Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Fare ve insan hematopoetik progenitör hücre tarafından CRISPR/Cas9 yüksek verimli Gene bozulma

doi: 10.3791/57278 Published: April 10, 2018
* These authors contributed equally

Summary

Bir iletişim kuralı için hızlı fare CRISPR/Cas9-aracılı gene bozulma ve insan birincil hematopoetik hücreler bu makalede açıklanan. Cas9-sgRNA ribonucleoproteins elektroporasyon ile vitro transkripsiyon ve ticari Cas9 ile oluşturulan sgRNAs ile tanıtılmaktadır. Yüksek Düzenleme verimliliği sınırlı zaman ve maliyet ile elde edilir.

Abstract

Hematopoetik kök hücre (HSCs) alanındaki gelişmeler yöntemlerle hayvan modelleri yanı sıra birincil progenitör hücrelerin genetik mühendisi destekli. HSCs tam gen ablasyon hangi HSCs izole olabilir ve birincil insan HSCs gen ablasyon mümkün değildi nakavt fareler nesil gerekli. Viral iletim knock-down yaklaşımlar için kullanılan olabilir, ancak bunlar değişken etkinlik acı. İnsan genel, genetik manipülasyon ve fare hematopoetik hücrelerin düşük verimleri ve geniş zaman ve maliyet taahhütleri ile engel oldu. Son zamanlarda, CRISPR/Cas9 memeli hücrelerinin DNA mühendislik yeteneği önemli ölçüde genişletti. Ancak, CRISPR/Cas9 uygulamaya hematopoetik hücreler, esas olarak onların düşük transfection verimliliği nedeniyle, plazmid tabanlı yaklaşımlar toksisite ve yavaş gerçekleştirme süresi virüs tabanlı iletişim kurallarının zor oldu.

CRISPR/Cas9-aracılı gen fare ve insan hematopoetik kök ve progenitör hücrelerin knockout verimliliği % 90 ile düzenleme yapmak için hızlı bir yöntem bu makalede sunulmaktadır. Bu yaklaşım kolaylaştırılmış bir üç günlük iş akışı ile bir Ribonükleoprotein (RNP) teslim strateji kullanır. Cas9-sgRNA RNP düzenlenen hücre genomu yok eksojen DNA dizileri tanıtan ve hedef kapalı etkileri azaltmak çarpıp kaçan bir yaklaşım için sağlar. Hızlı ve doğru sözlü RNP tabanlı yöntemi: Bu sgRNAs, virüs hazırlık veya belirli sgRNA kimyasal değişiklik klonlama gerektirmez. Bu iletişim kuralı ile bilim adamları başarıyla duruş Oligonükleotid sentezi için de dahil olmak üzere bir hafta içinde knockouts bir genin birincil hematopoetik hücrelerin ilgi oluşturmak gerekir. Bu yaklaşım kullanıcı kendi ihtiyaçları için bu protokolü adapte çok daha geniş grupları izin verir.

Introduction

CRISPR/Cas9 gelişiyle radikal memeli hücrelerde gen düzenleme basitleştirdi. Erken CRISPR/Cas9 protokolleri plazmid veya virüs alan teslim Cas9 protein ve sgRNA1,2,3kullanılmıştır. Bu yaklaşımlar hücresel ve hayvan modelleri geliştirilmesi için devrimci olduğunu kanıtladı ve birincil hematopoetik kök ve progenitör hücre (HSPCs)4,5' e de başarıyla uygulandı. Ancak, bu yöntemlerin sakıncaları bir dizi var. İlk olarak, gene bozulma verimliliği kez %504,5kalır. Bu hücre hatlarında nakavt (KO) klon üretmek için yeterli olmakla birlikte, kısa vadeli kültür için gerekliliğini HSPCs için böyle bir strateji değil mükellef yapar. İkinci olarak, klonlama için gereksinimin tek deneylerde test edilebilir ve üreten büyük, zor yapıları transfect için sgRNAs miktarını sınırlandırır. Üçüncü olarak, bu yaklaşımların teslimat süresini yavaşlatmak için bilim adamları zorlamak.

Bu sınırlamalar üstesinden gelmek için bizim grup geliştirilen ve son zamanlarda yayınlanan başka bir CRISPR/Cas9 yaklaşım Cas9-sgRNA ribonucleoproteins (RNPs) kullanarak HSPCs-teslimat6dayalı. Bu strateji, CRISPR raw bileşenleri (Cas9 protein ve vitro sgRNA transkripsiyonu) pre-complexed ve doğrudan hedef hücrelere elektroporasyon (şekil 1) yolu ile teslim. Cas9-sgRNA RNP kompleks half-life zaman daha kısa olduğu gibi bu plazmid veya viral nükleik asit sentezlenir, hedef kapalı oranı erken yaklaşımlar7' ye kıyasla daha düşük. Ayrıca, RNP yaklaşım herhangi bir kaynak rastgele hücresel dönüştürme için önde gelen hedef hücre genomu entegre edebilirler eksojen DNA'ın ortadan kaldırarak yararı ekler.

Bu iletişim kuralı RNP temel gen bozulma deneyler için kolaylaştırılmış bir iş akışı şekil 1' de temsil edilen temel alır. İlk adım tasarlama ve astar her sgRNA için sipariş. Bu astar vitro transkripsiyon (IVT) sgRNAs elde etmek için kullanılan sgRNA DNA şablonları yapmak için kullanılmaktadır. Saf sgRNAs sonra formu Cas9 sgRNA RNP kompleksleri için daha önce satın alınan Cas9 protein ile inkübe. Son olarak, pre-complexed Cas9-sgRNA RNPs electroporated hücre içine vardır. Elektroporasyon Düzenleme verimliliği test edilebilir ve vitro/vivo deneyler başlatılabilir, gereksinimlerine bağlı olarak. Bu yenilikçi deneysel yaklaşımla ayrıntılı bir açıklamasını bulabilirsiniz.

Protocol

Protokol Baylor College of Medicine insan Etik Komitesi kuralları izler. Fareler üzerinde yapılan tüm deneysel prosedürler Baylor College tıp kurumsal hayvan bakımı ve kullanımı Komitesi tarafından onaylanır.

1. sgRNA Fwd tasarım

  1. SgRNAs ilgi tasarlamaya başlamadan için http://www.crisprscan.org/?page=track8 ' e gidin.
  2. "Fare" veya faiz hücre türüne bağlı olarak "İnsan" düğmesini tıklayın.
  3. Faiz gen UCSC arama kutusuna girin ve git tuşuna basın.
  4. Yakınlaştırma ve gen bölgeye taşımak (i.e. belirli bir exon) hedef için ilgi olduğunu.
    Not: Bu hedefleme önerilir verimli gen bozulma elde etmek için tüm kopya etmek izoformlarının belirli hücre türü içinde en erken exon(s) mevcut.
  5. Potansiyel sgRNA hedef sıraları bir "CRISPRscan tahminler genler (CD)" altında listelenen sağlamak başlık.
  6. Bulmak ve bir hedef sıra nispeten yüksek bir skor ile tıklayın ve bazı kapalı-(parlak yeşil vurgulanır) hedefleri. "Oligo sıra" bölümünde görüntülenen tam sırası kopyalayıp, bir metin belgesi içine yapıştırın. "ATAGC" 3' dizisi için ekleyin. Bir kez tam, tam uzunlukta serisi için sipariş.
    Not: Her hedef sıra için CRISPRscan8 T7 organizatörü, protospacer (hedef) dizisi ve evrensel iskele örtüşme sıra içeren bir "entegre" ileri sgRNA astar sağlayan ( şekil 1A' ya bakınız). Tam uzunlukta bir sıra 56 ya da 57 nükleotit protospacer uzunluğuna bağlı olarak yapılır.

2. sgRNA DNA şablon sentezi

  1. Dağıtılması ve sgRNA ileri sar ve evrensel Rev astar (bkz. Tablo 1 için tam sırası) oranında seyreltin. 10 µM son konsantrasyonu elde etmek için üretici nasıl 100 µM için astar sulandırmak, sonra bir 1:10 yapmak izlemek belgili tanımlık öğretim seyreltme nükleaz ücretsiz su ile.
  2. PCR örtüşen gerçekleştirmek için aşağıdaki PCR şerit tüpler (bakınız şekil 1B), mix: 2 µL ileri sgRNA astar (10 µM), 2 µL evrensel Rev iskele astar (HPLC) (10 µM) saf, 10 µL yüksek sadakat DNA polimeraz ana mix (2 x) ve 6 µL nükleaz ücretsiz su.
  3. PCR ile aşağıdaki programı çalıştır: 3 dk, 5 için 98 ° C için 95 ° C s, 60 ° C 5 s, 10 72 ° C s, 2 git 6 döngüsü 72 ° C için 1 dakika, 4 ° C sonsuza kadar.
  4. DNA arıtma sütunları (reçetesi görmek tablo) kullanarak PCR ürünü arındırmak. Üreticinin yönergelerini izleyin ve elüsyon arabellek 11,5 µL ile elute.
  5. PCR ürünleri konsantre bir Spektrofotometre ölçmek. Elüsyon arabellek aletle boş.
    Not: DNA toplama ~ 50 ve ~ 120 ng/µL arasında olmalıdır.

3. sgRNA in Vitro transkripsiyon

  1. Aşağıdaki bileşenler PCR şerit tüpler (reaktifler RNA sentezi kit içinde sağlanır), mix: eluted DNA, dNTPs 4 µL, 10 x reaksiyon arabellek 1 µL ve T7 RNA polimeraz enzimi Mix 1 µL 4 µL.
  2. Örnekleri için en az 4 h 37 ° C'de kuluçkaya.
  3. RNase eldivenli elleri kaldırmak için RNase Temizlik maddesi uygulanır.
  4. Her RNA örnek nükleaz ücretsiz su ile 50 µL toplam hacmi kadar getirmek (üretici talimatları RNA arınma ilk adım).
  5. Kit tarafından sağlanan nükleaz ücretsiz su 50 µL içinde elute ve üretici talimatları RNA arıtma ile devam edin.
  6. Eluted sgRNA konsantre bir Spektrofotometre ölçmek. Nükleaz ücretsiz su aletle boş.
    Not: Beklenen arıtma sonra 50-80 µg RNA (yani konsantrasyon 1.0-1.5 µg/µL) verimidir.
  7. 2-4 µL-80 ° C'de aliquots uzun dönemli depolamak veya saf sgRNA hemen kullanın.

4. HSPC yalıtım ve kültür

  1. Fare HSPCs yalıtım ve kültür
    Not: Erkek ve dişi Ubc-GFP fare (JAX004353) ve Rosa26-LSI-tdTomato (JAX007914) Vav-iCre ile (JAX008610) 2-6 ay-in yaş geçti aşağıda gösterilen sonuçları elde etmek için kullanılmıştır.
    1. Servikal çıkığı aracılığıyla imzalat fareler ötenazi.
      Not: İki eğitimli kişiler bağımsız olarak solunum eksikliği işaret ederek başarılı ötenazi doğrulamanız gerekir ve en az 5 dakika süreyle kalp atışı hayvanlardan cilt kaldırın.
    2. Yırtılmalarıteşhis, uyluk ve iliyak armalar farelerin incelemek ve tüm kas ve bağ dokusu disseke kemikleri etrafında kaldırın. Yere sağlam kemik buzda bir doku kültürü çanak içine %2 ile desteklenmiş HBSS ile FBS (HBSS +). Laminar akış kukuIeta sürede kemikleri temizlenmiş ve doku kültürü yemek için transfer al olarak taşıyın.
    3. Temizlenmiş transferi içeren 2 mL steril harç için buz gibi HBSS + 3 kemik başına bones. Havaneli kullanarak, kemik iliği içinde serbest kemik parçalara ezmek. Kemiklerin altında havaneli çatlama durdurana kadar pestling devam edin.
    4. Süpernatant harç ve filtre bir 50 mL konik tüp bir 40 µm hücre süzgeç kullanarak toplamak. Kalan kemik parçaları ile 5 mL durulama buz gibi HBSS + ve filtre aynı 40 µm süzgeç kullanarak aynı 50 mL konik tüp içine.
    5. Hücreleri ile buz gibi HBSS + tüp kapalı Tepesi ve 400 x g 7 dk. atma süpernatant de centrifuging tarafından iki kez yıkayın.
    6. İkinci yıkama hücre Pelet buz soğuk PBS 20 mL resuspend. Hücrelerin trypan-mavi dışlama9sayı saymak.
    7. 1 mL başına 1 x 108 hücrelerin kuluçkaya buz gibi HBSS + 1: 100 seyreltme buz üzerinde 45 dk için c-kit antikor biotin Birleşik ile.
    8. Hücreleri ile buz gibi HBSS + 400 x g 7 min için de centrifuging ve süpernatant atarak yıkayın.
    9. Hücreleri Anti-biotin manyetik boncuklar üretici talimatları ile kuluçkaya.
    10. C-kit pozitif hücrelerinin manyetik sütunları veya manyetik aktif hücre sorters üretici talimatları kullanarak yalıtmak. C-kit pozitif hücrelerinin 15 mL konik tüpler toplamak.
    11. 15 mL konik tüp tepesi tarafından PBS iki kez hücrelerle yıkayın ve 400 x g 7 dakika süreyle de centrifuging süpernatant atın. Arasında iki yıkar trypan mavi dışlama9tarafından hücrelerin toplam sayısını hesaplayın.
    12. C resuspend-kit + %2 FBS, 50 ng/mL fare kök hücre faktörü (SCF), 50 ng/mL fare thrombopoietin (TPO), 10 ng/mL fare IL-3 ve 10 ng/mL fare Il-6 ile desteklenmiş fare HSPCs için kültür ortamının 100 µL başına en çok 106 viablecells bir konsantrasyon hücreleri.
    13. Hücreleri 37 ° c, % 5 CO2 en fazla 24 h elektroporasyon önce en az 1 h için kuluçkaya.
  2. İnsan HSPCs yalıtım ve kültür
    Not: Bu adımları bir laminar akış mahallede gerçekleştirilmelidir.
    1. Kemik iliği/kordon kanı hücreleri 40 µm hücre süzgeç aracılığıyla filtre.
    2. 1:2 süzülmüş kemik iliği/kordon kanı hücreleri ile 1 mM EDTA (PBS/EDTA) ile desteklenmiş PBS oranında seyreltin.
    3. Yoğunluk gradient orta 15 mL 50 mL konik tüp içine dağıtmak. Hafifçe sulandırılmış kemik iliği/kordon kanı 30 mL yoğunluk gradient orta yüzeyinde dökün. Hücre süspansiyon hacmi 30 mL büyükse birden çok tüpleri hazırlayın.
      Not: Kan ve yoğunluk gradient orta arasında arayüz gibi keskin tutmak için emin olun.
    4. Tüpler, 750 x g 30 dk için hiçbir yavaşlama ile spin.
    5. Orta 's arabirimi ve transfer tespit mononükleer hücre katmanı temiz 50 mL konik tüp toplamak. PBS/EDTA ile tüp doldurmak ve 280 g 15 dk. atmak için hücreleri süpernatant spin.
    6. Hücrelerde iki kez 400 x g 7 min için de PBS/EDTA iplik ve süpernatant atarak yıkayın.
    7. Mononükleer hücrelerin üretici talimatları anti-CD34 manyetik boncuklar ile kuluçkaya.
    8. Manyetik sütunları veya manyetik aktif hücre sorters üretici talimatları kullanarak ayrı tut moduyla CD34 + hücre. CD34 + hücre 15 mL konik tüpler toplamak.
    9. Yıkama CD34 + hücre iki kez PBS ile tüp kapalı Tepesi ve 400 x g 7 min için de iplik süpernatant atarak tarafından toplanan ve. Arasında iki yıkar trypan mavi dışlama9tarafından hücrelerin toplam sayısını hesaplayın.
    10. Kültür 100 ng/mL ile desteklenmiş orta hücrelerde resuspend insan SCF, 100 ng/mL insan FLT3 ligand (FLT3L), 100 ng/mL ~2.5 x 105 hücrelerin bir konsantrasyon, insan TPO / ml. Kültür izole hücreler CD34 + 37 ° c, en fazla 48 saat önceden için 24 h için %5 CO2 elektroporasyon için.
      Not: Elektroporasyon önce Akış Sitometresi tarafından zenginleştirilmiş CD34 + nüfus saflığı kontrol edin.

5. adım

Not: Aşağıdaki iletişim kuralı 10 µL elektroporasyon ipuçları için optimize edilmiştir. Tüm adımları bir laminar akış mahallede yapılmalıdır.

  1. Trypan tarafından hücreleri hesaplama dışlama9mavi. 2 x 105 hücrelerin Çoğalt (örneğin toplamak 6 x 105 hücreler için 3 electroporations) ücret toplamak.
  2. İki kez PBS de 300 x g 7 dk. ve dikkatle iplik, yıkama hücrelerle süpernatant kaldırın.
  3. Buna paralel olarak, Cas9-sgRNA RNP kompleksleri PCR tüpleri Cas9 tek denetim dışında her çoğaltma için toplam sgRNA RT 1.5 µg Cas9 ile 1 µg, 20-30 dk içinde kuluçka hazırlayın.
    Not: Cas9 protein 10 µg/µl konsantrasyonu sağlanır. Doğru pipetting emin olmak için Cas9 protein nükleaz ücretsiz su ile gerekli toplam miktarı 1:10 seyreltik (örneğin 10 electroporations için Cas9 protein 1 µl al ve 9 nükleaz ücretsiz su µl ile sulandırmak ve REPLICATE başına seyreltilmiş Cas9 1 µl kuluçkaya. SgRNA konsantrasyon bağlı olarak, Cas9 ve sgRNA toplam hacmi 1.7 ve 2 µl REPLICATE başı arasında oluşan. Eğer iki kullanarak sgRNAs kuluçkaya 500 ng her sgRNA başına çoğaltılır; Eğer 3 kullanarak sgRNAs kuluçkaya 330 çoğaltılır ve benzeri başına her sgRNA ng.
  4. Arabellek T 10 µL toplam sayısı ile çarpılarak gerekli çoğaltır resuspension hacmi (örneğin 30 µL 3 çoğaltır için) gerekli hesaplamak. Arabellek T. hücre süspansiyon son konsantrasyonu 2 x 107 hücre/mL olması hesaplanan hacmi ile pelleted hücreleri resuspend.
  5. Resuspended hücreleri/Çoğalt pre-complexed sgRNA/Cas9 RNP (pre-complexed Cas9-sgRNA içeren bir PCR tüp içine hücre süspansiyon, bir nüsha aliquot 30 μL için) içeren her PCR tüpün içine aliquot 10 µL.
  6. Kurmak için adım sistem araç üzerinde çevirin ve arabellek E bir elektroporasyon küvet içine 3 mL eklemek ve küvet küvet yuvasına kaydırın.
  7. İstenen elektroporasyon koşullar küme aygıtta: insan HSPCs (1600 V, 10 ms, 3 bakliyat) veya fare HSPCs (1700 V, 20 ms 1 darbe).
    Not: Arzu, CD34 + HSPCs, deneyler gerçekleştirmeden önce sgRNA verimliliği Akut Miyeloid Lösemi (AML) hücre hatları (örneğin HL60) aşağıdaki elektroporasyon koşullar ile aynı strateji (kullanım AML hücre hatları antibiyotik-Alerjik orta) kullanarak test edilebilir eğer: Arabellek R, 1350 V, 35 ms, 1 darbe.
  8. Elektroporasyon elektroporasyon pipet ucu sürgüler bir pençe vardır özel elektroporasyon pipet ile gerçekleştirilir. Elektroporasyon pipet tutun, pençe genişletmek, pipet ucu içinde belgili tanımlık yuvarlak yüzey kapmak ve güvenli aşağı pipet ucu sıkıca bastırın.
  9. Yukarı ve aşağı karıştırmak için 10 kez örnek pipette. Hava kabarcığı yok, olduğundan emin yapma 10 µL almak ve pipet ucu elektroporasyon küvet elektrolitik arabellekte doğrudan takabilirsiniz. Küvet duvarlar dokunmak deneyin. Ekranda "Başlat" tuşuna basın. "Tamamlandı" iletisi görüntülendikten sonra pipet kaldırmak ve yeni HSPC kültür orta ile kuyuya içeriği dağıtmak.
  10. Tüm örnekleri için yineleyin. Değişiklik pipet örnekleri arasında yalnızca gerekirse ipuçları.

Representative Results

Bu iletişim kuralı, gen nakavt (KO) fare ve insan HSPCs Cas9-sgRNA RNPs kullanarak gerçekleştirmek için hedeftir. İş akışı hızla ve deneyler tamamlanmasında bir haftadan az deneysel tasarım değerlendirmesi KO verimlilik sağlar.

Plazmid veya virüs dayalı yaklaşımlar karşılaştırıldığında, bizim iletişim kuralı başarısı sgRNA RNPs kombinasyonu ve elektroporasyon inşa edilmiştir. Bu klonlama-ücretsiz strateji önemli ölçüde transfect için bileşenleri almak için gereken süreyi kısaltır. Saf Cas9 protein-ebilmek var satın almak birkaç şirket () Ayrıca, elektroporasyon için hücreleri, % 95'e kadar transfection sağlar RNPs. sgRNAs teslimini en üst düzeye çıkarma vitro transkripsiyon (IVT) aracılığıyla laboratuarında synthetized olabilir protokol bkz.). sgRNA DNA şablonları IVT için kısa bir PCR sgRNA Fwd astar (şekil 1A, B) kullanarak performans elde edilir ve evrensel İskele yapısı-Rev astar (şekil 1B - Protokolü Bkz:). PCR ürünü daha sonra IVT (şekil 1 c) için şablon olarak kullanılır. Cas9-sgRNA RNP kompleksleri için 15-30 dakika sgRNAs ve Cas9 kuluçka oluşturulur (şekil 1 c). Son olarak, sgRNA RNPs electroporated hücre içine vardır. Düzenlenen HSPCs sonra vitro ve in vivo deneyler gerçekleştirmek için kullanılabilir.

Gene bozulma fare hücrelerinde

C Cas9-sgRNA RNP elektroporasyon strateji etkinliğini göstermek için-kit + ubiquitously GFP veya tdTomato ifade fareler izole HSPCs-si olmak be GFP veya tdTomato karşı sgRNA ile electroporated. GFP karşı tasarlanmış üç sgRNA arasında yaklaşık % 70-75 bozulma Akış Sitometresi (şekil 2A, B) tarafından belirlenen GFP ifade sergileyen GFP sg1 en verimli bir şekilde gerçekleştirilen. Genomik düzeyinde gene bozulma frekans ölçmek için electroporated hücrelerden genomik DNA izole edildi ve T7 endonükleaz-esaslı (T7EI) tahlil gerçekleştirildi. Şekil 2Ciçinde gösterildiği gibi T7EI tahlil % 60 Indel oluşumuna kadar algıladı. T7EI deneyleri indels frekansları hafife eğilimindedir unutmayın. Biz de sgRNA tdTomato ve electroporated HSPCs tdTomato Rosa26 odağı üzerinden ifade karşı oluşturulan. Şekil 2Bolarak gösterildiği gibi tdTomato sg1 verimli bir şekilde tdTomato ifade ablated.

Gene bozulma insan hücrelerinde

Burada, verimli bozulma CD45, hematopoetik hücreler üzerinde ifade bir hücre yüzey işaretçi hedefleme bir tek sgRNA yaklaşımla elde gösterilir. Üç sgRNAs farklı ekzonlar CD45 hedefleme tasarlanmış (CD45 sg1, sg2 ve sg3) vardı. SgRNAs verimliliğini HL60 AML hücre kültürünü (şekil 3A) test edildi. Protein KO 5 gün sonra elektroporasyon Akış Sitometresi tarafından değerlendirildi. CD45 sg1 en verimli (% 98'i KO verimliliği - şekil 3A) olup daha fazla deneyler için kullanılmamıştır. Şekil 3B CD45 KO CD45 sg1, 5 gün sonra elektroporasyon Akış Sitometresi tarafından değerlendirildi birincil insan CD34 + progenitör hücrelerin kullanarak gösterir. CD34 ifade etkilenmemiş iken, CD45 ifade hücreleri yaklaşık % 80 kayboldu. 200.000 düzenlenen birincil CD34 + hücre retro-orbitally 6 saat sonra elektroporasyon NSG fareler nakledilen. Kemik iliği ve dalak hücre nakli sonra hasat 3 ay vardı. Düzenlenmiş hücreler (HLA-ABC pozitif, CD45 olumsuz, kırmızı renkte) yalnızca tedavi sgRNA örnekleri ve Cas9 tek denetimleri (şekil 3 c) tespit vardır.

İsterseniz, iki sgRNAs hedefleme sıraları silme oluşturmak için kullanılabilir. Bu yaklaşım için dönüştürülür bir hızlı bir PCR ile Düzenleme verimliliği ve genellikle daha yüksek kesinti verimliliği. Şekil 3D DNMT3Aexon 10 58 bp silme verimli nesil gösterir. 200.000 düzenlenen CD34 + hücre çoğalmasıyla sonra 6 saat NSG fareler nakledilen. 58 bp silme açıkça 5 ay sonra enjeksiyonları (şekil 3E) CD34 + hücre uzun vadeli engraftment yetenekleri ile düzenleme teyit engrafted NSG farelerde periferik kanda tespit edilmiştir.

Figure 1
Şekil 1: sgRNA RNPs oluşturmak için hızlı ve kolay bir yaklaşım. A) sgRNA Fwd astar gösterimi. SgRNA Fwd astar T7 organizatörü, protospacer sıra ve sgRNA iskele ile bir çakışma sıra içeren bir DNA Oligonükleotid var. 3' kırmızı ile vurgulanacaktır, CRISPRscan üzerinde elde edilen sgRNA Fwd astar diziye eklenmesi gerekir "ATAGC" sıra sonudur. B) PCR gerçekleştirilen IVT şablonu edinmek için örtüşme şematik gösterimi. SgRNA Fwd astar ve evrensel iskele Rev astar arasında örtüşme uzantısı ve amplifikasyon PCR tarafından sağlar. C) IVT tepki ve sgRNA RNP pre-kompleks anlatan çizgi film. PCR ürünü saflaştırılmış ve IVT için şablon olarak kullanılabilir. IVT kullanılabilir sgRNAs yüksek miktarda birden çok çoğaltır (Protokolü Bkz:) oluşturur. sgRNA RNPs IVT ve daha önce satın alınan Cas9 protein saf sgRNA kuluçka oluşturulur. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2: fare hematopoetik progenitör hücre verimli gen bozulma. A) Cas9 protein ile birlikte GFP (GFP sg1) hedefleme bir sgRNA electroporated fare c içine yapıldı-GFP ifade ve Akış Sitometresi tarafından 24 saat sonra elektroporasyon analiz kiti + HSPCs. B) GFP sg1 farklı büyüklükte 1 µg Cas9 protein ve electroporated ile complexed. Kadar az 200 ng GFP sg1, verimli bir şekilde GFP ifade ablated. C) T7EI tahlil gerçekleştirilen genomik DNA izole--dan A-b'de kullanılan hücre üzerinde Cas9-sgRNA bölünme yerdi amplicon PCR kapsayan seyreltilmiş 1:4 içinde 1 x arabellek 2 ve Melez Termal cycler içinde yavaş yavaş. Melez parçaları sonra ile 1,25 T7 U endonükleaz sindirmek ben 37 ° C'de 10 dakika Sindirilir parçaları polyacrylamide Jel Elektroforez tarafından ayrı kaldık. Grup yoğunluklarda grup yoğunluklarda her Lane komplo tarafından ImageJ yazılımını kullanarak analiz edildi. % bölünme uncleaved grup cleaved şeritler şiddetlerde oranı tarafından hesaplanır. D) c-kit + tdTomato ifade fareler izole HSPCs oldu electroporated Cas9 protein ile sgRNA tdTomato karşı complexed. Akış Sitometresi 24 saat hücre yaklaşık % 74 tdTomato silinmiş elektroporasyon ortaya sonra gerçekleştirilen. R26 Rosa26 =. * p < 0,05, ** p < 0,01, *** p < 0,001. Bu rakam Gundry ve arkadapte edilmiş. 6 Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: insan hematopoetik hücrelerin verimli gen bozulma. A) üç sgRNAs CD45 hedefleme (CD45 sg1, sg2 ve sg3) tasarlanmış ve test HL60 AML hücre hattında (protokol elektroporasyon koşulları için bakınız). Akış Sitometresi 5 gün sonra elektroporasyon gerçekleştirildi. CD45 sg1 en verimli olarak üç sgRNAs (verimliliği % 98'i KO) arasında seçildi. B) CD45 KO birincil insan kordon kanı CD34 + HSPCs CD45 sg1 kullanarak. CD45 kaybı hücrelerin kabaca % 80 oranında tespit edilebilir. -Den sonra baskı CD34 ifade değişmeden olduğuna dikkat edin. C) Edited insan HSPCs verimli bir şekilde NSG fareler engrafted. İnsan çekirdekli hücreler görüntüler normal HLA +/ CD45 + fenotip salt Cas9 içinde engrafted fareler, CD34 + hücre, her iki HLA CD45-sg1 ile engrafted farelerde tedavi ise +/ CD45 + ve HLA +/ CD45-nüfus gözlenen engraftment insan CD45 KO hücre gösteren. D) 2 sgRNAs (çift Kılavuzu yaklaşım) 3 farklı kordon kanı (CB1, CB2 ve CB3) dan DNMT3A insan HSPCs içinde 10 exon tarafından oluşturulan 58 bp silme gösterilen % 2 özel jel. PCR 3 gün sonra elektroporasyon gerçekleştirildi. E) 5 ay sonra nakli NSG fareler içine 58 bp silme sebat gösteren % 2 özel jel. Bu rakam Gundry ve ark. adapte edilmiş 6 Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Oligonükleotid Sıra Not
Evrensel Rev iskele astar gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct Evrensel ters astar için üst üste PCR
hCD45 sgRNA 1 taatacgactcactataGGTGCTGGTGTTGGGCGCACgttttagagctagaaatagc sgRNA Fwd astar sıra örtüşme PCR
hCD45 sgRNA 2 taatacgactcactataGGGAGCAAGTGAGGATCCTCgttttagagctagaaatagc sgRNA Fwd astar sıra örtüşme PCR
hCD45 sgRNA 3 taatacgactcactataGGGATGCTTGTTCCCTTCAGgttttagagctagaaatagc sgRNA Fwd astar sıra örtüşme PCR
hDNMT3A Ex10 sg1 taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd astar sıra örtüşme PCR
hDNMT3A Ex10 sg2 taatacgactcactataGGGTGGCCAGCAGCCGCGCGgttttagagctagaaatagc sgRNA Fwd astar sıra örtüşme PCR
Rosa26 sgRNA taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd astar sıra örtüşme PCR
GFP sg1 taatacgactcactataGGGCGAGGAGCTGTTCACCGgttttagagctagaaatagc sgRNA Fwd astar sıra örtüşme PCR
tdTomato sg1 taatacgactcactataGGGGTACAGGCGCTCGGTGGgtttaagagctagaaatagc sgRNA Fwd astar sıra örtüşme PCR

Tablo 1: Tamamlamak sgRNA Fwd astar deneyler ve evrensel Rev astar kullanılan dizisi.

Discussion

Bu ayrıntılı iletişim kuralında tanımlanan RNP yaklaşım verimli gen nakavt fare ve insan birincil hematopoetik hücreler de olduğu gibi süspansiyon hücre hatları sağlar. Her ne kadar çok yüksek KO verimliliği kez elde edilen, çeşitli kritik değişkenler dikkate alınması gerekir. İlk olarak, uygun exon seçimdir verimli Indel birleşme gen nakavt için karşılık gelen garanti anahtar. EXoN seçim ile ilgili iki önemli koruma Tutanaklar içinde izoformlarının ve exon pozisyon karşısında faktörlerdir. İzoformu ifade desenleri değişken hücre türleri arasında Yani gen KO hücre türleri arasında isterseniz, sabit arasında ekzonlar hücre türleri hedef olmalıdır. İzoformu desenleri q-PCR veya RNA-sıralama verileri kullanarak doğrulanabilir. Exon pozisyonun Tutanaklar içinde sondan bir önceki exon saçma-aracılı çürüme10proteinler gerçek boş değerlere yerine roman veya bilinmeyen işlevleri ile üreten, kaçış olabilir veya frameshift mutasyonlar Terminal olarak erken ekzonlar hedeflemek en iyisidir.

Indel belirlemede önemli bir adım KO etkinliğini belirlemede ve deneme, biyolojik sonucunu doğru yorumlamak sıklığıdır. Endonucleases deneyleri (örneğin surveyor tahlil) nispeten hızlı ve gerçekleştirmek kolay olmanın avantajı var. Ancak, önemli arka plan sinyalleri nedeniyle yanlış olma eğilimi ve sonuçları çoğu kez yeniden oluşturulması zor. Ayrıca, onlar bilgi oluşturulan indels (örneğin uzunluğu eklemeler ve silmeler) deneyinde kalitesini sağlar. Sanger sıralama endonükleaz deneyleri için değerli bir alternatif sağlar. GELGİT11 (https://tide.nki.nl/) gibi platformlar sanger izlemeler ayrıştırmak ve allelic bozulma verimlilik, aynı zamanda bireysel indels frekansları sağlarken doğru tahminler üretmek yardımcı olur. En büyük dezavantajı yüksek kaliteli Sanger sıralama izlemeler üzerinde mutlak bir bağımlılık olduğunu. Yüksek işlem hacmi amplicon sıralama çoğu bu sorunların üstesinden gelir. Amplicon kitaplıklar çok düşük DNA girişleri ile başlayan hazırlıklı olmak ve yüksek kapsama güvenilir sonuçlar sağlar. Amplicon sıralama maliyetini azaltmak için biz genellikle amplicon kütüphanelerde toplam okuma yalnızca % 1-1,5 kullanarak daha büyük sıralama çalışmalarını (örneğin RNA-sıralama) spike. Son olarak, başarılı nakavt onaylamak için protein düzeyleri tarafından Batı lekesi değerlendirilmesi veya kesinlikle öneririz Akış Sitometresi, mümkün olduğunda.

Daha önce açıklandığı gibi burada sunulan yöntem hızlı ve doğru sözlü ve fare ve insan HSPCs gen darbe dışarı çalışmaya yeni bir araç temsil eder. Bizim iletişim kuralı elektroporasyon uç tabanlı sistemi ile gen nakavt için yönergeler sağlar iken, diğer sistemleri son derece etkili12,13olmak gösterilmiştir.

İki büyük sınırlamalar RNP yaklaşım ile ilgili kabul gerekir. İlk olarak, bizim grup tarafından açıklandığı gibi sgRNAs HSPCs electroporated In vitro ile canlılık transkripsiyonu çoğalmasıyla, özellikle koşulları en iyi6olmadığında önemli ölçüde tehlikeye girebilir. Gerekirse, ticari olarak sentezlenmiş sgRNAs (yani giderilmesi vitro transkripsiyon) bu sorunu aşmak. Bunlar zamanla daha ucuz hale geliyor ve çeşitli satıcılardan satın alınabilir. Bu senaryoda, vitro transkripsiyon sgRNA etkinliği için ekran için bir havuz oluşturmak için kullanılabilir ve daha sonra en verimli sgRNA(s) sentezi için seçilebilir. İkinci büyük RNP yaklaşım olduğu gibi viral tabanlı yaklaşımlar başarıyla transfected hücreleri izlemek için yetersizlik kısıtlamasıdır. Ancak, yüksek KO verimli ve hızlı düzenleme Cas9-sgRNA RNPs ile elde edilen bu sakıncaları birçok deneysel senaryoda baskın. Yüksek işlem hacmi amplicon sıralama bozulma verimliliği her denemede tam olarak belirlemek için kullanmanızı öneririz. Knock-out ilgi genin bir proliferatif fenotip (yani ya azaltılmış veya artan nükleer silahların yayılmasına karşı vahşi tipi hücrelere kıyasla) tanımak bekleniyor, birden fazla zaman Puan Indel frekans belirleme bir değerlendirmeye sağlayan hücreler olup KO zenginleştirme (yani Indel sıklığı artar zaman içinde) geçmesi veya outcompeted (i.e. Indel frekans azaltır zaman içinde).

İçinde vivo veya tüp bebek deneyler gen fonksiyon kaybı biyolojik etkileri anlamak için gerçekleştirmek için uygun kontrollerin gerekir. Daha önce belirtildiği gibi transkripsiyonu vitro sgRNAs hücrelere toksik olabilir, özellikle birincil progenitör hücrelerin6. Ayrıca, Cas9 protein tarafından neden DNA çift iplikli kırılmalara gen bağımsız anti-proliferatif yanıt14neden olabilir. Bu nedenle, sık sık kontrol sgRNAs bir dizi CRISPR deneylerde kullanın ve hücre türünün yanı sıra değil ifade ikinci bir hedef gen ifade bir hücre yüzey marker öneririz.

Sitokinler huzurunda insan HSPCs kısa vadeli kültür gene bozulma verimliliği6 artırır ve yüksek verimli KO sağlamak gereklidir. 36-48 saat önce elektroporasyon6kültürünün en ideal dönemi olarak bulduk. Elektroporasyon daha fazla kültürlü göz önünde bulundurarak hücreler olabilir bu artık kültür multilineage engraftment kapasite kaybetme yüksek riski. Bu nedenle, genellikle 6 saat sonra elektroporasyon ve 24 saat sonra elektroporasyon asla geç nakli gerçekleştirin.

CRISPR/Cas9 bilim adamları başarıyla genom memeli hücre düzenleme yeteneğini önemli ölçüde iyileşmiştir. Gene bozulma birincil hematopoetik progenitör hücre içinde daha uygun hale hızla HSPCs ve hematolojik hastalıklar alanında bilimsel bilgi geliştirmek için tahmin edilmektedir. Önemlisi, burada açıklanan protokol, ayrıca aynı anda bırakmak lösemik hastalıklarda sık görülen karmaşık genetik manzara modellenmesi için yüksek verimlilik ile birden çok altını gizleme oluşturmak olanak verir.

Her ne kadar burada açıklanan protokoller gene bozulma üzerinde duruldu, gen çakma deneyler için kolayca adapte olabilirler. Bu içeren AAV6 Vektörler ile tek iplikçikli Oligonükleotid şablonları homoloji yönetmen onarım6,13 (HDR) Co teslimini veya hücreleri post-elektroporasyon iletim yoluyla gerçekleştirilebilir homoloji şablon12. Onarım veya HSPCs belirli mutasyonların tanıtmak için yetenek gen terapisi ve kanser sürücü mutasyonların AML ve diğer hematolojik hastalıklar genişletilmiş bir çalışma için yeni tedavi stratejileri kolaylaştıracaktır. HDR insan HSPCs içinde başarılı6,12,13buradayken, fare HSPCs-si olmak be bu strateji6kullanarak düzenlemek zor. HDR protokolleri insan ve fare HSPCs'da özellikle duruma getirilmesi daha özel düzenleme ve geliştirme araçları düzenlenmiş hücreler endojen etiketleme kullanarak izlemek için olanak sağlar.

Son olarak, bu da mutant işlevi kazanç allelleri bozulma konjenital ve Edinsel hematopoetik bozukluklar için potansiyel bir tedavi yaklaşımı temsil edebileceği öngörülüyor. Bu senaryoda, DNA-Alerjik bir yaklaşım dönüşümü teşvik verebilecek olası entegrasyonlar önlemek için tavsiye edilir. Ayrıca, "hit ve koşmak" yaklaşım istenmeyen hedef kapalı etkileri azaltır. Daha fazla çaba kötü huylu ve kötü huylu olmayan hematolojik hastalıklar tedavi için yeni yollar açmak belirli dağıtım sistemleri geliştirmek için gereklidir.

Disclosures

Hiçbir ifşa etmek çıkar çatışması

Acknowledgments

Bu eser kanser önleme tarafından desteklenen ve Araştırma Enstitüsü (RP160283, RP140001 ve R1201), Teksas Gabrielle's Angel Foundation kanser araştırmaları, Edward s. Evans Vakfı ve NIH (DK092883, CA183252, CA125123, P50CA126752, için CA193235 ve DK107413). M.C.G. araştırma Baylor savunucuları tarafından öğrenci bilim adamları için desteklenir. Akış Sitometresi kısmen Baylor College of Medicine için NIH (Ulusal Merkezi araştırma kaynakları grant S10RR024574, ulusal alerji ve bulaşıcı hastalıklar AI036211 ve Ulusal Kanser Enstitüsü P30CA125123 Enstitüsü) tarafından desteklenmiştir Sitometresi ve hücre çekirdeği sıralama.

Materials

Name Company Catalog Number Comments
Tissue culture plates according to cell numbers
1.5 ml Eppendorf microtubes Sigma Z606340-1000EA
50ml Falcon tubes Corning 352070
Nuclease Free Water - DEPC treated ThermoFisher Scientific AM9915G
KAPA HiFi HotStart ReadyMix (2X) KAPA Biosystems KK2600
MinElute PCR purification Kit Qiagen 28004
RNAse Zap RNAse Decontamination Solution ThermoFisher Scientific AM9780
RNA Clean and Concentrator-25 Zymo R1017
HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs E2040S
Alt-R S.p. Cas9 Nuclease 3NLS, 100 µg IDT 1074181
40 mm Cell Strainers VWR 352340
Dulbecco's Phosphate Buffered Saline (PBS) GenDEPOT CA008-050
Fetal Bovine Serum (FBS), Regular Corning 35010CV
AutoMACS Pro Separator or MACS manual Cell Separation columns Miltenyi
Neon Transfection System Device ThermoFisher Scientific
Neon Transfection System 10mL kit ThermoFisher Scientific MPK1025 For larger numbers of cells (see protocol) Neon Transfection System 100 mL kit (# MPK10025) can be used
Name Company Catalog Number Comments
UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific 15575020 For human experiments only
Lymphoprep Stem Cell Technologies 7851 For human experiments only
CD34 MicroBead Kit UltraPure human Miltenyi Biotec 130-100-453 For human experiments only
Stem Span SFEM II Stem Cell Technologies 9605 For human experiments only
Recombinant Human SCF Miltenyi Biotec 130-096-695 For human experiments only
Recombinant Human TPO Miltenyi Biotec 130-094-013 For human experiments only
Recombinant Human FLT3L Miltenyi Biotec 130-096-479 For human experiments only
Name Company Catalog Number Comments
Mouse dissection tools For mouse experiments only
Mortar and Pestle For mouse experiments only
Hank's Balanced Salt Solution (HBSS) Gibco 14170112 For mouse experiments only
Biotin-conjugated anti c-kit antibody eBioscience 13-1171-82 For mouse experiments only
Anti-Biotin MicroBeads Miltenyi Biotec 130-090-485 For mouse experiments only
X VIVO-15, with L-Glutamine, Genatmycin and Phenol Red Lonza 04-418Q For mouse experiments only
Mouse IL-6 Peprotech 216-16 For mouse experiments only
Mouse TPO Peprotech 315-14 For mouse experiments only
Mouse IL-3 Peprotech 213-13 For mouse experiments only
Mouse SCF Peprotech 250-03 For mouse experiments only

DOWNLOAD MATERIALS LIST

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, 816-821 (2012).
  2. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  3. Sternberg, S. H., Doudna, J. A. Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell. 58, 568-574 (2015).
  4. Heckl, D., et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 32, 941-946 (2014).
  5. Mandal, P. K., et al. Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell stem cell. 15, 643-652 (2014).
  6. Gundry, M. C., et al. Highly Efficient Genome Editing of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. Cell Rep. 17, 1453-1461 (2016).
  7. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012-1019 (2014).
  8. Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature methods. 12, 982-988 (2015).
  9. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Current protocols in immunology. 111, A3 B 1-3 (2015).
  10. Lykke-Andersen, S., Jensen, T. H. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol. 16, 665-677 (2015).
  11. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, e168 (2014).
  12. Dever, D. P., et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature. 539, 384-389 (2016).
  13. DeWitt, M. A., et al. Selection-free genome editing of the sickle mutation in human adult hematopoietic stem/progenitor cells. Sci Transl Med. 8, 360ra134 (2016).
  14. Aguirre, A. J., et al. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting. Cancer Discov. 6, 914-929 (2016).
Fare ve insan hematopoetik progenitör hücre tarafından CRISPR/Cas9 yüksek verimli Gene bozulma
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).More

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter