Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Высокоэффективные гена срыв мышиных и человека гемопоэтических предшественников клеток ТРИФОСФАТЫ/Cas9

doi: 10.3791/57278 Published: April 10, 2018
* These authors contributed equally

Summary

Протокол для быстро ТРИФОСФАТЫ/Cas9-опосредованной гена срывов в мышь и гемопоэтических клеток человека основных описанных в этой статье. Cas9-sgRNA ribonucleoproteins вводятся через электропорации с sgRNAs, порожденных через в vitro транскрипция и коммерческих Cas9. Высокая эффективность редактирования достигаются с ограниченного времени и финансовых затрат.

Abstract

Успехов в области гемопоэтических стволовых клеток (СКК) был опираясь на методы генетически инженер первичной прогениторных клеток, а также Животные модели. Полный геном абляции в СКК требует поколение мышей нокаут от которых СКК может быть изолированы, и Джин абляции в первичных человеческих СКК не удалось. Вирусная трансдукции могут быть использованы для нокдауна подходов, но они страдали от переменной эффективность. В общем, генетические манипуляции человека и мыши гемопоэтических клеток затрудняется низкой эффективности и обширные время и стоимость обязательств. Недавно ТРИФОСФАТЫ/Cas9 значительно расширил возможности инженер ДНК клеток млекопитающих. Однако применение ТРИФОСФАТЫ/Cas9 гемопоэтических клеток была сложной, главным образом из-за их низкой трансфекции эффективности, токсичность подходов на основе плазмид и медленного времени протоколов, основанных на вирус.

Быстрый метод для выполнения ТРИФОСФАТЫ/Cas9-опосредованной гена, редактирования в мышиных и человека гемопоэтических стволовых и прогениторных клеток с нокаут КПД до 90% предусмотрено в этой статье. Этот подход использует стратегию доставки рибонуклеопротеида (RNP) с хорошо налаженный процесс три дня. Использование Cas9-sgRNA RNP позволяет скоротечные подход, представляя последовательности не экзогенной ДНК в геноме отредактированных ячеек и уменьшая эффекты пробить. Метод, основанный на RNP быстро и просто: он не требует клонирование sgRNAs, вирус подготовки или конкретных sgRNA химическая модификация. Этот протокол ученые должны быть способны успешно генерировать нокауты гена интереса к первичной гемопоэтических клеток в течение недели, включая время простоя для синтеза олигонуклеотида. Этот подход позволит гораздо более широкой группы пользователей адаптировать этот протокол для удовлетворения их потребностей.

Introduction

С появлением ТРИФОСФАТЫ/Cas9 радикально упрощены, редактирование гена в mammalian клетках. Первые протоколы ТРИФОСФАТЫ/Cas9 использовали плазмиду или доставки на основе вирус Cas9 белка и sgRNA1,2,3. Эти подходы оказались революционной для разработки моделей сотовых и животных и также успешно применяется для первичной гемопоэтических стволовых и прогениторных клеток (HSPCs)4,5. Однако эти методы имеют ряд недостатков. Во-первых Джин нарушения эффективности часто остается ниже 50%4,5. Хотя это достаточно для генерации нокаут (KO) клоны в клеточных линий, необходимость в краткосрочных культуры делает HSPCs не поддаются такой стратегии. Во-вторых требование для клонирования ограничивает количество sgRNAs, которая может быть проверена в одном экспериментов и генерирует большие, трудно transfect конструкции. В-третьих эти подходы силу ученых медленный поворот раз.

Чтобы преодолеть эти ограничения, наша группа разработала и недавно опубликовал альтернативный подход ТРИФОСФАТЫ/Cas9 в HSPCs с помощью Cas9-sgRNA ribonucleoproteins (RNPs)-на основе доставки6. В этой стратегии, сырьевых компонентов ТРИФОСФАТЫ (Cas9 белков и в пробирке транскрипции sgRNA) являются pre-complexed и непосредственно доставлен в клетки-мишени через электропорации (рис. 1). Как период полураспада комплекс Cas9-sgRNA RNP короче времени что плазмида или вирусной нуклеиновой кислоты транскрибируется, -целевой показатель ниже по сравнению с ранних подходов7. Кроме того подход RNP добавляет в интересах устранения любого источника экзогенной ДНК, который случайно можно интегрировать в геном клетки целевой, ведущих к сотовой трансформации.

Этот протокол основан на хорошо налаженный процесс для экспериментов на основе RNP гена нарушения, как представлено на рисунке 1. Первым шагом проектирование и заказ Праймеры для каждого sgRNA. Эти грунты используются сделать шаблоны sgRNA ДНК, которые используются для в vitro транскрипция (IVT) для получения sgRNAs. Затем очищенный sgRNAs инкубируют с ранее приобретенные Cas9 белок, форма Cas9-sgRNA RNP комплексов. Наконец pre-complexed Cas9-sgRNA RNPs, electroporated в клетки. После электропорация, может быть проверена эффективность редактирования и в пробирке/ экспериментыв естественных условиях может быть запущен, в зависимости от потребностей. Можно найти ниже подробное описание Этот новаторский экспериментальный подход.

Protocol

Протокол соответствует руководящим принципам Комитета колледж Бейлор человеческой этики. Все экспериментальные процедуры выполняются на мышах утверждаются Baylor колледж медицины институциональных животных ухода и использования Комитетом.

1. sgRNA передний дизайн

  1. Перейдите к http://www.crisprscan.org/?page=track8 , чтобы начать разработку sgRNAs интерес.
  2. Нажмите на «Мышь» или кнопку «Человека» в зависимости от типа ячейки интереса.
  3. Введите в поле поиска UCSC гена интереса и нажмите кнопку go.
  4. Увеличение и перемещается к области гена (т.е. конкретных Эксон) это интерес к целевому объекту.
    Примечание: Для достижения эффективного гена нарушения, которые рекомендуется ориентации ранних exon(s) настоящее время в всех изоформ транскрибируется в вашей конкретной ячейки типа.
  5. Убедитесь, что потенциальные sgRNA последовательности перечислены под «CRISPRscan прогнозы на гены (CDS)» заголовок.
  6. Найдите и нажмите на последовательности целевых объектов с относительно высокий балл и несколько вне цели (выделено в ярко-зеленый). Скопируйте полную последовательность, отображается в разделе «Oligo последовательность» и вставьте его в текстовый документ. Добавьте «ATAGC» в 3' конец последовательности. После завершения оформления заказа на полнометражных последовательности.
    Примечание: Для каждой последовательности целевых объектов, CRISPRscan8 предоставляет «интегрированных» вперед sgRNA грунт, который включает T7 промоутер, protospacer (цель) последовательность и последовательность совпадения универсальная леска (см. рис. 1A). Полнометражный последовательность состоит из 56 или 57 нуклеотидов в зависимости от длины protospacer.

2. sgRNA синтеза ДНК шаблон

  1. Распустить и разбавленных sgRNA передний и универсальная грунтовка Rev (см. таблицу 1 для полной последовательности). Для того чтобы получить окончательный концентрации 10 мкм, следуйте инструкциям производителя о том, как ослабить грунтовки до 100 мкм, а затем сделать 1:10 разбавления водой свободной от нуклеиназы.
  2. Для выполнения перекрытия ПЦР (см. рис. 1B), смесь следующих в пробирках, ПЦР полосы: 2 мкл вперед sgRNA грунт (10 мкм), 2 мкл универсальный Rev эшафот грунт (ВЭЖХ очищенный) (10 мкм), 10 мкл высокой верности ДНК полимеразы главный микс (2 x) и 6 мкл нуклеиназы свободной воды.
  3. Запустите ПЦР с следующей программы: 95 ° C в течение 3 мин, 98 ° C за 5 сек, 60 ° C за 5 s, 72 ° C для 10 s, перейти к 2 для 6 циклов, 72 ° C в течение 1 мин., 4 ° C навсегда.
  4. Очищайте продукт PCR, с использованием ДНК очистки столбцов (см. таблицу материалы). Следуйте инструкциям производителя и элюировать с 11,5 мкл буфера.
  5. Измерение концентрации продуктов ПЦР на спектрофотометре. Пустой документ с Элюирующий буфер.
    Примечание: ДНК концентрация должна быть между ~ 50 и ~ 120 нг/мкл.

3. в Vitro транскрипция sgRNA

  1. Смешайте следующие компоненты в PCR трубки газа (реагенты предоставляются в комплекте синтез РНК): 4 мкл eluted дна, 4 мкл дНТФ, 1 мкл 10 x буфер реакции и 1 мкл T7 РНК полимераза фермент смесь.
  2. Проинкубируйте образцы при 37 ° C в течение 4 часов.
  3. Примените РНКазы чистящее средство для удаления РНКазы из перчатках.
  4. Принести каждый образец РНК до суммарный объем 50 мкл свободной от нуклеиназы водой (первый этап очищения RNA, следуя инструкциям производителя).
  5. Приступить к очистке РНК, следуя инструкциям производителя и элюировать в 50 мкл комплект условии нуклеиназы свободной воды.
  6. Измерьте концентрацию eluted sgRNA на спектрофотометре. Бланк документа с нуклеиназы свободной воды.
    Примечание: Ожидаемой доходности после очистки составляет 50-80 мкг РНК (т.е. концентрация 1,0-1,5 мкг/мкл).
  7. Используйте очищенный sgRNA сразу или хранить в аликвоты мкл 2-4-80 ° c в долгосрочной перспективе.

4. HSPC изоляции и культура

  1. Мышиных изоляции HSPCs и культура
    Примечание: Мужские и женские Ubc-GFP мышей (JAX004353) и Rosa26-LSL-tdTomato (JAX007914) пересекается с ВАВ МСВЗ (JAX008610) в возрасте 2-6 месяцев были использованы для получения результатов, показано ниже.
    1. Усыпить наркотизированных мышей через шейки матки дислокации.
      Примечание: Два подготовленных лиц должны самостоятельно проверить успешное эвтаназии, отметив отсутствие дыхания и пульса для по крайней мере 5 минут удалить кожу от животных.
    2. Вскрыть tibias, бедра и подвздошные гребни мышей и удалить все мышечной и соединительной ткани вокруг расчлененных костей. Место нетронутыми костей в тканевой культуры блюдо на льду с HBSS дополнена 2% FBS (HBSS +). Перейти к Ламинарный шкаф как можно скорее Аль кости были очищены и переданы на тканевой культуры блюдо.
    3. Передачи очищены кости стерильный раствор, содержащий 2 мл ледяной HBSS + за 3 кости. С помощью пестика, раздавить костей в костных фрагментов, выпуская костного мозга от в пределах. Далее, pestling до костей стоп растрескивание под толкателем.
    4. Соберите супернатант из минометов и фильтр в 50-мл Конические трубки с помощью стрейнер клеток 40 мкм. Промойте оставшиеся фрагменты костей с 5 мл ледяной HBSS + и фильтр трубу же 50 мл конические с использованием же фильтр 40 мкм.
    5. Вымойте клетки дважды, дозаправки трубку с ледяной HBSS + и центрифугирование в g 400 x 7 мин удалить супернатант.
    6. После второй мыть Ресуспензируйте Пелле клеток в 20 мл холодного льда PBS. Количество жизнеспособных клеток путем исключения Трипановый синий9.
    7. Инкубировать 1 x 108 жизнеспособных клеток в 1 мл ледяной HBSS + с биотин конъюгированных антител c комплект при разбавлении 1: 100 для 45 мин на льду.
    8. Вымойте клетки с ледяной HBSS +, центрифугирование в 400 g x 7 мин и отменяя супернатант.
    9. Проинкубируйте клетки с анти биотина магнитные бусы, следуя инструкциям производителя.
    10. Изолируйте c комплект позитивных клеток с использованием магнитной столбцы или магнитные активации клеток сортировщики, следуя инструкциям производителя. Соберите положительные клетки c комплект в 15 мл конические трубы.
    11. Вымыть клетки дважды с PBS, дозаправки 15 мл Конические трубки и центрифугирование в 400 g x 7 мин удалить супернатант. Между двумя моет Рассчитайте общее количество жизнеспособных клеток Трипановый синий отчуждения9.
    12. Ресуспензируйте c-комплект + клеток в концентрации до 10 viablecells6 на 100 мкл питательной среды для мышиных HSPCs с 2% FBS, фактор стволовых клеток мыши 50 нг/мл (SCF), 50 нг/мл мыши thrombopoietin (ТПО), 10 нг/мл мыши Ил-3 и 10 нг/мл мышь ИЛ-6.
    13. Инкубируйте клетки при 37 ° C, 5% CO2 для по крайней мере 1 час максимум за 24 часа до электропорации.
  2. Человеческого HSPCs изоляции и культура
    Примечание: Эти шаги должны быть выполнены в Ламинарный шкаф.
    1. Фильтр клетки костного мозга/пуповинной крови через стрейнер клеток 40 мкм.
    2. 1:2 клетки отфильтрованных костного мозга/пуповинной крови разбавляют PBS с 1 мм ЭДТА (PBS/ЭДТА).
    3. Отказаться от 15 мл средний градиент плотности в 50-мл Конические трубки. Осторожно залейте 30 мл разбавленной костного мозга/пуповинной крови на поверхности средний градиент плотности. Если объем суспензии клеток больше, чем 30 мл подготовить несколько труб.
      Примечание: Убедитесь в том сохранить интерфейс между кровью и средний градиент плотности острый, как можно.
    4. Спин трубы на 750 g x 30 мин без замедления.
    5. Соберите мононуклеарных клеток слой обнаруживаемая на интерфейс и передача среднего чистого 50 мл Конические трубки. Заполнить трубу с PBS/ЭДТА и спина клетки на 280 g 15 мин удалить супернатант.
    6. Вымойте клетки дважды в PBS/ЭДТА спиннинг на 400 g x 7 мин и отменяя супернатант.
    7. Проинкубируйте мононуклеарных клеток с анти CD34 магнитные бусы, следуя инструкциям производителя.
    8. Изолируйте CD34 + клеток с использованием магнитной столбцы или магнитные активации клеток сортировщики, следуя инструкциям производителя. Собирайте CD34 + клеток в 15 мл конические трубы.
    9. Мыть собранные CD34 + клетки дважды дозаправки трубку с PBS и спиннинг на 400 x g 7 мин и отбрасывая супернатант. Между двумя моет Рассчитайте общее количество жизнеспособных клеток Трипановый синий отчуждения9.
    10. Ресуспензируйте клетки в культурной среде, дополняется 100 нг/мл человека SCF, 100 нг/мл человека FLT3 лиганда (FLT3L), 100 нг/мл человека ТПО в концентрации ~2.5 x 105 жизнеспособных клеток / мл. Культура изолированные CD34 + клеток при 37 ° C, 5% СО2 за 24 ч до предварительного максимум 48 ч для электропорации.
      Примечание: До электропорации Проверьте чистоту обогащенного CD34 + населения проточной цитометрии.

5. Электропорация

Примечание: Следующий протокол оптимизирован для 10 мкл электропорации советы. Все действия должны выполняться в Ламинарный шкаф.

  1. Подсчет ячеек Трипановый синий отчуждения9. Сбор 2 x 105 жизнеспособных клеток / репликацию (например собирать 6 x 105 клеток для 3 electroporations).
  2. Вымыть клетки дважды с PBS, спиннинг на 300 x g 7 минут и тщательно удалить супернатант.
  3. Параллельно Подготовьте RNP Cas9-sgRNA комплексов, инкубации в пробирках, ПЦР для 20-30 мин на RT 1,5 мкг Cas9 с 1 мкг всего sgRNA для каждой репликации, за исключением элемента управления только Cas9.
    Примечание: Cas9 белок предоставляется при концентрации 10 мкг/мкл. Чтобы гарантировать точное дозирование, развести 1:10 количество белка Cas9, необходимо с нуклеиназы свободной воды (например, для 10 electroporations взять 1 мкл Cas9 белка и разбавить его с 9 мкл нуклеиназы свободной воды и инкубировать 1 мкл разбавленного Cas9 на репликацию. В зависимости от концентрации sgRNA общий объем Cas9 и sgRNA должны входить между 1,7 и 2 мкл на репликацию. Если с помощью двух sgRNAs инкубировать 500 нг каждого sgRNA на репликацию; Если с помощью 3 sgRNAs инкубировать 330 нг каждого sgRNA на репликацию и так далее.
  4. Вычислить, что общий объем взмучивания, который реплицирует буфера T необходимо, умножив Количество всего 10 мкл (например 30 мкл для 3 реплицирует). Ресуспензируйте гранулированных клетки с расчетный объем буфера т. Убедитесь, что конечная концентрация суспензию клеток 2 x 10-7 кл/мл.
  5. Аликвота 10 мкл ресуспензированы клеток/репликацию в каждую ПЦР-пробирку, содержащие pre-complexed sgRNA/Cas9 RNP (например, для трех экземплярах аликвота 30 мкл суспензии клеток в ПЦР-пробирку, содержащие pre-complexed Cas9-sgRNA).
  6. Чтобы настроить электропорации системы Включите прибор и добавить 3 мл буфера E в кювет электропорации и вставьте держатель кювет кювет.
  7. Установите желаемый электропорации условий на устройстве: человеческого HSPCs (1600 V, 10 мс, 3 импульсов) или мыши HSPCs (1700 V, 20 мс, 1 импульса).
    Примечание: Если необходимо, перед выполнением эксперименты на CD34 + HSPCs, sgRNA эффективность может быть проверен на острый миелоидный лейкоз (ОМЛ) клеточных линий (например HL60) с помощью той же стратегии (использование антибиотик бесплатно средних для AML клеточных линий) с соблюдением следующих условий электропорации: Буфер, R, 1350 V, 35 ms, 1 импульса.
  8. Электропорация выполняется с специальных электропорации пипетки, который имеет коготь, что защелки на электропорации наконечник пипетки. Держать пипетку электропорация, расширить коготь, возьмите диск внутри наконечник пипетки и твердо нажмите пипетку до безопасных кончик.
  9. Пипетка образец вверх и вниз по 10 раз перемешать. Взять 10 мкл, убедившись, что есть никаких пузырей и вставьте наконечник пипетки непосредственно в электролитический буфер в кювет электропорации. Старайтесь не касаться стены кювет. Нажмите кнопку «Старт» на экране. После того, как появится сообщение «полный», удалите пипетки и распределять содержимое в колодец с новой HSPC питательной среды.
  10. Повторите для всех образцов. Изменение пипеткой советы между образцами, только в случае необходимости.

Representative Results

Цель настоящего протокола — выполнить Нокаут гена (KO) в мышь и человека HSPCs с помощью Cas9-sgRNA RNPs. Рабочий процесс легко и быстро и позволяет для завершения экспериментов в менее чем через неделю от экспериментального дизайна для оценки эффективности KO.

По сравнению с подходы на основе плазмид или вирус, успех нашего протокола основывается на комбинации sgRNA RNPs и электропорации. Эта стратегия, клонирование бесплатно значительно сокращает время, необходимое для получения компонентов для transfect. Кроме того электропорации позволяет для transfection до 95% клеток, максимизации доставки RNPs. sgRNAs может быть синтезированный в лаборатории через в vitro транскрипция (IVT), а очищенный протеин Cas9 можно приобрести от нескольких компаний ( Смотреть протокол). sgRNA ДНК шаблоны для ИВТ получаются выполнения коротких ПЦР с использованием sgRNA передний грунт (рис. 1A, B) и Всеобщей эшафот Rev грунтовка (рис. 1B - протокол). Затем продукт PCR используется как шаблон для ИВТ (рис. 1 c). Cas9-sgRNA RNP комплексы создаются инкубации 15-30 минут, sgRNAs и Cas9 (рис. 1 c). Наконец sgRNA RNPs, electroporated в клетки. Отредактированная HSPCs затем может использоваться для выполнения как in vitro и in vivo экспериментов.

Срыв генов в клетки мыши

Чтобы продемонстрировать эффективность стратегии Cas9-sgRNA RNP электропорация, c-комплект + HSPCs, изолированные от мышей, повсеместно выражая GFP или tdTomato были electroporated с sgRNA против GFP или tdTomato. Среди трех sgRNA, направленных против GFP GFP sg1 выполнены наиболее эффективно, экспонируется около 70-75% нарушение экспрессия гена GFP определяется проточной цитометрии (рисунок 2A, B). Чтобы измерить частоту гена нарушения на уровне генома, genomic дна от клеток electroporated был изолирован и T7 эндонуклеазы я-на основе анализа (T7EI) была выполнена. Как показано на рис. 2 c, T7EI пробирного обнаружено до 60% indel формирования. Обратите внимание, что T7EI анализов склонны недооценивать частоты indels. Мы также генерируется sgRNA против tdTomato и electroporated HSPCs, выражая tdTomato от Rosa26 Локус. Как показано на рисунке 2D, tdTomato sg1 эффективно удаленной выражение tdTomato.

Срыв генов в клетках человека

Здесь эффективной нарушения, полученные с одной sgRNA подход, ориентация CD45, маркер поверхности клетки, выразил на кроветворные клетки, показано. Три sgRNAs ориентации различных экзонов CD45 были разработаны (CD45 sg1, sg2 и sg3). Эффективность sgRNAs был испытан в строке ячейки HL60 бод (рис. 3A). Белка KO оценивали проточной цитометрии 5 дней после электропорации. CD45 sg1 было наиболее эффективным (98% KO КПД - рис. 3а) и был использован для дальнейших экспериментов. Рисунок 3B показывает CD45 KO первичной CD34 + прогениторных клеток человека CD45 sg1, оценены проточной цитометрии 5 дней после электропорации. В то время как CD34 выражение было неизменным, CD45 выражение было потеряно в около 80% клеток. 200.000 отредактированный первичной CD34 + клетки ретро орбитально были пересажены в ГЯП мышей через 6 часов после электропорации. Собранный 3 месяца после пересадки костного мозга и селезенки клетки. Измененные клетки (HLA-ABC положительный, отрицательный CD45, выделены красным цветом) обнаруживаются только в sgRNA лечение образцов и не Cas9 только элементы управления (рис. 3 c).

При желании, два sgRNAs ориентации по поблизости последовательности может использоваться для создания исключений. Этот подход позволяет для быстрой оценки эффективности редактирования с ПЦР и часто производит более высокую эффективность нарушения. 3D рисунок показывает эффективным поколения 58 удаления bp в экзона 10 DNMT3A. 200.000 отредактированный CD34 + клетки были пересажены в ГЯП мышей через 6 часов после электропорации. 58 удаление bp явно был обнаружен в периферической крови прижившимися ГЯП мышей 5 месяцев после инъекции (Рисунок 3E) подтверждающие редактирования CD34 + клеток с долгосрочным приживления возможностями.

Figure 1
Рисунок 1: быстрый и простой подход для создания sgRNA RNPs. A) представление sgRNA передний грунт. SgRNA передний грунт является ДНК олигонуклеотида, содержащий T7 промоутер, protospacer последовательность и последовательность совпадения с sgRNA леса. В 3' конца, выделены красным цветом, это последовательность «ATAGC», которая должна быть добавлена к последовательности грунтовка передний sgRNA, полученные на CRISPRscan. B) схематическое изображение перекрытия, ПЦР выполнены в том, чтобы получить шаблон ИВТ. Перекрытие между sgRNA передний грунт и грунтовка универсальная леска Rev позволяет для расширения и усиления методом ПЦР. C) мультфильм, описывая IVT реакции и sgRNA RNP pre комплексообразования. ПЦР продукта очищается и использоваться в качестве шаблона для ИВТ. IVT генерирует большое количество sgRNAs, которые могут быть использованы в нескольких реплицирует (см. протокол). sgRNA RNPs генерируются инкубации sgRNA, очищенного от ИВТ и приобретенных ранее Cas9 белка. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: эффективные гена срывов в гемопоэтических прогениторных клеток мыши. A) sgRNA ориентации GFP (GFP sg1) вместе с белком Cas9 был electroporated в мышиных c-комплект + HSPCs, выражая GFP и проанализированы подачей cytometry 24 часа после электропорации. B) различное количество GFP sg1 был complexed с 1 мкг белка Cas9 и electroporated. Как 200 нг sg1 ГПУПТТ эффективно удаленной экспрессия гена GFP. C) T7EI пробирного над геномной ДНК, изолированный от ячеек, которые используются в A-B. ПЦР ампликон охватывающих расщепления сайт Cas9-sgRNA был разведен 1:4 в 1 x буфере 2 и гибридизированные медленно в тепловая велосипедист. Гибридизированные фрагменты были затем переваривается с 1,25 U T7 эндонуклеазы I для 10 минут при 37 ° C. Усваивается фрагменты были отделены электрофорезом геля полиакриламида. Группа интенсивности анализировались с использованием ImageJ программного обеспечения путем построения группы интенсивности каждого Лейн. % расщепления был рассчитан на отношение интенсивностей полос рассеченного uncleaved полос. D) c-комплект + HSPCs, изолированные от мышей, выражая tdTomato был electroporated с Cas9 белком complexed с sgRNA против tdTomato. Проточной цитометрии осуществляется через 24 часа после электропорации показали, что приблизительно 74% клеток исключить tdTomato. R26 = Rosa26. * p < 0,05, ** p < 0.01, *** p < 0,001. Эта цифра была адаптирована из Gundry и др. 6 Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: нарушение эффективного гена гемопоэтических клеток человека. A) три sgRNAs ориентации CD45 (CD45 sg1, sg2 sg3) были разработаны и испытаны в строке ячейки HL60 бод (см. протокол для электропорации условий). Проточной цитометрии было проведено 5 дней после электропорации. CD45 sg1 был выбран как наиболее эффективным среди трех sgRNAs (KO эффективность 98%). B) CD45 KO первичной человеческой пуповинной крови CD34 + HSPCs с помощью CD45 sg1. CD45 потери могут быть обнаружены в примерно 80% клеток. Обратите внимание, что выражение CD34 неизменным после редактирования. C) под редакцией человека HSPCs может быть эффективно engrafted в ГЯП мышей. Человека ядерных клеток отображения обычных HLA +/ CD45 + фенотип в Cas9-только прижившимися мышей, тогда как в мышей, прижившимися с CD45-sg1 лечение CD34 + клетки, как HLA +/ CD45 + и HLA +/ CD45-населения наблюдаются указанием приживления CD45 KO клеток человека. D) 2% агарозном геле показаны 58 bp исключения, генерируемые 2 sgRNAs (двойное руководство подход) в экзона 10 DNMT3A в человека HSPCs от 3 различных пуповинной крови (CB1, CB2 и CB3). ПЦР была выполнена через 3 дня после электропорации. E) 2% агарозном геле демонстрируют сохранение 58 удаления bp 5 месяцев после пересадки в ГЯП мышей. Эта цифра была адаптирована из Gundry и др. 6 Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Олигонуклеотида Последовательность Примечание
Грунт универсальный Rev эшафот gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct Универсальные обратный грунтовка для перекрытия PCR
hCD45 sgRNA 1 taatacgactcactataGGTGCTGGTGTTGGGCGCACgttttagagctagaaatagc sgRNA передний грунт последовательности для дублирования PCR
hCD45 sgRNA 2 taatacgactcactataGGGAGCAAGTGAGGATCCTCgttttagagctagaaatagc sgRNA передний грунт последовательности для дублирования PCR
hCD45 sgRNA 3 taatacgactcactataGGGATGCTTGTTCCCTTCAGgttttagagctagaaatagc sgRNA передний грунт последовательности для дублирования PCR
hDNMT3A Ex10 sg1 taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA передний грунт последовательности для дублирования PCR
hDNMT3A Ex10 sg2 taatacgactcactataGGGTGGCCAGCAGCCGCGCGgttttagagctagaaatagc sgRNA передний грунт последовательности для дублирования PCR
Rosa26 sgRNA taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA передний грунт последовательности для дублирования PCR
GFP sg1 taatacgactcactataGGGCGAGGAGCTGTTCACCGgttttagagctagaaatagc sgRNA передний грунт последовательности для дублирования PCR
tdTomato sg1 taatacgactcactataGGGGTACAGGCGCTCGGTGGgtttaagagctagaaatagc sgRNA передний грунт последовательности для дублирования PCR

Таблица 1: Завершения последовательности праймеров sgRNA передний, используемых в экспериментах и грунтовка универсальная Rev.

Discussion

RNP подход, описанный в этом подробный протокол позволяет эффективно гена нокаут в мышь и первичных гемопоэтических клеток человека также как подвеска клеточных линий. Хотя часто получаются очень высокая эффективность KO, несколько критических переменных должны рассматриваться. Во-первых выбор правильного экзона является ключевым в обеспечении, что эффективное indel инкорпорации соответствует Нокаут гена. Два важных фактора, связанные с выбором экзона являются сохранение через изоформ и экзона позиции в пределах стенограммы. Шаблоны выражений изоформы являются переменными различных типов клеток, так что если ген KO различных типов клеток, клеток экзонов, которые являются инвариантными между типы должны быть направлены. Изоформы шаблоны могут быть проверены с помощью q ПЦР или РНК последовательности данных. Экзона позиции в пределах стенограммы лучше ориентироваться на ранних экзонов как фреймшифт мутации в терминале или предпоследнем экзона может избежать нонсенс опосредованной распада10, производства белков с роман или неизвестных функций, а не истинный значения NULL.

Определение indel частота является важным шагом для оценки эффективности KO и правильно интерпретировать биологических результаты эксперимента. Эндонуклеазами анализов (например пробирного инспектора) имеют преимущество относительно быстро и легко выполнять. Однако они клонат быть неточными из-за значительных фон сигналов, и результаты зачастую трудно воспроизвести. Кроме того они не обеспечивают информацию о качестве генерируется indels (например, длина вставок и удалений) в эксперименте. Сэнгер последовательности обеспечивает ценную альтернативу эндонуклеазы анализов. Платформы, такие как ПРИЛИВ11 (https://tide.nki.nl/) помогают разложить Сэнгер следы и производить точные оценки эффективности аллельные нарушения, обеспечивая при этом частоты индивидуальных indels. Основным недостатком является абсолютная зависимость от высокого качества Сэнгер последовательность следов. Ампликон высокопроизводительного секвенирования преодолевает большинство из этих вопросов. Ампликон библиотеки могут быть получены начиная с очень низким ДНК входов и высокий охват обеспечивает надежные результаты. Для снижения расходов ампликонами последовательности, мы обычно шип в ампликон библиотек в больше проходит последовательности (например, РНК последовательности), используя только 1-1,5% всего читает. Наконец чтобы подтвердить успешное нокаут, настоятельно рекомендуется оценки уровня белка в западных помарках или проточная цитометрия, когда это возможно.

Как описывалось ранее метод, представленные здесь быстро и понятен и представляет собой новый инструмент для изучения гена нокаут в мышь и человеческой HSPCs. Хотя наш протокол содержит инструкции по нокаут гена с системой на основе наконечник электропорация, другие системы были продемонстрированы быть весьма эффективным в12,13.

Два основных ограничения необходимо признать, что касается подхода RNP. Во-первых, как описано в нашей группе, жизнеспособность HSPCs electroporated с in vitro транскрипции sgRNAs может быть значительно снижена электропорация, особенно, когда условия не являются оптимальным6. При необходимости, коммерчески синтезированных sgRNAs (т.е. Устранение в vitro транскрипция) может преодолеть эту проблему. Они становятся менее дорогим, с течением времени и могут быть приобретены от нескольких поставщиков. В этом случае в vitro транскрипция могут быть использованы для создания пула sgRNA экран для эффективности, а затем можно выбрать наиболее эффективный sgRNA(s) для синтеза. Вторым основным ограничением RNP подхода является неспособность отслеживать успешно transfected клеток, как вирусные подходы. Однако высокая эффективность KO и быстрого редактирования, полученные с Cas9-sgRNA RNPs может превысить эти недостатки во многих экспериментальных сценариях. Мы рекомендуем использовать ампликон высокопроизводительного секвенирования точно определить эффективность нарушения в каждом эксперименте. Если ожидается, что Нокаут гена интереса возлагают пролиферативной фенотип (т.е. либо снижение или увеличение распространения, по сравнению с одичал тип клеток), определения частоты indel в нескольких точках времени позволяет оценить ли KO клетки пройти обогащение (т.е. indel частота увеличивается с течением времени) или являются outcompeted (т.е. indel частота уменьшается с течением времени).

Выполнение в естественных условиях или в пробирке эксперименты понять биологические эффекты потери функции гена требует надлежащего контроля. Как упоминалось ранее, в пробирке транскрипции sgRNAs могут быть токсичны для клеток, особенно начальное прародитель клетки6. Кроме того двухнитевые разрывы ДНК, вызванные Cas9 белка может привести к Джин независимых анти Пролиферативная реакция14. Таким образом мы часто используют количество управления sgRNAs в экспериментах ТРИФОСФАТЫ и рекомендовать маркер поверхности клетки, выразил на ваш тип ячейки, а также второй цели ген, который выражается не.

Краткосрочные культура человека HSPCs присутствии цитокинов увеличивает эффективность нарушению гена6 и необходимых для достижения высокой эффективности KO. Мы нашли 36-48 часов, чтобы быть идеальным периодом культуры до электропорации6. После электропорация, клетки могут быть далее культивировали имея в виду, что чем дольше культуры, тем выше риск потерять мультилинейного приживления потенциала. Таким образом мы обычно выполняют трансплантации 6 часов после электропорации и никогда не позднее, чем через 24 часа после электропорации.

ТРИФОСФАТЫ/Cas9 значительно улучшилась ученых возможность успешно редактировать генома клеток млекопитающих. Делая ген нарушения более осуществимым в клетках первичной гемопоэтических предшественников, по прогнозам, быстро расширить научные знания в области HSPCs и гематологических заболеваний. Важно отметить, что протокол, описанные здесь делает его также можно одновременно создавать несколько нокауты с высокой эффективностью, позволяя для моделирования сложных генетических ландшафтов, часто видели в лейкозных заболеваний.

Хотя протоколы, описанные здесь сосредоточены на ген потрясений, они могут быть легко адаптированы для гена забивные экспериментов. Это может осуществляться через совместное доставки одноцепочечной олигонуклеотида шаблоны для гомологии направленных ремонт6,13 (HDR) или через трансдукции пост electroporation клетки с AAV6 векторов содержащие гомологии шаблон12. Возможность ремонта или ввести специфических мутаций в HSPCs будут способствовать новые терапевтические стратегии для генной терапии и расширенного исследования рака драйвер мутаций в борьбе с отмыванием денег и других гематологических заболеваний. В то время как HDR в человека HSPCs был успешным6,12,13, мыши HSPCs было сложно редактировать с помощью этой стратегии6. Оптимизации HDR протоколов в человека и особенно в мыши HSPCs позволит более конкретные редактирования и разработки инструментов для отслеживания отредактированных ячеек с использованием эндогенного пометки.

Наконец предполагается также, что нарушения мутантные аллели усиления функции может представлять потенциальный терапевтический подход для врожденных и приобретенных заболеваний кроветворных. В этом случае ДНК свободный подход рекомендуется для того, чтобы избежать возможной интеграции, которые могли бы содействовать трансформации. Кроме того «хит и запустить» подход снижает вероятность нежелательных эффектов пробить. Необходимы дополнительные усилия для разработки конкретных систем доставки, которые бы открыть новые возможности для лечения злокачественных и доброкачественных гематологических заболеваний.

Disclosures

Отсутствие конфликта интересов раскрывать

Acknowledgments

Эта работа была поддержана профилактики рака и научно-исследовательский институт штата Техас (RP160283, RP140001 и R1201), Габриэль Анхель Фонд исследований рака, Эдвард р. Эванс фонд и низ (DK092883, CA183252, CA125123, P50CA126752, CA193235 и DK107413). M.C.G. поддерживается Baylor исследования выступает для ученых, студентов. Проточной цитометрии было частично при поддержке низ (Национальный центр для исследования ресурсов Грант S10RR024574, Национальный институт аллергии и инфекционных болезней AI036211 и национального P30CA125123 института рака) колледж Бейлор Цитометрии и сортировка ядра клеток.

Materials

Name Company Catalog Number Comments
Tissue culture plates according to cell numbers
1.5 ml Eppendorf microtubes Sigma Z606340-1000EA
50ml Falcon tubes Corning 352070
Nuclease Free Water - DEPC treated ThermoFisher Scientific AM9915G
KAPA HiFi HotStart ReadyMix (2X) KAPA Biosystems KK2600
MinElute PCR purification Kit Qiagen 28004
RNAse Zap RNAse Decontamination Solution ThermoFisher Scientific AM9780
RNA Clean and Concentrator-25 Zymo R1017
HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs E2040S
Alt-R S.p. Cas9 Nuclease 3NLS, 100 µg IDT 1074181
40 mm Cell Strainers VWR 352340
Dulbecco's Phosphate Buffered Saline (PBS) GenDEPOT CA008-050
Fetal Bovine Serum (FBS), Regular Corning 35010CV
AutoMACS Pro Separator or MACS manual Cell Separation columns Miltenyi
Neon Transfection System Device ThermoFisher Scientific
Neon Transfection System 10mL kit ThermoFisher Scientific MPK1025 For larger numbers of cells (see protocol) Neon Transfection System 100 mL kit (# MPK10025) can be used
Name Company Catalog Number Comments
UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific 15575020 For human experiments only
Lymphoprep Stem Cell Technologies 7851 For human experiments only
CD34 MicroBead Kit UltraPure human Miltenyi Biotec 130-100-453 For human experiments only
Stem Span SFEM II Stem Cell Technologies 9605 For human experiments only
Recombinant Human SCF Miltenyi Biotec 130-096-695 For human experiments only
Recombinant Human TPO Miltenyi Biotec 130-094-013 For human experiments only
Recombinant Human FLT3L Miltenyi Biotec 130-096-479 For human experiments only
Name Company Catalog Number Comments
Mouse dissection tools For mouse experiments only
Mortar and Pestle For mouse experiments only
Hank's Balanced Salt Solution (HBSS) Gibco 14170112 For mouse experiments only
Biotin-conjugated anti c-kit antibody eBioscience 13-1171-82 For mouse experiments only
Anti-Biotin MicroBeads Miltenyi Biotec 130-090-485 For mouse experiments only
X VIVO-15, with L-Glutamine, Genatmycin and Phenol Red Lonza 04-418Q For mouse experiments only
Mouse IL-6 Peprotech 216-16 For mouse experiments only
Mouse TPO Peprotech 315-14 For mouse experiments only
Mouse IL-3 Peprotech 213-13 For mouse experiments only
Mouse SCF Peprotech 250-03 For mouse experiments only

DOWNLOAD MATERIALS LIST

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, 816-821 (2012).
  2. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  3. Sternberg, S. H., Doudna, J. A. Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell. 58, 568-574 (2015).
  4. Heckl, D., et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 32, 941-946 (2014).
  5. Mandal, P. K., et al. Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell stem cell. 15, 643-652 (2014).
  6. Gundry, M. C., et al. Highly Efficient Genome Editing of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. Cell Rep. 17, 1453-1461 (2016).
  7. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012-1019 (2014).
  8. Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature methods. 12, 982-988 (2015).
  9. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Current protocols in immunology. 111, A3 B 1-3 (2015).
  10. Lykke-Andersen, S., Jensen, T. H. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol. 16, 665-677 (2015).
  11. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, e168 (2014).
  12. Dever, D. P., et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature. 539, 384-389 (2016).
  13. DeWitt, M. A., et al. Selection-free genome editing of the sickle mutation in human adult hematopoietic stem/progenitor cells. Sci Transl Med. 8, 360ra134 (2016).
  14. Aguirre, A. J., et al. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting. Cancer Discov. 6, 914-929 (2016).
Высокоэффективные гена срыв мышиных и человека гемопоэтических предшественников клеток ТРИФОСФАТЫ/Cas9
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).More

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter