Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Interrupción génica altamente eficiente de las células progenitoras hematopoyéticas murinas y humanas por CRISPR/Cas9

doi: 10.3791/57278 Published: April 10, 2018
* These authors contributed equally

Summary

Un protocolo para rápido CRISPR/Cas9-mediado interrupción de genes en ratón y células hematopoyéticas primarias humanas se describe en este artículo. Cas9 sgRNA ribonucleoproteínas se introducen a través de electroporación con sgRNAs generado a través de transcripción en vitro y Cas9 comercial. Alta eficiencia edición se logra con tiempo limitado y costos financieros.

Abstract

Avances en el campo de células madre hematopoyéticas (HSCs) han sido ayudados por métodos para diseñar genéticamente células progenitoras primarias como en modelos animales. Ablación del gen completo en HSCs necesaria la generación de ratones knockout que HSCs podrían ser aisladas, y ablación del gen en HSCs humanas primarias no era posible. Transducción viral podría ser utilizado para métodos de precipitación, pero éstos sufrieron de eficacia variable. En general, genética manipulación de humano y ratón células hematopoyéticas se vio obstaculizadas por la baja eficiencia y tiempo extenso y compromisos de gastos. Recientemente, CRISPR/Cas9 ha ampliado considerablemente la capacidad de diseñar el ADN de células de mamíferos. Sin embargo, la aplicación de CRISPR/Cas9 a células hematopoyéticas ha sido difícil, debido principalmente a sus eficacias de transfección baja, la toxicidad de los enfoques basados en el plásmido y el tiempo de respuesta lento de protocolos basados en virus.

En este artículo se ofrece un método rápido para realizar CRISPR/Cas9-mediated gene edición progenitor y vástago hematopoyética murina y humana de las células con eficiencias del golpe de gracia de hasta un 90%. Este enfoque utiliza una estrategia de entrega de ribonucleoproteína (RNP) con un optimizado flujo de trabajo de tres días. El uso de RNP Cas9 sgRNA permite un enfoque relámpago, no introduciendo secuencias de ADN exógenas en el genoma de las células editados y reducir los efectos off-target. El método basado en la RNP es rápido y sencillo: no requiere clonación de sgRNAs, virus de la preparación o modificación química sgRNA específicos. Con este protocolo, los científicos deben ser capaces de generar con éxito discos removibles de un gen de interés en las células hematopoyéticas primarias dentro de una semana, incluyendo paradas para síntesis de oligonucleótidos. Este enfoque permitirá a un grupo mucho más amplio de los usuarios para adaptarse a este protocolo a sus necesidades.

Introduction

El advenimiento de CRISPR/Cas9 ha simplificado radicalmente edición de genes en células de mamíferos. Principios CRISPR/Cas9 protocolos utilizan plásmido o virus basado en entrega de Cas9 proteína y sgRNA1,2,3. Estos enfoques resultó revolucionarios para el desarrollo de modelos celulares y animales y se han aplicado también con éxito a primaria hematopoyéticas tronco y progenitor células (HSPCs)4,5. Sin embargo, estos métodos tienen varios inconvenientes. En primer lugar, eficiencia de la interrupción del gene sigue siendo a menudo debajo del 50%4,5. Mientras que esto es suficiente para generar clones de nocaut (KO) en líneas celulares, la necesidad de cultura a corto plazo hace HSPCs no susceptibles de tal estrategia. En segundo lugar, el requisito para la clonación limita la cantidad de sgRNAs que puede ser probado en experimentos individuales y genera grandes y difíciles de transfectar las construcciones. En tercer lugar, estos enfoques fuerza científicos para disminuir tiempos de respuesta.

Para superar estas limitaciones, nuestro grupo desarrolló y publicó recientemente una alternativa CRISPR/Cas9 en HSPCs utilizando ribonucleoproteínas Cas9 sgRNA (RNPs)-basado en entrega6. En esta estrategia, los componentes crudos de CRISPR (proteína Cas9 y en vitro transcripción sgRNA) son pre-complejado y entregado directamente en las células diana mediante electroporación (figura 1). La vida media del complejo RNP Cas9 sgRNA es menor que el tiempo ese plásmido o ácido nucleico viral se transcribe, la tasa objetivo es inferior comparada con enfoques temprano7. Por otra parte, el enfoque de RNP añade la ventaja de eliminar cualquier fuente de ADN exógeno, que puede integrar al azar en el genoma de la célula objetivo conduce a la transformación celular.

Este protocolo se basa en un flujo de trabajo racionalizado para experimentos de interrupción génica basadas en RNP, según lo representado en la figura 1. El primer paso es diseñar y ordenar cartillas para cada sgRNA. Estos iniciadores se utilizan para hacer plantillas de la DNA sgRNA que se utilizan para la transcripción en vitro (IVT) para obtener el sgRNAs. SgRNAs purificadas luego se incuban con proteína de Cas9 comprada anteriormente, para formar Cas9 sgRNA complejos de RNP. Por último, pre-complexed Cas9 sgRNA RNPs son electroporated en las células. Después de la electroporación, edición de eficiencia puede ser probado y en vitro/ pueden iniciar experimentosen vivo , dependiendo de las necesidades. A continuación una descripción detallada de este enfoque experimental innovador puede encontrarse.

Protocol

El protocolo sigue las pautas del Comité de ética humana del Baylor College of Medicine. Todos los procedimientos experimentales realizados en ratones se aprobaron por Baylor College de medicina institucional Animal cuidado y uso.

1. sgRNA Fwd diseño

  1. Desplácese a http://www.crisprscan.org/?page=track8 para empezar a diseñar sgRNAs de interés.
  2. Haga clic en el botón "Humano" en función del tipo de célula de interés o "Ratón".
  3. Introducir el gen de interés en el cuadro de búsqueda UCSC y pulse go.
  4. Zoom y hacia la región del gen (es decir. un exón específico) que es de interés para el objetivo.
    Nota: Para lograr la interrupción eficaz de genes que se recomienda a los primeros exon(s) en isoformas todos transcritos en el tipo de célula específica.
  5. Asegurar que las posibles secuencias de destino sgRNA se enumeran en "predicciones de CRISPRscan en los genes (CDS)" título.
  6. Busque y haga clic en una secuencia de destino con un puntaje relativamente alto y pocos (resaltados en color verde) de objetivos. La secuencia completa que aparece en la sección "Secuencia del Oligo" de copiar y pegar en un documento de texto. Añadir "ATAGC" en el extremo 3' de la secuencia. Una vez completado, coloque el orden de la secuencia completa.
    Nota: Para cada secuencia de destino, CRISPRscan8 proporciona una cartilla sgRNA adelante "integrado" que incluye el promotor de T7, la secuencia protospacer (blanco) y la secuencia de superposición de andamio universal (ver figura 1A). Una secuencia integral está conformada por 56 o 57 nucleótidos dependiendo de la longitud de protospacer.

2. sgRNA síntesis de plantilla de la DNA

  1. Disolver y diluir lo sgRNA Fwd y cartilla Rev universal (ver tabla 1 para la secuencia completa). Para obtener una concentración final de 10 μm, siga las instrucciones del fabricante diluir cartillas a 100 μm, entonces hacer un 1:10 dilución con agua libre de nucleasa.
  2. Para realizar la superposición de PCR (ver figura 1B), mezcla en tubos PCR tira: 2 μl sgRNA adelante primer (10 μm), cartilla de Universal Rev andamio de 2 μl (HPLC purificada) (10 μm), 10 μl ADN polimerasa de alta fidelidad mezclar maestro (x 2) y agua libre de nucleasa de 6 μl.
  3. Ejecutar la polimerización en cadena con el siguiente programa: 95 ° C por 3 min, 98 ° C durante 5 s, 60 ° C durante 5 s, 72 ° C durante 10 s, ir a 2 por 6 ciclos, 72 ° C por 1 min, 4 ° C para siempre.
  4. Purificar el producto PCR utilizando columnas de purificación de ADN (véase tabla de materiales). Siga las instrucciones del fabricante y eluir con 11.5 μl de tampón de elución.
  5. Medir la concentración de los productos PCR en un espectrofotómetro. En blanco el instrumento con el tampón de elución.
    Nota: La concentración de ADN debe ser entre 50 ~ y ~ 120 ng/μl.

3. transcripción in Vitro de sgRNA

  1. Mezclar los componentes siguientes en los tubos de la tira PCR (los reactivos son suministrados en el kit de la síntesis de RNA): 4 μL de ADN eluída, 4 μL de dNTPs, 1 μl de 10 x Buffer de reacción y 1 μl de mezcla de enzima T7 ARN polimerasa.
  2. Incubar las muestras a 37 ° C durante al menos 4 h.
  3. Aplicar el agente limpieza Rnasa Rnasa Retire las manos enguantadas.
  4. Llevar cada RNA muestra hasta un volumen total de 50 μL con agua libre de nucleasas (primer paso de purificación de RNA siguiendo las instrucciones del fabricante).
  5. Proceder a la purificación del ARN siguiendo las instrucciones del fabricante y eluir en 50 μl de agua libre de nucleasa suministrada por el kit.
  6. Medir la concentración de lo sgRNA eluída en un espectrofotómetro. En blanco el instrumento con agua libre de nucleasa.
    Nota: El rendimiento esperado después de la purificación es 50-80 μg de ARN (es decir, concentración de 1.0-1.5 μg/μl).
  7. Utilice el sgRNA purificada inmediatamente o almacenar en alícuotas de 2-4 μL a-80 ° C a largo plazo.

4. cultivo y aislamiento de la HSPC

  1. Cultura y aislamiento HSPCs murino
    Nota: Machos y hembras de ratones de Ubc-GFP (JAX004353) y Rosa26-LSL-tdTomato (JAX007914) cruzado con Vav-iCre (JAX008610) 2-6 meses de edad fueron utilizados para obtener los resultados que se muestran a continuación.
    1. Eutanasia a ratones anestesiados mediante dislocación cervical.
      Nota: Dos personas formadas independientemente deben verificar éxito eutanasia señalando una falta de respiración y latidos del corazón durante al menos 5 minutos retirar la piel de los animales.
    2. Diseccionar tibias, fémures y crestas ilíacas de ratones y retire todos los músculos y tejido conectivo alrededor de los huesos disecados. Coloque los huesos intactos en un plato de cultivo de tejidos en el hielo con HBSS suplementado con 2% FBS (HBSS +). Hacia una campana de flujo laminar en cuanto a los huesos limpios y transferidos a la placa de cultivo de tejido.
    3. Transferencia de limpiar los huesos al mortero estéril, que contiene 2 mL helada HBSS + por 3 huesos. Con la mano del mortero, machacar los huesos en fragmentos de hueso, liberando la médula desde dentro. Seguir pestling hasta que los huesos dejen de grietas bajo la mano del mortero.
    4. Recoger sobrenadante del mortero y filtro en un tubo cónico de 50 mL usando un tamiz de 40 μm células. Enjuague los restantes fragmentos de hueso con 5 mL helado HBSS + filtro y en el mismo tubo cónico de 50 mL con el mismo tamiz de 40 μm.
    5. Lavan las células dos veces por rellenado el tubo con HBSS helada + y centrifugación a 400 x g durante 7 min., descartar el sobrenadante.
    6. Después del segundo lavado Resuspender el precipitado de células en 20 mL de PBS frío hielo. Contar las células viables de exclusión azul de tripano9.
    7. Incubar 1 x 108 células viables por mL 1 helada HBSS + con el conjugado con biotina anticuerpo c-kit en dilución 1: 100 para 45 min sobre hielo.
    8. Lavar las células con HBSS helada + por centrifugación a 400 x g por 7 min y descartar el sobrenadante.
    9. Incubar las células con bolas magnéticas anti-biotina siguiendo las instrucciones del fabricante.
    10. Aislar las células positivas de c-kit con columnas magnéticos o clasificadores de célula activada por el magnético siguiendo las instrucciones del fabricante. Recoger las células positivas de c-kit en tubos cónicos de 15 mL.
    11. Lavan las células dos veces con PBS por rellenado el tubo cónico de 15 mL y centrifugar a 400 x g por 7 min descarte el sobrenadante. Entre los dos lavados para calcular el número total de células viables de exclusión del azul tripán9.
    12. Resuspender el c-kit + células a una concentración de hasta 10 viablecells6 por 100 μl de medio de cultivo para HSPCs murinos suplementado con 2% FBS, factor de células madre de ratón (SCF) de 50 ng/mL, 50 ng/mL ratón trombopoyetina (TPO), del ratón 10 ng/mL IL-3 y 10 ng/mL ratón IL-6.
    13. Incube las células a 37 ° C, 5% CO2 durante al menos 1 h hasta un máximo de 24 h antes de la electroporación.
  2. Cultivo y aislamiento de HSPCs humano
    Nota: Estos pasos deben realizarse en una campana de flujo laminar.
    1. Filtro de las células sanguíneas de la médula ósea, cordón a través de un tamiz de 40 μm celular.
    2. Diluir 1:2 las células de la sangre filtrada médula ósea, cordón con PBS suplementado con 1 mM EDTA (PBS/EDTA).
    3. Verter 15 mL de medio de gradiente de densidad en un tubo cónico de 50 mL. Suavemente Vierta 30 mL de la sangre diluida, cordón de la médula en la superficie medio gradiente de densidad. Si el volumen de la suspensión celular es mayor que 30 mL preparar tubos múltiples.
      Nota: Asegúrese de mantener la interfaz entre la sangre y el medio de gradiente de densidad lo más nítidas posible.
    4. Girar los tubos a 750 x g durante 30 min con la no desaceleración.
    5. Recoge la capa de células mononucleares detectable en el interfaz y la transferencia de medio a un tubo cónico de 50 mL limpio. Llenar el tubo con PBS/EDTA y vuelta a las células a 280 g por 15 minutos, descartar el sobrenadante.
    6. Lavan las células dos veces en PBS/EDTA spinning a 400 x g por 7 min y descartar el sobrenadante.
    7. Incube las células mononucleares con bolas magnéticas anti-CD34, siguiendo las instrucciones del fabricante.
    8. Aislar las células CD34 + mediante columnas magnéticos o clasificadores de célula activada por el magnético siguiendo las instrucciones del fabricante. Recoger las células CD34 + en tubos cónicos de 15 mL.
    9. Lavado recoge las células CD34 + dos veces por rellenado el tubo con PBS y girando a 400 x g por 7 min y descartar el sobrenadante. Entre los dos lavados para calcular el número total de células viables de exclusión del azul tripán9.
    10. Resuspender las células en medio de cultivo suplementado con 100 ng/mL SCF humano, 100 ng/mL humano FLT3 ligando (FLT3L), 100 ng/mL TPO humana en una concentración de ~2.5 x 105 células viables / ml. cultura aislado las células CD34 + a 37 ° C, 5% de CO2 durante 24 h antes de un máximo de 48 h a electroporación.
      Nota: Antes de la electroporación comprobar pureza de población CD34 + enriquecido por citometría de flujo.

5. electroporación

Nota: El siguiente protocolo está optimizado para consejos de electroporación de 10 μl. Todas las medidas deben realizarse en una campana de flujo laminar.

  1. Contar las células de trypan azul exclusión9. Recoger 2 x 105 células viables por repetición (e.g. recoger 6 x 105 células para 3 electroporations).
  2. Células de lavado dos veces con PBS, girando a 300 x g por 7 min y cuidadosamente retire el sobrenadante.
  3. En paralelo, preparar complejos Cas9 sgRNA RNP por incubación en tubos de PCR de 20-30 min a RT 1.5 μg Cas9 con 1 μg de sgRNA total para cada repetición, excepto el único control que Cas9.
    Nota: Proporciona proteína Cas9 10 concentración μg/μl. Para asegurarse de pipeteo preciso, diluir 1:10 la cantidad total de proteína Cas9 con agua libre de nucleasas (por ejemplo para 10 electroporations toma 1 μl de proteína Cas9 y diluir con 9 μl de agua libre de nucleasas e incubar 1 μl de Cas9 diluido por repetición. Dependiendo de la concentración de lo sgRNA, el volumen total de Cas9 y sgRNA debe compuesto entre 1,7 y 2 μl por repetición. Si utiliza dos sgRNAs incubar 500 ng de cada sgRNA por repetición; Si con 3 sgRNAs incubar 330 ng de cada sgRNA por repetición y así sucesivamente.
  4. Calcular el volumen total de resuspensión Replica T búfer necesario multiplicando 10 μl por el número total necesario (por ejemplo, 30 μl de 3 repeticiones). Resuspender las células alimentos peletizadas con el volumen calculado de Buffer T. asegurar que la concentración final de la suspensión celular es 2 x 107 células/mL.
  5. Alícuota de 10 μl de células/repetición resuspendido en cada tubo PCR que contiene la pre-complexed sgRNA/Cas9 RNP (e.g. para un triplicado alícuotas 30 μL de la suspensión celular en un tubo PCR que contiene pre-complexed Cas9-sgRNA).
  6. Para configurar el sistema de electroporación encienda el instrumento y añadir 3 mL de buffer E en una cubeta de electroporación y deslice la cubeta en el soporte de la cubeta.
  7. Establecer las condiciones de electroporación deseada en dispositivo: HSPCs humanos (1600 V, 10 ms, 3 pulsos) o ratón HSPCs (1700 V, 20 ms, 1 pulso).
    Nota: Si lo desea, antes de realizar experimentos en CD34 + HSPCs, sgRNA eficiencia puede probarse en líneas celulares de leucemia mieloide aguda (AML) (e.g. HL60) usando la misma estrategia (uso medio sin antibióticos para las líneas de células AML) con las siguientes condiciones de electroporación: 1350 V, ms 35, R, 1 pulso del almacenador intermediario.
  8. La electroporación se realiza con una pipeta especial electroporación, que tiene una garra que engancha en la punta de la pipeta de electroporación. Sostenga la pipeta de electroporación, extender la garra, agarrar el disco dentro de la punta de la pipeta y luego presione firmemente la pipeta hacia abajo para asegurarlo la punta.
  9. Pipetear la muestra arriba y abajo 10 veces para mezclar. Saca 10 μl, asegurándose de que no hay ningunas burbujas e inserte la punta de la pipeta directamente en el búfer electrolítico en la cubeta de electroporación. Trate de no tocar las paredes de la cubeta. Pulse "start" en la pantalla. Después aparece el mensaje "complete", quitar la pipeta y añada contenidos en bien con el nuevo medio de cultivo de la HSPC.
  10. Repita para todas las muestras. Puntas de pipeta de cambio entre las muestras, sólo si es necesario.

Representative Results

El objetivo de este protocolo es realizar nocaut (KO) en el gen de ratón y humanos HSPCs con Cas9 sgRNA RNPs. El flujo de trabajo es fácil y rápido y permite la realización de experimentos en menos de una semana de diseño experimental a la evaluación de la eficacia de KO.

En comparación con enfoques basados en el plásmido o el virus, el éxito de nuestro protocolo se basa en la combinación del sgRNA RNPs y electroporación. Esta estrategia de clonación-libre acorta significativamente el tiempo necesario para obtener los componentes para transfectar. Por otra parte, electroporación permite la transfección de hasta el 95% de las células, maximizar la entrega de la RNPs. sgRNAs puede ser sintetizado en el laboratorio a través de transcripción en vitro (IVT), mientras que la proteína purificada de Cas9 puede adquirirse en varias empresas ( Ver protocolo). plantillas de la DNA del sgRNA para IVT se obtienen realizando un corto PCR utilizando lo sgRNA primer Fwd (figura 1A, B) y el universal andamio Rev cartilla (figura 1B - ver protocolo). El producto PCR entonces se utiliza como plantilla para el IVT (figura 1). Complejos de RNP Cas9 sgRNA se generan el sgRNAs y el Cas9 de incubación de 15-30 minutos (figura 1). Finalmente, RNPs sgRNA son electroporated en las células. HSPCs editados pueden utilizarse entonces para llevar a cabo experimentos tanto in vitro e in vivo .

Interrupción del gene en células de ratón

Para demostrar la eficacia de la estrategia de electroporación Cas9 sgRNA RNP, c-kit + HSPCs aislados de ratones ubicuo expresando GFP o tdTomato han sido electroporated con sgRNA contra GFP o tdTomato. Entre los tres sgRNA diseñado contra GFP, GFP sg1 realizada más eficientemente, exhibiendo aproximadamente 70-75% trastorno de la expresión de GFP según lo determinado por citometría de flujo (figura 2A, B). Para cuantificar la frecuencia de interrupción del gene en el nivel genomic, se aisló ADN genómico de las células electroporated y T7 endonucleasa I-basado (T7EI) análisis fue realizado. Como se muestra en la figura 2, T7EI análisis detectó hasta a 60% indel formación. Tenga en cuenta que T7EI los ensayos tienden a subestimar las frecuencias de indels. También generamos sgRNA contra tdTomato y electroporated HSPCs tdTomato desde el locus Rosa26 de expresar. Como se muestra en la Figura 2D, tdTomato sg1 ablación eficaz la expresión de tdTomato.

Interrupción del gene en células humanas

Aquí, se muestra la interrupción eficiente obtenida con un enfoque único sgRNA a CD45, un marcador de superficie celular expresado en células hematopoyéticas. Tres sgRNAs a diferentes exones del CD45 fueron diseñados (CD45 sg1, sg2 y sg3). La eficacia de la sgRNAs fue probada en la línea de celular HL60 AML (Figura 3A). Proteína KO se evaluó por citometría de flujo 5 días después de la electroporación. Sg1 CD45 fue la más eficiente (98% KO eficiencia - Figura 3A) y fue utilizado para experimentos adicionales. Figura 3B muestra CD45 KO en primario humano CD34 + células progenitoras utilizando sg1 CD45, evaluados por citometría de flujo 5 días después de la electroporación. Mientras que la expresión de CD34 era inafectada, expresión de CD45 se perdió en alrededor del 80% de las células. retro-orbitally, 200,000 corregida principal células de CD34 + fueron transplantadas en ratones NSG 6 horas después de la electroporación. Células de bazo y médula ósea fueron cosechadas 3 meses después del trasplante. Células editadas (el positivo HLA-ABC, CD45 negativo, marcado en rojo) son detectables sólo en muestras sgRNA tratado y no en Cas9 sólo controles (figura 3).

Si lo desea, sgRNAs dos objetivos cerca de secuencias pueden utilizarse para generar deleciones. Este enfoque permite una rápida estimación de la eficacia de la edición con un PCR y a menudo produce una mayor eficiencia de la interrupción. Figura 3D muestra la generación eficiente de una canceladura de 58 puntos de ebullición en el exón 10 de DNMT3A. 200,000 editadas células de CD34 + fueron transplantadas en ratones NSG 6 horas después de la electroporación. La canceladura de 58 puntos de ebullición claramente fue detectado en la sangre periférica de ratones NSG implantadas 5 meses después de las inyecciones (figura 3E) confirmando la edición de células CD34 + con capacidades de injerto a largo plazo.

Figure 1
Figura 1: el enfoque rápido y sencillo para generar sgRNA RNPs. A) representación de lo sgRNA primer Fwd. SgRNA Fwd cebador es un oligonucleótido de ADN que contiene el promotor T7, la secuencia de protospacer y una secuencia de superposición con el andamio sgRNA. En el 3' final, resaltado en rojo, es la secuencia de "ATAGC" que debe añadirse a la secuencia de la cartilla de Fwd sgRNA obtenida en CRISPRscan. B) representación esquemática de la superposición PCR se realiza para obtener la plantilla IVT. El traslapo entre la sgRNA Fwd la cartilla y el primer Rev de andamio Universal permite la extensión y amplificación por PCR. C) historieta que describe la reacción de IVT y los sgRNA RNP pre-secuestrantes. El producto PCR purificado y utilizado como una plantilla para el IVT. IVT genera una alta cantidad de sgRNAs que puede ser utilizado en múltiples repeticiones (ver protocolo). RNPs sgRNA se generan incubando lo sgRNA purificado de IVT y la proteína Cas9 comprada anteriormente. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: interrupción eficaz de genes en células progenitoras hematopoyéticas de ratón. A) un sgRNA a GFP (GFP sg1) junto con proteína Cas9 fue electroporated en murine c-kit + HSPCs expresando GFP y analizadas por citometría de flujo 24 horas después de la electroporación. B) diferente cantidad de GFP sg1 fue complejado con 1 μg de proteína Cas9 y electroporated. Tan poco como 200 ng de GFP sg1 ablación eficaz expresión de GFP. C) T7EI análisis realizado en la DNA genomic aislada de células utilizadas en la A-B. PCR amplicones que abarca el sitio de la hendidura Cas9 sgRNA fue diluido 1:4 en 1 x Buffer 2 e hibridada lentamente en un termociclador. Hibridizada fragmentos entonces fueron digeridos con 1.25 U de T7 endonucleasa que durante 10 minutos a 37 ° C. Fragmentos digeridos fueron separados por electroforesis en gel de poliacrilamida. Intensidad de la banda fueron analizados utilizando el software ImageJ trazando intensidades de banda de cada carril. escote % se calculó mediante el cociente de las intensidades de las bandas hendidas a bandas uncleaved. D) c-kit + HSPCs aisladas de los ratones que expresaban tdTomato fue electroporated con proteína Cas9 complexed con sgRNA contra tdTomato. Citometría de flujo había realizada 24 horas después de la electroporación reveló que aproximadamente el 74% de las células de eliminar tdTomato. R26 = Rosa26. * p < 0.05, ** p < 0.01, *** p < 0.001. Esta figura ha sido adaptada de Gundry, et al. 6 Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: interrupción eficaz de genes en las células hematopoyéticas humanas. A) tres sgRNAs a CD45 (CD45 sg1, sg2 y sg3) fueron diseñados y probados en la línea de celular HL60 AML (véase protocolo de electroporación condiciones). 5 días después de la electroporación se realizó citometría de flujo. Sg1 CD45 fue seleccionado como el más eficiente entre los tres sgRNAs (KO eficiencia 98%). B) CD45 KO en humanos primarios sangre CD34 + HSPCs con CD45 sg1 de la cuerda. Puede detectarse pérdida de CD45 en aproximadamente un 80% de las células. Tenga en cuenta que la expresión de CD34 es sin cambios después de la edición. C) HSPCs humanas editado pueden ser eficientemente engrafted en ratones de la NSG. Células nucleadas humanas Mostrar la normal HLA + / CD45 + fenotipo en sólo Cas9 engrafted ratones, mientras que en ratones engrafted con CD45-sg1 tratados las células CD34 +, ambos HLA + / CD45 + y HLA + / CD45-poblaciones se observan indicando el engraftment de células CD45 KO humanas. D) gel de agarosa de 2% mostrando una canceladura puntos 58 generada por 2 sgRNAs (enfoque de doble guía) en el exón 10 de DNMT3A en HSPCs humanas de 3 diferentes sangre (CB1, CB2 y CB3). PCR fue realizada 3 días después de la electroporación. E) gel de agarosa 2% demostrando la persistencia de la supresión de bp 58 5 meses después del trasplante en los ratones NSG. Esta figura ha sido adaptada de Gundry et al. 6 Haga clic aquí para ver una versión más grande de esta figura.

Oligonucleótidos Secuencia de Nota
Primer andamio universal de Rev gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct Cartilla reversa universal para traslapo PCR
hCD45 sgRNA 1 taatacgactcactataGGTGCTGGTGTTGGGCGCACgttttagagctagaaatagc sgRNA Fwd secuencia de cartilla para el traslapo PCR
hCD45 sgRNA 2 taatacgactcactataGGGAGCAAGTGAGGATCCTCgttttagagctagaaatagc sgRNA Fwd secuencia de cartilla para el traslapo PCR
hCD45 sgRNA 3 taatacgactcactataGGGATGCTTGTTCCCTTCAGgttttagagctagaaatagc sgRNA Fwd secuencia de cartilla para el traslapo PCR
hDNMT3A Ex10 sg1 taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd secuencia de cartilla para el traslapo PCR
hDNMT3A Ex10 sg2 taatacgactcactataGGGTGGCCAGCAGCCGCGCGgttttagagctagaaatagc sgRNA Fwd secuencia de cartilla para el traslapo PCR
Rosa26 sgRNA taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd secuencia de cartilla para el traslapo PCR
Sg1 GFP taatacgactcactataGGGCGAGGAGCTGTTCACCGgttttagagctagaaatagc sgRNA Fwd secuencia de cartilla para el traslapo PCR
tdTomato sg1 taatacgactcactataGGGGTACAGGCGCTCGGTGGgtttaagagctagaaatagc sgRNA Fwd secuencia de cartilla para el traslapo PCR

Tabla 1: Completar secuencias de sgRNA Fwd iniciadores utilizados en los experimentos y cartilla Universal Rev.

Discussion

El enfoque de la RNP se describe en este protocolo detallado permite nocaut eficaz de genes en ratón y humanas primario las células hematopoyéticas, así como en líneas celulares de suspensión. Aunque a menudo se obtiene KO de eficiencia muy alto, varias variables críticas necesitan ser considerados. En primer lugar, exón correcta elección es clave para garantizar que indel eficiente incorporación corresponde a golpe de gracia del gene. Dos factores importantes relacionados con la elección de exón son conservación a través de isoformas y exón posición dentro de las transcripciones. Patrones de expresión de la isoforma son variables a través de tipos de la célula, por lo que si desea gen KO en los tipos de célula, la célula de los exones que son invariantes entre tipos deben dirigirse. Isoforma patrones pueden verificarse utilizando datos de secuencias de RNA o q-PCR. Para posición de exón en transcripciones, es mejor atacar tempranos exones como mutaciones del mutágeno ' frameshift ' en el terminal o penúltima exón escapen de decaimiento absurdo-mediado10, producción de proteínas con la novela o funciones desconocidas en lugar de verdaderos valores nulos.

Determinar el indel frecuencia es un paso crítico para estimar la eficiencia del KO y a interpretar correctamente el resultado biológico de la experiencia. Análisis de endonucleasas (e.g. análisis del topógrafo) tienen la ventaja de ser relativamente rápido y fácil de realizar. Sin embargo, tienden a ser inexactas debido a las señales de fondo significativo y los resultados a menudo son difíciles de reproducir. Además, no proporcionan información sobre la calidad de indels generado (por ejemplo longitud de inserciones y deleciones) en el experimento. Sanger secuenciación proporciona una valiosa alternativa a ensayos de endonucleasa. Plataformas como marea11 (https://tide.nki.nl/) ayudan a descomponer los rastros sanger y producir estimaciones precisas de la eficacia de interrupción alélicas, mientras que también proporciona las frecuencias de indels individuales. El mayor inconveniente es una dependencia absoluta de rastros de secuenciación de Sanger de alta calidad. Secuenciación de amplicones de alto rendimiento supera la mayoría de estas cuestiones. Bibliotecas de amplicon pueden prepararse a partir con muy bajos insumos de ADN y la alta cobertura garantiza resultados confiables. Para reducir el costo de la secuenciación de amplicones, nosotros generalmente spike en bibliotecas de amplicon en funcionamientos de la secuencia más grandes (p. ej. secuenciación del RNA) usando sólo 1-1.5% de la muestra total. Por último, para confirmar el exitoso golpe de gracia, fuertemente recomienda evaluar los niveles de proteínas por western blot o flujo cytometry, cuando sea posible.

Como se describió anteriormente, el método presentado aquí es rápido y sencillo y representa una nueva herramienta para el estudio de gene knock out en ratón y humanos HSPCs. Mientras que nuestro protocolo proporciona instrucciones para knockout de genes con un sistema de electroporación basados en punta, otros sistemas han demostrado para ser altamente efectiva12,13.

Dos limitaciones principales deben ser reconocidos en relación con el enfoque de la RNP. En primer lugar, según lo descrito por nuestro grupo, la viabilidad de electroporated de HSPCs con in vitro transcrito sgRNAs puede ser significativamente comprometida por electroporación, especialmente cuando las condiciones no son óptimas6. Si es necesario, sgRNAs comercialmente sintetizado (es decir, elimina en vitro transcripción) puede resolver este problema. Estos son cada vez menos costosos con el tiempo y se pueden comprar de varios proveedores. En este escenario, en vitro transcripción podría utilizarse para generar un pool de sgRNA a pantalla para eficacia, y entonces el sgRNA(s) más eficiente puede ser seleccionado para síntesis. La segunda limitación importante de la estrategia de la RNP es la incapacidad para seguir con éxito transfected las células, como en los enfoques basados en el viral. Sin embargo, la eficacia alta de KO y edición rápida con RNPs Cas9 sgRNA pueden compensar estos inconvenientes en muchos escenarios experimentales. Recomendamos utilizar productos de alto rendimiento de secuenciación para determinar exactamente la eficacia de interrupción en cada experimento. Si el knock out del gen de interés se espera que confieren un fenotipo proliferativo (es decir, reducido o aumentado proliferación comparado a las células de tipo salvaje), determinar la frecuencia de indel en varios puntos del tiempo permite evaluar si KO células someterse a enriquecimiento (es decir, indel frecuencia aumenta con el tiempo) o son competencia (es decir. indel frecuencia disminuye con el tiempo).

Realización de experimentos in vivo o in vitro para entender los efectos biológicos de pérdida de función del gen requiere los controles apropiados. Como se mencionó anteriormente, en vitro transcrito sgRNAs puede ser tóxico para las células, especialmente primario progenitor células6. Adicionalmente, roturas de doble cadena de DNA causados por Cas9 proteína pueden causar gene respuesta antiproliferativa independiente14. Por lo tanto, a menudo utilizan un número de control sgRNAs en experimentos CRISPR y recomendar un marcador de superficie celular expresado en el tipo de la célula, así como un segundo gene de la blanco que no se expresa.

Cultura a corto plazo de HSPCs humanas en presencia de citocinas aumenta el gen interrupción eficiencia6 y es necesaria para lograr alta eficiencia KO. Hemos encontrado 36-48 horas que el período ideal de cultura antes de la electroporación6. Después de la electroporación, las células pueden ser más cultivadas teniendo en cuenta que cuanto más la cultura mayor será el riesgo de perder capacidad de engraftment del multilineage. Por lo tanto, generalmente realizamos trasplantes 6 horas después de la electroporación y nunca más tarde de 24 horas después de la electroporación.

CRISPR/Cas9 ha mejorado dramáticamente la capacidad de los científicos para modificar con éxito el genoma de células de mamíferos. Haciendo la interrupción del gene más factible en células progenitoras hematopoyéticas primaria se predice para mejorar rápidamente los conocimientos científicos en el campo de HSPCs y enfermedades hematológicas. Lo importante, el protocolo descrito aquí es también posible generar simultáneamente varios nocauts con alta eficiencia, lo que permite el modelado de complejos paisajes genéticos, visto a menudo en enfermedades leucémicas.

Aunque los protocolos descritos en este documento se centran en la interrupción génica, pueden ser fácilmente adaptados para gene knock-en experimentos. Esto puede lograrse a través de la entrega conjunta de plantillas del oligonucleótido de cadena simple para reparación dirigida por homología6,13 (HDR) o a través de la transducción de células post-electroporación con vectores de AAV6 que contiene la plantilla de homología12. La capacidad de reparar o introducir mutaciones específicas en HSPCs facilitará nuevas estrategias terapéuticas para la terapia génica y el estudio ampliado de mutaciones de controlador de cáncer en AML y otras enfermedades hematológicas. Mientras que el HDR en HSPCs humanas ha sido exitoso6,12,13, ratón HSPCs han sido difíciles de editar usando esta estrategia6. Optimización de protocolos HDR en humanos y en particular en HSPCs de ratón le permitirá editar más específicos y el desarrollo de herramientas para rastrear las células editadas mediante etiquetado endógeno.

Por último, también se prevé que la interrupción de alelos del mutante de ganancia de función podría representar un enfoque terapéutico potencial para desordenes hematopoyéticos congénitas y adquiridas. En este escenario, se recomienda un enfoque libre de ADN para evitar integraciones posibles que podrían promover la transformación. Por otra parte, el enfoque de "hit and run" reduce la posibilidad de efectos no deseados fuera del objetivo. Se necesita más esfuerzo para desarrollar sistemas de entrega específicos que abriría nuevas vías para el tratamiento de enfermedades hematológicas malignas y no malignas.

Disclosures

Ningún conflicto de interés divulgar

Acknowledgments

Este trabajo fue apoyado por la prevención del cáncer y el Instituto de investigación de Texas (RP160283, RP140001 y R1201) Angel Foundation de Gabrielle para la investigación del cáncer, la Fundación Edward P. Evans y el NIH (DK092883, CA183252, CA125123, P50CA126752, CA193235 y DK107413). M.C.G. es apoyada por defensores de investigación Baylor para estudiantes científicos. Citometría de flujo fue parcialmente financiada por los NIH (Centro Nacional para recursos de investigación grant S10RR024574, Instituto Nacional de alergia y AI036211 de enfermedades infecciosas y el nacional cáncer Institute P30CA125123) de la Baylor College of Medicine Citometría y célula base de la clasificación.

Materials

Name Company Catalog Number Comments
Tissue culture plates according to cell numbers
1.5 ml Eppendorf microtubes Sigma Z606340-1000EA
50ml Falcon tubes Corning 352070
Nuclease Free Water - DEPC treated ThermoFisher Scientific AM9915G
KAPA HiFi HotStart ReadyMix (2X) KAPA Biosystems KK2600
MinElute PCR purification Kit Qiagen 28004
RNAse Zap RNAse Decontamination Solution ThermoFisher Scientific AM9780
RNA Clean and Concentrator-25 Zymo R1017
HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs E2040S
Alt-R S.p. Cas9 Nuclease 3NLS, 100 µg IDT 1074181
40 mm Cell Strainers VWR 352340
Dulbecco's Phosphate Buffered Saline (PBS) GenDEPOT CA008-050
Fetal Bovine Serum (FBS), Regular Corning 35010CV
AutoMACS Pro Separator or MACS manual Cell Separation columns Miltenyi
Neon Transfection System Device ThermoFisher Scientific
Neon Transfection System 10mL kit ThermoFisher Scientific MPK1025 For larger numbers of cells (see protocol) Neon Transfection System 100 mL kit (# MPK10025) can be used
Name Company Catalog Number Comments
UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific 15575020 For human experiments only
Lymphoprep Stem Cell Technologies 7851 For human experiments only
CD34 MicroBead Kit UltraPure human Miltenyi Biotec 130-100-453 For human experiments only
Stem Span SFEM II Stem Cell Technologies 9605 For human experiments only
Recombinant Human SCF Miltenyi Biotec 130-096-695 For human experiments only
Recombinant Human TPO Miltenyi Biotec 130-094-013 For human experiments only
Recombinant Human FLT3L Miltenyi Biotec 130-096-479 For human experiments only
Name Company Catalog Number Comments
Mouse dissection tools For mouse experiments only
Mortar and Pestle For mouse experiments only
Hank's Balanced Salt Solution (HBSS) Gibco 14170112 For mouse experiments only
Biotin-conjugated anti c-kit antibody eBioscience 13-1171-82 For mouse experiments only
Anti-Biotin MicroBeads Miltenyi Biotec 130-090-485 For mouse experiments only
X VIVO-15, with L-Glutamine, Genatmycin and Phenol Red Lonza 04-418Q For mouse experiments only
Mouse IL-6 Peprotech 216-16 For mouse experiments only
Mouse TPO Peprotech 315-14 For mouse experiments only
Mouse IL-3 Peprotech 213-13 For mouse experiments only
Mouse SCF Peprotech 250-03 For mouse experiments only

DOWNLOAD MATERIALS LIST

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, 816-821 (2012).
  2. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  3. Sternberg, S. H., Doudna, J. A. Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell. 58, 568-574 (2015).
  4. Heckl, D., et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 32, 941-946 (2014).
  5. Mandal, P. K., et al. Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell stem cell. 15, 643-652 (2014).
  6. Gundry, M. C., et al. Highly Efficient Genome Editing of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. Cell Rep. 17, 1453-1461 (2016).
  7. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012-1019 (2014).
  8. Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature methods. 12, 982-988 (2015).
  9. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Current protocols in immunology. 111, A3 B 1-3 (2015).
  10. Lykke-Andersen, S., Jensen, T. H. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol. 16, 665-677 (2015).
  11. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, e168 (2014).
  12. Dever, D. P., et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature. 539, 384-389 (2016).
  13. DeWitt, M. A., et al. Selection-free genome editing of the sickle mutation in human adult hematopoietic stem/progenitor cells. Sci Transl Med. 8, 360ra134 (2016).
  14. Aguirre, A. J., et al. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting. Cancer Discov. 6, 914-929 (2016).
Interrupción génica altamente eficiente de las células progenitoras hematopoyéticas murinas y humanas por CRISPR/Cas9
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).More

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter