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell stem cell. 15, 643-652 (2014).
  6. Gundry, M. C., et al. Highly Efficient Genome Editing of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. Cell Rep. 17, 1453-1461 (2016).
  7. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012-1019 (2014).
  8. Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature methods. 12, 982-988 (2015).
  9. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Current protocols in immunology. 111, A3 B 1-3 (2015).
  10. Lykke-Andersen, S., Jensen, T. H. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol. 16, 665-677 (2015).
  11. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, e168 (2014).
  12. Dever, D. P., et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature. 539, 384-389 (2016).
  13. DeWitt, M. A., et al. Selection-free genome editing of the sickle mutation in human adult hematopoietic stem/progenitor cells. Sci Transl Med. 8, 360ra134 (2016).
  14. Aguirre, A. J., et al. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting. Cancer Discov. 6, 914-929 (2016).
Disrupção do Gene altamente eficiente de células progenitoras hematopoiéticas murino e humano por CRISPR/Cas9
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).More

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter