Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Afgørende 3'-Termini og sekvenser af spirende enkeltstrenget Viral DNA molekyler i HIV-1 omvendt transkription i inficerede celler

doi: 10.3791/58715 Published: January 30, 2019

Summary

Her præsenterer vi en dyb sekventering tilgang, der giver en objektiv bestemmelse af spirende 3'-termini og mutationsmønstre profiler af enkeltstrenget DNA molekyler. Den vigtigste anvendelse er karakterisering af spirende retroviral supplerende DNAs (cDNAs), de mellemprodukter, der er genereret i løbet af processen af retroviral reverse transkription.

Abstract

Overvågning af nukleinsyre mellemprodukter under virus replikering giver indsigt i effekt og virkningsmekanisme af antivirale forbindelser og vært celle proteiner på viral DNA syntese. Her afhjælpe vi manglen på en celle-baseret, høj dækning og høj opløsning assay, der er i stand til at definere retroviral reverse transkription mellemprodukter inden for fysiologiske virusinfektion. Metoden beskrevet indfanger 3'-termini af spirende supplerende DNA (cDNA) molekyler i HIV-1-inficerede celler med enkelt nucleotid opløsning. Protokollen indebærer høst af hele celle DNA, målrettet berigelse af viral DNA via hybrid capture, adapter ligatur, størrelse fraktionering af gel rensning, PCR forstærkning, dyb sekvensering og dataanalyse. Et vigtigt skridt er den effektiv og fordomsfri ligatur af adapter molekyler til at åbne 3'-DNA termini. Anvendelse af den beskrevne metode bestemmer overfloden af reverse udskrifter af hver enkelt bestemt længde i en given prøve. Det indeholder også oplysninger om (interne) sekvens variation i omvendt udskrifter og dermed enhver potentiel mutationer. I almindelighed, er analysen egnet til spørgsmål vedrørende DNA 3'-udvidelse, forudsat at skabelon sekvensen er kendt.

Introduction

For at dissekere og forstår viral replikation fuldt, stadig mere raffinerede teknikker, fange replikering er mellemprodukter påkrævet. Især den præcise definition af viral nukleinsyre arter inden for rammerne af inficerede celler kan give ny indsigt, da mange virusreplikation mekanismer har til dato været undersøgt i isolerede in vitro- reaktioner. Et godt eksempel er processen med reverse transkription i retrovira, såsom human immundefekt virus 1 (HIV-1). De forskellige trin af HIV-1 omvendt transkription, hvorunder viral enzym reverse transkriptase (RT) kopierer enkeltstrenget RNA genom til dobbelt-strenget DNA, har været undersøgt primært i primer udvidelse assays med oprenset protein og nukleinsyre syrer1,2,3,4,5. Mens grundlæggende principper blev fastlagt, sådan assays indarbejde ikke alle viral og cellulær komponenter og kan ikke afspejle biologisk relevante stoichiometries af involverede faktorer. Derfor, vi har udviklet en effektiv teknik til at bestemme spektre af reverse transkription mellemprodukter med deres præcise cDNA 3'-termini (dvs. bestemmelse af deres nøjagtige længde) og nukleotidsekvenser i forbindelse med infektioner i levende celler6. Indsamling af data fra tid kursus eksperimenter kan udnyttes til at sammenligne profil af udskrifter under forskellige forhold, såsom tilstedeværelsen af antivirale molekyler eller proteiner, der kan påvirke effektivitet og processivity af DNA-syntese og ophobning. Dette giver mulighed for en mere detaljeret forståelse af naturlige patogen livscyklus, som ofte er grundlaget for en målrettet drug design og vellykket terapeutisk intervention.

HIV-1 omvendt transkription består af en række successive begivenheder initieret af Udglødning af en tRNA primer til skabelonen genomisk RNA, som derefter udvides af RT til at producere en kort enkeltstrenget cDNA udskrift kaldet et minus-strand stærk-stop (-sss) (jf. Figur 1). Efterfølgende - sss cDNA overføres fra 5'-lange terminal Gentag (LTR) til 3'-LTR af genomisk RNA, hvor det anneals og tjener som primer for fortsatte RT medieret brudforlængelse på minus strand DNA (Se anmeldelser på reverse transkription1 , 2 , 3 , 4). denne første strand overførsel er en af de hastighedsbegrænsende trin i reverse transkription; Derfor er - sss cDNA kendt at akkumulere. Den grundlæggende workflow og bibliotek design til at fange omvendt transkription produkterne i inficerede celler er skitseret i figur 2a. De specifikke primere og analyser indstillinger, der er brugt i protokollen og i tabel 1 anførte målrette alle tidligt reverse transkription cDNA mellemprodukter inden for længde rækkevidde af 23 til ~ 650 nt, som omfatter 180-182 nt - sss DNA. Dog vil passende mindre tilpasninger af strategien tillade programmet ikke kun slutningen reverse transkription produkter, men også andre vira og systemer, hvor målet er at opdage 3'-OH indeholdende DNA ender. Vigtige begrænsninger at overveje omfatter længde rækkevidde af den endelige PCR produkt i biblioteket; især vil skabeloner, hvor afstanden mellem adapter på åben 3'-terminus og webstedet opstrøms primer overstiger ~ 1000 nt sandsynligvis være mindre effektivt sekventeret, potentielt at indføre vildledende tekniske bias under bibliotek forberedelse ( Se diskussion for flere detaljer og tilpasning forslag).

Tidligere har rapporteret teknikker til systematisk bestemmelse af 3'-termini af nukleinsyre-strenge fokuseret på RNA, ikke DNA, molekyler. Et eksempel er 3' RACE (hurtige forstærkning af cDNA ender)7, som bygger på polyadenylation af mRNA. Derudover blev adapter ligatur-baserede strategier beskæftiger RNA ligases udviklet, som har medtaget RLM-RACE (RNA ligase-medieret RACE)8 eller blonder (ligering-baseret forstærkning af cDNA ender)9. Det er vigtigt at understrege, at ligatur-baserede klarlægger er følsomme over for enhver form for partiskhed indført ved ligatur reaktion, selv. For eksempel, kan ligatur være mere eller mindre effektiv afhængig af en bestemt nukleotidsekvens i positionen 3', sekvens, samlede molekyle længde eller lokale struktur. Sådanne ligase præferencer føre til ufuldstændig erobringen af molekyler og vildledning i udlæsning, som vi og andre har observeret9,10. For at minimere ligatur bias under adapter tilføjelse trin i protokollen beskrevet heri, vi har testet en række ligatur strategier og fandt brugen af T4 DNA ligase med en hårnål enkeltstrenget DNA adapter (som beskrevet af Kwok mfl. 11) at være den eneste procedure med nær kvantitative ligatur, der ikke resulterede i betydelige forskelle i ligatur effektivitet når vurderet med et specifikt udvalgt sæt af kontrol oligonukleotider6. Valget af denne ligatur strategi er derfor et centralt element i succesen af denne protokol.

Til dato, overvågning af HIV-1 RT progression i inficerede celler er primært opnået ved at måle reverse transkription produkter af forskellige længde med kvantitativ PCR (qPCR) ved hjælp af primer-sonde sæt, der entydigt måler kortere eller længere tid (tidlig og sent, henholdsvis) cDNA produkter12,13,14. Mens denne qPCR tilgang er hensigtsmæssig til bestemmelse iboende effektivitetsgevinster af reverse transkription proces i cellulære systemer, er output relativt lav opløsning, med ingen sekvens oplysninger at blive afledt. Vores nye tilgang, baseret på optimeret adapter ligatur, PCR-medieret bibliotek generation og dyb sekventering adresser teknologikløft og tilbyder mulighed for at overvåge reverse transkription i HIV-1 infektion kvantitativt og på single nucleotid opløsning.

Vi har illustreret nytten af denne metode i en undersøgelse, der skelnes mellem to foreslåede modeller for kapaciteten af HIV-1 begrænsning faktor APOBEC3G (apolipoprotein B mRNA redigering enzym katalytisk polypeptid-lignende 3G) til at blande sig med den produktion af viral omvendt udskrifter6.

Protocol

Bemærk: Der henvises til Tabel af materialer til specifikke reagenser og udstyr, der anvendes i denne protokol.

1. virus produktion og celle infektion

Forsigtig: Smitsomme HIV-1 bør kun håndteres i godkendte biosikkerhed indeslutning laboratorier.

Bemærk: Produktion af HIV-1 partikler af forbigående Transfektion af humane embryonale nyre (HEK) 293T celler, som beskrevet i trin 1.1, er en standard procedure og er blevet beskrevet tidligere15,16. Generelle cellekultur procedurer er beskrevet tidligere17.

  1. HIV-1 virus produktion.
    1. Opretholde 293T celler i Dulbeccos modificerede Eagle medium (DMEM) suppleret med 10% føtal bovint serum (FBS) og 1% penicillin/streptomycin (fuld DMEM) i en standard celle kultur inkubator ved 37 ° C og 5% CO2 som beskrevet tidligere17.
    2. I en standard laminar flow vævskultur hood fjerne vækst medier og tilsættes 3 mL pre varmede (37 ° C) trypsin til en nær sammenflydende 10 cm celle kultur parabol (~1.2 x 107 celler) af 293T celler. Sæt fadet tilbage i inkubator for 2-3 min.
    3. Tag skålen fra rugemaskinen tilbage i vævskultur hood og tilføje 7 mL af fuld medium. Pipetteres op og ned i skålen flere gange til resuspend cellerne. Opdel celler 1:4 ved at tilføje 2,5 mL af cellesuspension til en ny 10 cm parabol og fyld den med 7,5 mL af fuld medium.
    4. Den næste dag, mix 10 µg for proviral HIV-1 plasmid DNA (f.eks pNL4.3) med 1 mL serum-fri minimal afgørende medium og tilføje polyethylenimine (PEI) løsning (25.000 mW, 1 mg/mL pH 7) på 4,5 µL pr. 1 µg DNA. Der inkuberes i 10 min. ved RT og tilføje dråbevis til 293T celler.
    5. 24 timer efter Transfektion, fjerne medium og erstatte det med 6 mL af fuld DMEM indeholdende RNase-fri DNase på 20 U/mL medium. Efter 6 h, skal du erstatte mediet med 10 mL af fuld DMEM.
    6. 48 timer efter Transfektion, høste supernatanten og filtreres gennem et 0,22 µm filter, ved hjælp af en 10 mL sprøjte, ind i en 15 mL polypropylen rør.
    7. Tilsættes 2 mL sterilt 20% saccharose i 1 x fosfatbufferet saltopløsning (PBS) til en åben top tyndvæggede ultracentrifuge tube. Langsomt overlay saccharose med cellen filtrerede supernatanten.
    8. Der centrifugeres i 1 h 15 min på 134,000 x g ved 4 ° C ved hjælp af en ultracentrifuge.
    9. Fjerne rør fra ultracentrifuge omhyggeligt. Langsomt tag både supernatanten og saccharose ved hjælp af en suge eller en pipette. Brug en mindre pipette og vippe røret, når du tager den sidste rørsukkeropløsning. Forlade den pelleted virus i bunden af røret.
      Bemærk: Pellet vil ikke være synlig.
    10. Tilføje 200 µL 1 x PBS, forlader i køleskab til 4 til 12 h, resuspend og fryse i 20 µL alikvoter ved-80 ° C.
    11. Afgøre p24Gag indhold bruger de en p24 HIV-1 antigen ELISA kit (følgende producentens anvisninger).
  2. T-celle linje infektion.
    1. Kultur en udødeliggjort T-celle linje (fx., CEM-SS celler) i Roswell Park Memorial Institute (RPMI) 1640 medium suppleret med 10% FBS og 1% penicillin/streptomycin (fuld RPMI). Tælle celler ved hjælp af en hemocytometer18 og frø 1 godt pr. prøve med 1 mL af fuld RPMI med 2 x 106 celler/mL i en 12-godt format celle kultur plade.
    2. Tilføje HIV-1 partikler svarende til 150 ng p24Gag og sted plade i en swingende centrifugeres spand med biocontainment låg til spin-inficere ved centrifugering i en benchtop centrifuge for 2 h på 2.000 x g ved 30 ° C.
    3. Fjerne pladen fra centrifugen og lad det hvile i 1 time i en standard vævskultur inkubator ved 37 ° C og 5% CO2.
    4. For at vaske af input virus, indsamle celler ved at overføre celle suspensioner microcentrifuge rør og centrifugering i en microcentrifuge på RT (RT) ved 500 x g i 2 min. Tag supernatanten uden at forstyrre den celle pellet.
    5. Resuspend celle pellets i 1 mL af pre varmede (37 ° C), sterile 1 x PBS. Gentag centrifugering, supernatanten fjernelse og resuspension trin to gange mere.
    6. Centrifugeres igen, Fjern supernatanten og resuspend celle pellets i 1 mL af fuld RPMI. Tilføje hver suspension til en brønd i en ny 12 godt plade.
    7. På 6 h efter indledende tilsætning af virus (4 h efter centrifugering), skal du høste cellerne ved centrifugering, som gjort i trin 1.2.4. Fjern og kassér supernatanten. Celle pellets kan frosne ved-80 ° C eller forarbejdes direkte til DNA-ekstraktion.

2. DNA-ekstraktion, HIV-1 DNA kvantificering og berigelse af Hybrid Capture

  1. Uddrag hele celle DNA med en blod og væv samlede DNA udvinding kit ved at følge manualen kit for celler, væv kultur. Den eneste ændring er eluering i 200 µL af nukleasen-fri H2O i stedet for den medfølgende eluering buffer.
    Bemærk: Efter tilføjelsen af chaotropic lysisbuffer (kit's "AL buffer") og proteinase, prøver kan fjernes fra biosikkerhed indeslutning laboratorium og håndteres i en standard sikkerheds niveau laboratorium for resten af protokollen.
  2. Bestemme kopi antallet af HIV-1 cDNA ved qPCR.
    1. Tage 17 µL af eluatet fra trin 2.1 og tilføje 2 µL af 10 x begrænsning enzym buffer sammen med 1 µL af DpnI begrænsning enzym. Inkuber i 1 time ved 37 ° C til at fjerne enhver potentiel resterende input plasmid DNA fra Transfektion.
    2. Udføre qPCR for minus-strand stærk-stop cDNA ved hjælp af følgende primer sonde sæt: oHC64 (5 '-taactagggaacccactgc-3′) og oHC65 (5 '-gctagagattttccacactg-3′) og probe oHC66 (5 '-FAM-acacaacagacgggcacacacta-TAMRA-3′). qPCR setup og nøjagtige betingelser kan findes i henvisningerne6,13. Bære langs prøver med en seriel fortynding af pNL4.3 proviral plasmid som en standardkurven til at bestemme kopi numre af cDNA molekyler.
      Bemærk: Se diskussion for forventede mængder.
  3. HIV-1 DNA berigelse af hybrid capture.
    Bemærk: Fra dette skridt fremad er det at foretrække at bruge microcentrifuge rør med lav nukleinsyre bindende egenskaber samt aerosol filter pipette tips for alle DNA-prøver. Hvis det er muligt, arbejde i en PCR arbejdsstation. Alle trin og reagenser er på RT (RT) medmindre andet er angivet.
    1. For at forberede en master mix af magnetisk streptavidin perler, der afpipetteres 100 µL perler per prøve i et enkelt microcentrifuge rør. Placer røret på en magnet egnet til microcentrifuge rør.
    2. Når perlerne har udlignet mod magnet side af røret (~ 1 min), tage ud opbevaring buffer, fjerne røret fra magneten og resuspend perler i 500 µL af binde og vaske buffer (BW buffer, 5 mM Tris-HCL pH 7,5, 0,5 mM EDTA 1 M NaCl) at vaske.
    3. Placer røret tilbage på magnet, Fjern supernatanten og tilsættes 500 µL kasein løsning. Tage af magnet, resuspend og inkuberes i 10 min. ved RT, så vask med BW buffer.
      Bemærk: En vask refererer til markedsføring tuben magneten, afgang supernatanten, tager røret ud magnet, tilføjer bufferen, og resuspending.
    4. Placer røret tilbage på magneten, tage supernatanten og resuspend perler i 500 µL af BW buffer. Tilføje 50 pmol af hver fanger biotinylated oligonukleotider (Se tabel 1, tre oligos i dette tilfælde) pr. prøve. (For eksempel, hvis 5 DNA prøver behandles, bruge 500 µL af magnetiske perler fra trin 2.3.1 og 250 pmol af hver oligonukleotid).
    5. Inkuber i 30 min. ved RT mens vuggende i en over-slut mixer.
    6. Vask perler med de immobiliserede oligonukleotider to gange med 500 µL 1 x 10 buffer (10 mM Tris HCl pH 8.0, 1 mM EDTA, 100 mM NaCl).
    7. Resuspend perler i 10 µL 1 x 10 buffer pr. prøve.
    8. For hver prøve mærke et microcentrifuge rør og tilsæt 10 µL af perler suspension, 170 µL DNA (fra trin 2.1) og 90 µL af 3 x 10 buffer. Inkuber i en tør varme blok på 92 ° C i 2 min til at denaturere DNA.
    9. Flytte rørene til en anden tør varme blok, som er indstillet til 52 ° C, og Inkuber i 1 h. inverter for at blande regelmæssigt (~ hver 10 min) under denne inkubering.
    10. Vask en gang med 500 µL 1 x 10 buffer og resuspend i 35 µL nukleasen-fri H2O.
    11. For at eluere, Ruger rør på 92 ° C i en tør varme blok i 2 min. Derefter, hurtigt flytte rørene ind på magnet (en tube ad gangen). Når perlerne er bundet til siden af røret, overføre supernatanten indeholdende HIV-1 DNA til en frisk tube.
    12. Valgfrit: Gentag qPCR (som gjort i trin 2.2.2) til at bestemme den gendannede HIV-1 cDNA.
      Bemærk: Se diskussion for forventede mængder.

3. adapter ligatur

  1. Forberede adapteren
    1. Resuspend frysetørrede adapter (Se tabel 1 "fuld Kwok + MiSeq") på 100 µM i nukleasen-fri H2O.
    2. Per prøve plus én kontrolprøve, kombinere 0,45 µL af 10 x T4 DNA ligase buffer, 4 µL af adapter og 0,05 µL af nukleasen-fri H2O. varme til 92 ° C i 2 min og Lad køle ned langsomt.
      Bemærk: Hvis indstillingen er tilgængelig bruge en PCR-maskine med køling rentetilpasningslån (brug 2% sats). Det tager ca 30 min fra 92 ° C til 16 ° C. Alternativt kan du bruge en tør varme blok på 92 ° C og slukke. Tegne adapter mastermix, når den varme blok er tilbage på RT. Dette er at lade Overgangsstikket udgør en hårnål struktur (Se figur 2b).
  2. Forberede en kontrol reaktion med et sæt af syntetiserede oligonukleotider (Se tabel 2) i stedet for DNA ekstraheret fra celler.
    1. Gøre bestande af 100 µM af hver oligonukleotid. Bland 1 µL af hver af de 17 oligonucelotides og tilsæt 8 µL af H2O for et equimolar forhold i en endelige mængden af 25 µL.
    2. Fortyndes blandingen 1:2,500 i nukleasen-fri H2O i en seriel fortynding. Kombiner 1 µL af blandingen med 17,3 µL af nukleasen-fri H2O at bruge i kontrol prøve ligatur i trin 3.3.1, så hver oligonukleotid er til stede på 1,6 fmol (svarende til 0.026 nM i 60 µL reaktion).
  3. Opsætning af ligations
    1. For 60 µL endelige rumfang reaktioner i PCR rør kombinere 6 µL af 10 x T4 DNA ligase buffer, 24 µL af 40% PIND, 6 µL af 5 M betain, 4,5 µL (400 pmol) adapter (pre-annelead som i trin 3.1.2), 1,2 µL af T4 DNA ligase (2.000.000 enheder/mL) og 18,3 µL DNA (fra trin 2.3.11)
      Bemærk: Vær særlig forsigtig med tyktflydende løsninger som 40% PIND til at opretholde korrekte mængder. Gør ikke en mastermix.
    2. Oprette den samme reaktion, som udføres i trin 3.3.1 men med kontrol oligonukleotid blanding forberedt i trin 3.2.2.
    3. Bland Reaktionerne godt og Inkuber i et PCR-maskine på 16 ° C natten over.

4. adapter fjernelse og størrelse adskillelse

  1. Denatureringen gelelektroforese
    1. Tilføj 30 µL af formamid-holdige DNA gel loading bufferen til hver ligatur reaktion. Bland godt af pipettering.
    2. Varme i 2 min på 94 ° C i PCR-maskine, og derefter straks sætte på is.
    3. Placer en præfabrikerede 6% Borat-Tris-EDTA (TBE) denaturering urinstof polyacrylamid gel (10-well kam) i en passende gel tank. Tilføj 1 x TBE (89 mM Tris-base, 89 mM borsyre, 2 mM EDTA) kører buffer og pre Kør gelen i 20 min. på 250 V/max konstant.
    4. Udviske gel lommer med kører buffer ved hjælp af en sprøjte og 21G kanyle.
    5. Belastning hver 90 µL prøve til tre brønde (30 µL pr. brønd) og Kør i 20 min. (250 V/max) indtil mørk-blå farvestof front er omkring halvvejs gennem gel.
  2. Farvning og opskæring nukleinsyrer fra gel
    1. Forbered 3 små microcentrifuge rør (0,5 mL) pr. prøve ved at stikke huller i bunden ved hjælp af en 21 G sprøjte nål (Tag forsigtig mens du arbejder med klid). Sæt hver af de rede rør i en 2,0 mL microcentrifuge tube og mærke dem med prøven navn plus "lav", "mid" eller "høj".
    2. Tage og lirke åbne gel kassette. Skære gel lodret med et barberblad til generøst punktafgifter striben med 3 brøndene indlæst prøver. Tilføje gel strip til en container med 1 x TBE (ca. 30 mL) og 5 µL af cyanine nukleinsyre pletten. Inkuber i 3-5 min.
      Bemærk: Ekstraktionstrinet gel er særligt følsomme over for krydskontaminering. Det er tilrådeligt at kun køre 1 prøve pr. gel og ved hjælp af en separat ren beholder for hver gel farvning. Handsker bør ændres, hvis gel partikler kontakt behandskede fingre.
    3. Ren overfladen af en blå lys transilluminator grundigt med ddH2O. Tage gel stykke ud af farvning beholderen og føje det til boksen lys.
    4. Drej på lyskasse og inspicere de farvede nukleinsyrer gennem den orange filter.
      Bemærk: Adapteren typisk vises overbelastet og kører som store "blob" med sammenskrevne HIV-1 DNA kører over som et streg.
    5. Ved hjælp af en ny barberblad, skåret væk sider af gelen, hvis der er områder med ingen prøve indlæst stadig til stede. Næste, skåret lige over adapter til at fjerne adapteren og lavere gel dele. Endelig, skåret væk toppen af gel herunder ca 1 mm af gel lommer, som ofte har en skarp intens signal med højere molekylvægt DNA.
    6. Divider de resterende gel stykke indeholdende den prøve, som er typisk ~ 2 x 3 cm i størrelse, horisontalt i tre selv stykker: "lav", "mid" og "høj" molekylvægt områder.
      Bemærk: Hvert stykke vil nu blive behandlet separat [dvs., der vil være tre reagensglas (lav, mid og høj)] pr. oprindelige prøve.
    7. Skær hver af de tre gel fragmenter i mindre stykker (~ 2 x 2 mm partikler) og overføre dem til prepped 0,5 mL microcentrifuge rør (trin 4.2.1).
    8. Spin i topfart med åbent låg i 1 min. at presse gel stykker gennem hullet i 2 mL rør til at skabe en gel sjap. Hvis nogen gel partikler forbliver i bunden af 0,5 mL tube, overføre dem til 2 mL tube manuelt ved hjælp af en nål eller pipette tip.
  3. DNA-ekstraktion
    1. Der tilsættes 1 mL af urinstof gel ekstraktionsbuffer (0,5 M NH4CH3CO2, 1 mM EDTA, 0,2% SDS) til gel sjap. Rotere rør til et minimum af 3 h (natten er acceptabelt) på RT med en over-slut mixer.
    2. Brug en ren sæt pincet til at tilføje en lille runde glas fiber filter til centrifuge kolonner med celluloseacetat membranfiltre (0,2 µm), som undgår membran tilstopning. Sæt filteret på plads med en inverteret pipette spids.
    3. Kort spin 2 mL rør med gel sjap og udvinding buffer i en microcentrifuge og overføre 700 µL af supernatanten til kolonnerne rede filter. Holde gel sjap og resterende supernatanten.
    4. Der centrifugeres filter kolonnerne i en microcentrifuge på tophastighed i 1 min. overførsel af flowthrough til en ny 2,0 mL microcentrifuge tube.
    5. Genindlæse kolonner med de resterende supernatanten. Forsøge at få så meget væske som muligt fra udvinding sjap. Overførsel af gel stykker er ikke en bekymring. Spin igen og kombinere flowthroughs af de samme udvinding prøver.
  4. DNA nedbør
    1. Tilføje 3 µL af polyA RNA (1 µg/µL; som transportør), 1 µL af glykogen og 0,7 mL isopropanol til flowthrough fra trin 4.3.5. Vortex kort og fryse ved-80 ° C natten over.
    2. Udtage prøver af-80 ° C fryser og lad dem tø kort. Læg dem i et afkølet (4 ° C) microcentrifuge og spin i 30 min. i topfart.
    3. Fjern og kassér supernatanten. Være meget omhyggelig med ikke at fjerne pelleten. Forlade 30 til 50 µL af væske, hvis det er usikkert at pellet ville blive fjernet, ellers.
      Bemærk: Typisk alle "høj" prøver viser en mere synlig pellet end "mid" og "lav" prøver.
    4. Tilføje 800 µL 80% ethanol. Invertere rør og spin igen i 1 min i topfart. Fjerne fleste af ethanol med en pipette, kort spin rør igen og fjerne mere ethanol med en mindre volumen pipette.
    5. Lad enhver resterende ethanol fordampe ved at placere rør med en åben låget til en 55 ° C tør varme blok. Når prøverne er tør (2-4 min) tilføje 20 µL af nukleasen-fri H2O og spredt rundt i bunden af røret at sikre DNA pellet opløses. DNA-prøven kan opbevares ved-20 ° C.

5. PCR-amplifikation og bibliotek forberedelse

  1. Oprette en 40 µL PCR reaktion med 20 µL DNA polymerase pre-mix, 18 µL af udfældet og redissolved DNA fra trin 4.4.5, 1 µL af fremad primer "MP1.0 + 22HIV" (10µM) (Se tabel 1), og 1 µL af multiplex oligo primere (indeks primere 1 til 24) (Se tabel af Ma vedrørende).
    Bemærk: Kør indekseret de tre reaktioner (low, mid, high) af hver prøve i separate PCR reaktioner, men med samme primer. Bruge et andet indeks for hver af de oprindelige infektion prøver.
    1. Køre PCR-reaktionerne på følgende betingelser: 2 min på 94 ° C denaturering, så 18 cyklusser af 3-trins PCR; 15 s på 94 ° C denaturering, 15 s udglødning på 55 ° C og 30 s udvidelse på 68 ° C.
  2. Som en mulighed for kvalitetskontrol, analysere PCR reaktioner med høj følsomhed automatiseret gel elektroforese system. Tage 2 µL af en lav, mid og høj prøve at køre som pr fabrikantens anvisninger.
    Bemærk: De to primere skal være synlige og ofte køre ved en beregnede længde på omkring 45 og 95 nt (faktiske længde afviger). Derudover DNA registreres mellem 150-500 nt. Hvis ingen signal er til stede, er det tilrådeligt at tilføje yderligere PCR cykler, mellem 2 og 10 yderligere cykler. Må ikke tilsættes yderligere cykler for oligonukleotid kontrolprøver skabt taktfast 3.3.2.
  3. Hvis du vil fjerne bruge primere en Paramagnetiske perle-baserede PCR oprydning system.
    1. Tage 20 µL af hver PCR reaktion og samle prøver sammen (Bland alle prøverne på dette tidspunkt). Fryse de resterende 20 µL reaktioner som sikkerhedskopier ved-20 ° C.
    2. Lad Paramagnetiske perlerne kommer til RT og bland de poolede PCR reaktioner med 1,8 x mængden af perle løsning. Mix af pipettering og Inkuber i 5 min.
      Bemærk: Som et eksempel, hvis 4 prøver blev forberedt og hver har lav, mid og høj reaktioner, lydstyrken ville være 4 x 3 x 20 µL = 240 µL PCR reaktioner med en 432 µL perle løsning.
    3. Sætte rørene på et microcentrifuge tube magnet, lad perlerne binde for ~ 1 min., og tage af supernatanten kassere. Forlade rørene på magneten og tilsættes 500 µL 80% ethanol.
    4. Forlade ethanol til 30 s, derefter tage grundigt og lad perler airdry for ~ 5 min. tilføje 40 µL af nukleasen-fri H2O, tage rør off magneten, og pipetteres op og ned flere gange.
    5. Forlade suspension for 5 min. Læg tuben tilbage på magneten, lad perlerne bosætte sig til side, og overføre supernatanten til en ny tube. Dette er biblioteket. Tag en 10 µL alikvot for kvalitetskontrol og fryse resten ved-20 ° C.

6. evaluering af biblioteket

  1. Bestemme bibliotek kvalitet, koncentration og molariteten.
    1. Brug en metode, fluorometriske kvantificering. Måle 1 µL og 3 µL af biblioteket med en høj følsomhed dsDNA assay kit ifølge producentens anvisninger.
      Bemærk: Typiske koncentrationer er mellem 1 og 10 ng/µL.
    2. Foranstaltning bibliotek DNA molekylvægt spektrum af høj følsomhed automatiseret gelelektroforese som beskrevet ovenfor (trin 5.2).
    3. Brug den automatiske gel elektroforese analyse for at fastslå den gennemsnitlig molekylevægt på biblioteket og beregne for at fortynde bibliotek i nukleasen-fri H2O 4 nM. Flere biblioteker kan kombineres, så længe alle indeks er unikke.
  2. Valgfri lav dataoverførselshastighed kvalitetskontrol
    1. Underlagt biblioteket DNA TA kloning19 at indsætte bibliotek molekyler i vektorer for forstærkning. Følg kit's instruktioner, som vokser ud ~ 10-20 kolonier og ekstrakt DNA via miniprep protokoller, som beskrevet her20.
    2. Sekvens vektor ved hjælp af lokale Sekventeringen services og check at indsætter indeholder de ønskede HIV-1 afledt sekvenser og dokumentbiblioteksspecifikke adaptere.

7. høj overførselshastighed sekventering Run

  1. Oprette en sekventering sample ark med kommerciel software, der leveres med sekventering platform.
    1. Angiv den valgte sekventering kit. Typisk, vælge en 150-cyklus kit, men andre er egnet afhængigt af den ønskede Læs længde.
    2. Vælg "Fastq" som program arbejdsproces. Vælg en af de skabeloner, der indeholder 24 indeksene i multiplex oligonukleotid kits (angivet i kit manual).
    3. Vælg "25 nt" for Read1 og "125 nt" for Read2. Hold 6 nt for enkelt indeks læse.
      Bemærk: I den interne analyse kun Read2 anvendes i analysen. Holde Read1 på et minimum 25 nt til sekvensering platform algoritme formål.
  2. Følg producentens anvisninger netop for pre-opstille bibliotek forberedelse og opsætning. Vælge de maksimale 20 pM koncentration og bruge en 15% PhiX spike, som biblioteket er af meget lav kompleksitet.

8. dataanalyse

  1. Kontrollere hvis pass filter procentdel og gennemsnitlige Q30 kvalitetsresultat kan accepteres som pr sekventering platform producentens retningslinjer.
    Bemærk: Pass filter er typisk > 90% og Q30 scorer er typisk > 80%.
  2. Download den. fastq.gz filer fra producentens sekventering hub.
  3. Opsætning af scriptet sekventering
    1. Opret en ny mappe (mappe) opkaldt "AnalysisXYZ" og gå til https://github.com/malimlab/seqparse at hente alle kildekodefiler (parse_sam.pl, rc_extract.pl, parse.sh) ind i denne mappe.
    2. Download kort-Læs aligner Butterfly, version 1.1.2, fra http://bowtie-bio.sourceforge.net/index.shtml til den samme mappe.
    3. Download opretter en undermappe i "AnalysisXYZ" navngivne "Butterfly-1.1.2". Inden for denne mappe åbne undermappe "indeks" og hente de medfølgende skabelon sekvenser består af 6 filer med filtypenavnene .ebwt.
    4. Download FASTQ/A kort læser forbehandling toolkit fastx-0.0.13 fra http://hannonlab.cshl.edu/fastx_toolkit/download.html i mappen "AnalysisXYZ".
    5. Download Samtools (https://sourceforge.net/projects/samtools/files/) og bam-readcount (https://github.com/genome/bam-readcount) i mappen "Dokumenter".
  4. Flyt den. fastq.gz filer, har hentet i trin 8.2, af alle læse 2s (slutter i... _R2_001.fastq.gz) i mappen "AnalysisXYZ".
  5. Åbne kommando konsollen/terminalen. Flyt til "AnalysisXYZ" som den aktuelle mappe ved hjælp af cd-kommandoer. Skriv "./parse.sh." til at køre scripts.
  6. Find .csv-filerne med resuméer for alle prøver på samlede Læs tæller, længde justeres læse tæller, og normaliserer Læs tæller, samt filer med base variation, for hver prøve i en mappe med navnet parse_results i mappen "Analyse XYZ".
    Bemærk: Se diskussion for yderligere information om analyse proces. Scriptet returnerer CSV-filer med samlede læser for hver nukleotid langs HIV-1NL4.3 stærk-stop sekvenser og første strand overførsel indtil nukleotid 635. Som en vejledning, er 50.000 til 100.000 unikke læser typisk observeret i prøver fra infektioner med den angivne celle numre og viral inocula og uden antivirale proteiner eller forbindelser. Oligonukleotid kontrolprøve producerer normalt 100.000 til 200.000 læser.

Representative Results

Den teknik, der er beskrevet i denne artikel blev anvendt på en bredere undersøgelse for at tage fat på de underliggende hæmning af HIV-1 omvendt transkription af antiretroviral menneskelige protein APOBEC3G (A3G) mekanismer6. Figur 3 viser repræsentative resultater, der opnås efter beskæftiger protokol i prøver fra CEM-SS T-celler inficeret med vif-mangelfuld HIV-1 i fravær eller tilstedeværelse af A3G. Det samlede antal unikke læser fremstillet af hver prøve efter frafiltrere enhver PCR dubletter, der har de samme 6 nt stregkode og samme længde (udført af analyse software leveret) er afbildet i figur 3en. Stigende niveauer af A3G reducere den samlede Læs tal afspejler den hæmmende effekt af A3G på RT medieret cDNA syntese tidligere beskrevet og målt af qPCR6,13,21,22. I figur 3bvises nt brøkdel af molekyler på hver muligt længde inden for de første 182. For HIV-1 infektion i mangel af A3G, den mest rigelige arter er de vigtigste 180 nt stærk-stop molekylet selv, med nogle ophobning af læser i den kortere rækkevidde (23-40 nt) (top graf, blå histogrammer). Tilsætning af A3G ændringer denne profil som en skarp stigning af kortere, afkortet cDNA molekyler på et par meget specifikke, reproducerbare positioner er registreret (midterste og nederste grafer). Da A3G er en cytidine deaminase, cytosin til uridine (identificeret som C til T) opstår mutationer i cDNA når A3G er til stede i de inficerer virioner21,23,24. Ved hjælp af opnåede sekventering oplysningerne, var procentdelen af C til T mutationer afbildet på den samme graf (røde stiplede linje). Det skal bemærkes, at den mutationsmønstre profil er afledt fra alle unikke læser kombineret og dækningen af hver nukleotid vil variere. Dog, hvis det kræves sekvens oplysninger kan relateret tilbage til hvert molekyle og korreleret med en specifik 3'-terminus. Oplysningerne blev taget fra Pollpeter et al. 6 og sammenhængen mellem mutationsmønstre og cDNA længde profiler var vist sig for at være på grund af opdagelse og spaltning af deaminated cDNA af cellulære DNA reparation maskiner.

En positiv kontrol i 3'-mapping tilgang kan nemt fremstilles ved forarbejdning af en pulje af syntetiske oligonukleotider af kendte rækkefølge, længde og koncentration. Dette kontrolelement er tilføjet på adapteren ligatur i trin 3.3.2 og rådes til at være inkluderet i alle multipleksede biblioteker. Data fra en kontrolprøve bør have alle oligonukleotider på det forventede input nøgletal, med kun meget små baggrund læser. Figur 4 viser resultaterne af en positiv kontrol sæt 17 kemisk syntetiseret oligonukleotider (for sekvenser, se tabel 2), som blev blandet på equimolar nøgletal. Som forventet, vises alle molekyler i nærheden lig overflod med kun små variationer (øverste graf). Mens de fleste stillinger inden for - sss DNA sekvens, der ikke blev repræsenteret af en oligonukleotid returnerer nul Læs tæller, observeret vi mindre arter, der er 1 eller 2 nt kortere end de faktiske kontrol oligonukleotider. Vi har ikke yderligere undersøgt disse mindre arter, men antager, at de repræsenterer forringet eller ufuldstændig produkter potentielt til stede i de medfølgende oligonukleotid bestande på køb (oligonukleotider blev bestilt som HPLC renset, for hvilke den fabrikanten angiver > 80% renhed). Den nederste graf viser kontrolprøve fra et andet bibliotek køre, hvor variation er lidt højere placeret mellem de 17 oligonukleotider og korrelerer med længde, længere kontrol molekyler er opdaget mere effektivt så kortere ones. Dette kan skyldes en mindre bias i PCR reaktioner eller i klynger i MiSeq sekventering, som har en Indsæt størrelse optimal og kan forekomme med biblioteker transporterer særlig bredt Indsæt intervaller. En grundlæggende måde at løse denne bias er anvendelsen af en normalisering faktor baseret på skråningen, der angiver bias korrelerede til molekyle længde (lyserøde linje). De nødvendige beregninger er inkluderet i programmet analyse (Se trin 8.3 i protokollen).

Figure 1
Figur 1: Diagram, der viser de første trin i HIV-1 omvendt transkription. Processen starter med Udglødning af tRNA(Lys,3) (orange) til primer bindingssted (PBS) i det genomisk viral RNA (trin 1), som giver mulighed for indledningen og brudforlængelse af viral cDNA (blå, trin 2). Samtidig, er den skabelon genomisk RNA nedbrudt af RNaseH aktivitet af RT (trin 3). Den første fulde mellemprodukt i processen med reverse transkription er det minus-strand stærk-stop (-) sss cDNA, der er fuldført, når RT katalyseret polymerisering når 5'-endestationen for gRNA Gentag (R)-regionen (trin 3). (-) Sss mellemliggende overføres til 3'-terminalen af genomisk RNA skabelonen ved glødning til supplerende 3'-lange terminal Gentag (LTR) R-regionen. Herfra fortsætter polymerisation (trin 4). I den beskrevne metode bestemmes reverse transkription progression ved at kortlægge den præcise længde af den spirende viral cDNA (blå). PPT, polypurine tarmkanalen; U5, unikke 5'-sekvens; U3, unikke 3'-sekvens. Dette tal er genudgives fra en tidligere publikation6. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : Arbejdsproces disposition og skemaer adapter ligatur og PCR forstærkning strategi. a workflow skitserer vigtigste trin i den beskrevne teknik til at bestemme 3'-termini af HIV-1 omvendt udskrifter i inficerede celler. Tallet er tilpasset fra en tidligere publikation6. b skematisk adapter ligatur og PCR forstærkning strategi. Spirende cDNA molekyler af varierende længde, der er blevet renset i forrige trin er forbundet til en enkeltstrenget DNA adapter ved hjælp af T4 DNA ligase. Overgangsstikket hårnål (navngivet "fuld Kwok + MiSeq", se tabel 1) design blev inspireret af Kwok mfl. 11. adapteren bærer en tilfældig 6 nt stregkode sekvens, som giver mulighed for base-parring for at lette ligatur og samtidig fungerer som et id for entydigt læser. 3'-termini adapterens bærer en spacer (SpC3) at forhindre selvstændige ligatur. Sammenskrevne produkter er adskilt fra overskydende adapter ved denaturering polyacrylamid gelelektroforese (side). Nukleinsyrer i gelen er plettet og skåret i tre separate, lige-størrelse gel stykker i området fra ovenstående adapter til brønden, som gjort i25. Efter eluering, nedbør og resuspension, produkterne er PCR forstærket med primere udglødning til den kendte sekvens af adapter (primer 1, multiplex oligonukleotid kit, se Tabel af materialer) og en primer transporterer de første 22 nt af HIV-1 5'-LTR sekvens umiddelbart efter tRNA (primer 2, MP1.0 + 22HIV). 5'-termini af de valgte primere bære adaptere til den valgte sekventering platform (P5 og P7) samt en indeks sekvens skelne enkelte køre i den samme bibliotek. Udgangspunkterne for Sekventeringen læse primere er angivet. Blå boksen angiver område af interesse at bestemme de oprindelige 3'-termini erobrede molekyle. Dette tal er tilpasset fra en tidligere publikation6. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Repræsentative resultater. a den samlede Læs optælling af repræsentative prøver behandles med den beskrevne protokol. Dette omfatter alle sekvenser, der blev identificeret som unikke læsninger af HIV-1 molekyler med deres 3'-termini inden for de første 635 nt af minus streng cDNA (op til PPT, se figur 1). Infektion med HIV-1 ikke transporterer A3G giver det højeste antal læsninger, mens A3G hæmmer cDNA syntese og dermed reducerer den samlede Læs count. Ikke-inficerede celler fungerede som en negativ kontrol, mens en række syntetiske oligonukleotider giver en positiv kontrol. b) den relative forekomst af cDNAs for hver længde mellem nt positioner 23 og 182 (fuld længde - sss cDNA er 180 til 182 nt) af HIV-1NL4.3 sekvens (x-akse) er vist i blå histogrammer (skala på venstre y-akse). Den relative forekomst af cDNA blev beregnet ud fra det absolutte antal sekvenser afslutning på en given nukleotid inden for - sss cDNA sekvens divideret med summen af alle læser måling 182nt eller mindre. Vist i stiplede røde linjer er procenter af læser transporterer C-til-T/U mutationer på de respektive position (skala på højre y--akser). Figur 3 b udgives fra en tidligere publikation6. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4 : Repræsentative resultater af kontrolprøver. Vist er to profiler til pools indeholdende equimolar mængder af 17 forskellige længde syntetiske oligonukleotider. Disse oligonukleotider har sekvenser fra HIV-1NL4.3 og blev valgt til at dække forskellige længder og præsentere alle 4 baser som en 3'-nukleotid (Se tabel 2). Den øverste graf viser positive kontrolprøve fra figur 3en. Ingen betydelig skævhed i retning af molekylet længde eller åben 3'-termini er opdaget. Den nederste graf viser et andet bibliotek køre, som producerede en mindre længde bias i sekvensering. I dette tilfælde er det tilrådeligt at anvende en normalisering faktor, som er afledt af hældningen (vist i pink) der repræsenterer størrelse bias. Dette tal er genudgives fra en tidligere publikation6. Venligst klik her for at se en større version af dette tal.

Oligo navn Længde i nt Sekvens Formål Fabrikanten (rensning)
fuld Kwok + MiSeq 61 5'-PHO-tgaagagcctagtcgctgttcannnnnnctgcccatagagagatcggaagagcacacgtct-SpC3-3' Adapter IDT DNA teknologier (HPLC)
2xBiotin SS agn 40 5'-biotin-cagtgtggaaaatctctagcagtggcgcccgaacagggac-biotin-3' Hybrid Capture MWG Eurofins (HPLC)
Biotin 1-16 ss 22 5'-cagtgtggaaaatctctagcag-BiTEG-3' Hybrid Capture MWG Eurofins (HPLC
Biotin tRNA + CTG 16 5'-cagtggcgcccgaaca-BITEG-3' Hybrid Capture MWG Eurofins (HPLC)
MP1.0 + 22HIV 82 5'-aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatctcactgctagagattttccacactg-3' PCR-amplifikation MWG Eurofins (HPLC

Tabel 1: tabel over oligonukleotider herunder længde, sekvenser, og ændringer, der er udnyttet i de beskrevne protokol. Tabellen er tilpasset fra en tidligere publikation6Venligst klik her for at downloade denne tabel som en excel-fil.

Oligo navn Længde i nt Sekvens Fabrikanten (rensning)
HTP con lang C 120 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaagc-3' MWG Eurofins (HPLC)
HTP con lang G 119 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaag-3' MWG Eurofins (HPLC)
HTP con lang T 116 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggctt-3' MWG Eurofins (HPLC)
HTP con long A 118 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaa-3' MWG Eurofins (HPLC)
HTP con midten af C 76 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcac-3' MWG Eurofins (HPLC)
HTP con midten af G (en) 71 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacg-3' MWG Eurofins (HPLC)
HTP con midten af G (b) 72 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgg-3' MWG Eurofins (HPLC)
HTP con midten A 69 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacaga-3' MWG Eurofins (HPLC)
HTP con midten af T 85 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactt-3' MWG Eurofins (HPLC)
HTP con kort A 40 5'-ctgctagagattttccacactgactaaaagggtctgaggga-3' MWG Eurofins (HPLC)
HTP con korte T 33 5'-ctgctagagattttccacactgactaaaagggt-3' MWG Eurofins (HPLC)
HTP con kort G 41 5'-ctgctagagattttccacactgactaaaagggtctgaggg-3' MWG Eurofins (HPLC)
HTP con kort C 34 5'-ctgctagagattttccacactgactaaaagggtc-3' MWG Eurofins (HPLC)
HTP Con 46 (T) 46 5'-ctgctagagattttccacactg actaaaagggtctgagggatctct-3' MWG Eurofins (HPLC)
HTP Con 83 (C) 83 5'-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactac-3' MWG Eurofins (HPLC)
HTP Con 103 (C) 103 5'-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagc-3' MWG Eurofins (HPLC)
HTP Con 107 (A) 107 5'-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagcttta-3' MWG Eurofins (HPLC)

Tabel 2: oversigt over 17 syntetiske kontrol oligonukleotider bruges som en positive kontrolprøve. Top 13 oligonukleotider blev valgt baseret på størrelse [lang (116-120 nt), mid (69 til 85 nt), kort (33-41 nt)] og deres 3'-termini. Tabellen er tilpasset fra en tidligere publikation6.  Venligst klik her for at downloade denne tabel som en excel-fil.

Discussion

Tilgængeligheden af hurtig, pålidelig og omkostningseffektiv dyb sekventering har revolutioneret mange aspekter inden for biovidenskab, så stor dybde i sekventering-baserede analyser. En resterende udfordring ligger i innovative design og skabelse af repræsentant sekventering biblioteker. Her beskriver vi en protokol for at fange spirende viral cDNA molekyler, specielt mellemprodukter af HIV-1 omvendt transkription proces.

Det mest afgørende skridt i denne strategi er ligatur af en adapter til åben 3'-termini i en kvantitativ og saglig måde. Effektiviteten af ligations mellem to ssDNA termini, begge inter- og intramolekylære, er blevet undersøgt og optimeret til forskellige applikationer11,26,27,28,29. Valget mellem at bruge en hårnål adapter med T4 DNA ligase på betingelser beskrevet taktfast 3.3 er resultatet af empiriske optimering hvor vi evalueret forskellige ligases, adaptere og reagenser til ligatur af syntetiske oligonukleotider repræsenterer HIV-1 sekvenser (tabel 2) (data ikke vist). I disse in vitro- test reaktioner bekræftede vi, T4 DNA ligase medieret ligatur af hårnål adapteren, som beskrevet af Kwok mfl. 11, har en meget lav bias, og opnår nær komplet ligatur af acceptoren molekyler når Overgangsstikket bruges i overskud. Ligatur effektivitet var upåvirket ved tilsætning af nucleotidsekvensen at gengive adapteren kompatibel for multiplex primer system (Se figur 4). I sammenligning fandt vi, at en termostabil 5' DNA/RNA ligase ("Ligase A", se Tabel af materialer for nøjagtige ligases sammenlignet her), som er en manipuleret RNA ligase der blev udviklet en del at forbedre ligatur effektivitet med ssDNA som acceptoren 27, var faktisk mere effektivt på ligating to ssDNA molekyler end RNA ligase ("Ligase B") men havde en betydelig skævhed, med stærke forskelle i ligatur effektivitet selv mellem oligonukleotider med enkelt base længde forskelle [tabel 2 ; HTP con midten af G (a) og (b)]. Derudover fandt vi kun en minimal skævhed i reaktioner med "Ligase C" kombineret med en adaptor, transporterer en randomiseret 5'-termini (en strategi anvendes til at udligne kendte nukleotid bias "Ligase c"; Se f.eks Ding mfl. 30)., "Ligase C"-medieret intermolekylære ligations var ufuldstændige, rendering T4 DNA ligase system det overlegne valg.

Flere kvalitetskontrol trin over løbet af protokollen og inddragelse af positive og negative kontroller giver mulighed for påvisning af potentielle problemer før assay fortsættelse og give vejledning til fejlfinding bestræbelser. QPCR kvantificeringer i trin 2.2.2 og 2.3.12 sikre, at mængden af tilført materiale er tilstrækkeligt. Typiske cDNA kopi numre i 200 µL eluering (fra trin 2.1) spænder fra omkring 10.000 til 300.000 pr. µL. Hybrid capture trin kan resultere i tab af overordnede HIV-1 cDNA mængde men bør resultere i en stærk tilsætning af specifikke HIV-1 cDNA over cellulære DNA, hvilket kan fastslås ved hjælp af passende primere til at kvantificere genomisk DNA før og efter tilsætning af qPCR eller ved at måle samlede DNA koncentration. Gendannede HIV-1 cDNA efter hybride capture skridt bør være mindst 10% af input. Lav starter materiale kan ellers forklare en vellykket oligonukleotid positiv kontrol (Se trin 3.3.2) men kun begrænset læser opnåede i prøverne. Lav læse numre samlede kunne også forklares ved overvurdering af bibliotek koncentrationen på grund af tilstedeværelsen af irrelevante DNA arter uden MiSeq adaptere. Dette ville resultere i lav klynge tæthed og kan forbedres ved bestemmelse af koncentrationen af HIV-1 sekvenser i biblioteket af qPCR ud over den samlede DNA-mængde af fluorometriske assays. På grund af den meget følsomme karakter af metoden tages særlig pleje til at undgå selv low-level forurening, begge fra andre prøver (især fra høj koncentration kontrol oligonukleotid bestande) samt fra laboratorieudstyr. Arbejder i en UV sterilisering PCR arbejdsstation er gavnlig i denne henseende. Automatiseret gelelektroforese af den endelige bibliotek (trin 6.1.2) er en yderligere kvalitetskontrol foranstaltning. Nukleinsyre størrelsesområde typisk observeret er mellem 150-500 nt. primere, der kan påvises i den valgfri kontrol efter PCR, og før rensning (se note i trin 5.2) bør nu være fraværende. I et repræsentativt resultat, prøve intensitet kurve er et højdepunkt omkring 160-170 nt og en anden skarpere peak omkring 320-350 nt. Dette afspejler sandsynligvis den ses ofte højere overflod i både relativt korte (1 til 20 nt Indsæt længde) omvendt udskrifter og fuld længde stærk-stop (180 til 182 nt Indsæt længde) (fig. 3b).

Mens præsenteres protokol og valgte primere er specifikke for tidlige HIV-1 omvendt transkription konstruktioner, er metoden generelt gælder for enhver undersøgelse, med henblik på at bestemme åben 3'-termini af DNA. De vigtigste ændringer, der kræves i andre sammenhænge bliver være metoden for hybrid capture og primer design strategi. For eksempel, hvis målet er tilpasses til sen HIV-1 udskrifter, et større antal forskellige fanger biotinylated oligonukleotider udglødning på tværs af længden af cDNA ville være tilrådeligt og vil sandsynligvis reducere tabet i hybrid capture trin. Som nævnt i indledningen, er det vigtigt at overveje begrænsninger, når designe rækken, 3'-termini er at blive opdaget for at undgå forskellige kilder af bias. Først, der kan være en bias i PCR-reaktionerne hvis skabeloner med adapteren er af meget varierende længde. Andet, sekventering platformen bruges her (f.eks. MiSeq) har en foretrukken Indsæt længdeinterval for optimal klyngedannelse, og betydeligt kortere og længere produkter kan ikke blive sekventeret med samme effektivitet. Delvis, dette kan løses beregningsmæssigt, som blev gjort ved at beregne en korrektionsfaktor for lineær længde bias (Se figur 4, nederste graf). Men, hvis regionen hvor 3'-termini kortlægning ønskes er lang (> 1000 nt), det er mere hensigtsmæssigt at opdele reaktioner med de sammenskrevne udskrifter og bruge flere opstrøms primere til at vurdere 3'-termini i sektioner.

Programmet analyse var skrevet internt til det specifikke formål at analysere både den sidste nukleotid af HIV-1 sekvens støder op til den faste adapter sekvens og base variationen af alle baser til at identificere enhver mutationer. De enkelte trin omfatter følgende: først, adaptor sekvenser er trimmet ved hjælp af værktøjssættet fastx-0.0.13; derefter, nogen sekvenser, der er duplikeret (hvilket betyder identisk sekvenser herunder stregkoden) er fjernet. Alle resterende unikke læser derefter justeres til HIV-1 sekvens med Butterfly (http://bowtie-bio.sourceforge.net/index.shtml) med den maksimale uoverensstemmelse på tre baser. Skabelon sekvens består af de første 635 nt af HIV-1 cDNA (NL4.3 stamme), som omfatter - sss sekvens og den første strand overførsel vare op til polypurine spor (U5-R-U3-PPT, se figur 1). Dermed, er medfølgende software og skabeloner kun direkte egnet, hvis metoden, der bruges til det samme program (påvisning af tidlige omvendt udskrifter af HIV-1NL4.3). Justeringer bliver nødt til at være lavet for andre mål sekvenser. Holdninger af 3'-termini for hvert Læs blev bestemt af positionen i justeringen. Base opkald for hver position registreres og mutation priser beregnes ud fra den samlede dækning af hvert base, som varierer, som læser er af forskellige længder og lange skær kan ikke være helt dækket af 125-base sequencing i Read2.

Afslutningsvis mener vi den beskrevne metode til at være et værdifuldt redskab for mange typer af undersøgelser. Indlysende anvendelser omfatter undersøgelser af de underliggende reverse transkription hæmning gennem antiretroviral medicin eller cellulære begrænsning faktorer mekanismer. Kun relativt mindre justeringer bør dog nødvendigt at tilpasse systemet til 3'-termini kortlægning inden for andre enkeltstrenget DNA viral mellemprodukter, som er til stede, for eksempel i parvovirus replikering. Desuden kan princippet om metoden, især dens optimeret ligatur skridt, give en central del af bibliotek forberedelse design til karakterisering af 3'-DNA udvidelser, herunder forlængelser katalyseret af cellulære dobbelt-strenget DNA polymeraser.

Disclosures

Forfatterne erklærer, at de ikke har noget at oplyse.

Acknowledgments

Forfatterne anerkender støtten fra medlemmerne af Malim-laboratorium, Luis Apolonia, Jernej Ule, og Rebecca Oakey. Forfatterne takke Matt Arno på King's College London genomisk centrum og Debbie Hughes på University College London (UCL), Institut for neurologi næste Generation Sequencing facilitet, for at få hjælp med MiSeq sekventering kører. Arbejdet var støttet af den britiske Medical Research Council (G1000196 og hr./M001199/1 til M.M.), Wellcome Trust (106223/Z/14/Z til M.M.), Europa-Kommissionens syvende rammeprogram (FP7/2007-2013) under tilskudsaftalen ingen. PIIF-GA-2012-329679 (til DP), og af Department of Health via en nationale institutter for sundhed Research omfattende Biomedical Research Center award til fyr og St. Thomas' NHS Foundation Trust i partnerskab med King's College London og kongens College Hospital NHS Foundation Trust.

Materials

Name Company Catalog Number Comments
293T cells ATCC CRL-3216
Dulbecco's Modified Eagle's Medium Gibco 31966-021
Penicillin/Streptomycin Gibco 15150-122
Fetal Bovine Serum Gibco 10270-106
HeraCell Vios 250i CO2 Incubator Thermo Scientific 51030966
Laminar flow hood - CAS BioMAT2 Wolflabs CAS001-C2R-1800
10mm TC-treated culture dish Corning 430167
TrypLE™ Express (1x), Stable Trypsin Replacement Enzyme Gibco 12605-010
OptiMEM® (Minimal Essential Medium) Gibco 31985-047
HIV-1 NL4-3 Infectious Molecular Clone (pNL4-3) NIH Aids reagent program 114
Polyethylenimine (PEI) - MW:25000 PolySciences Inc 23966-2 dissolved at 1mg/ml and adjusted to pH7
RQ1- Rnase free Dnase Promega M6101
Filter 0.22 μm Triple Red Limited FPE404025
15 mL polypropylene tubes Corning CLS430791
Sucrose Calbiochem 573113
Phosphate Buffered Saline (1x) Gibco 14190-094
Ultracentrifuge tubes Beckman Coulter 344060
Ultracentrifuge Sorval WX Ultra Series Th-641 Rotor
Alliance HIV-1 p24 antigen ELISA kit Perkin Elmer NEK050001KT
CEM-SS cells NIH Aids reagent program 776
Roswell Park Memorial Institute Medium Gibco 31870-025
CoStar® TC treated multiple well plates Corning CLS3513-50EA
Benchtop centrifuge: Heraus™ Multifuge™ X3 FR Thermo Scientific 75004536
TX-1000 Swinging Bucket Rotor Thermo Scientific 75003017
Microcentrifuge: 5424R Eppendorf 5404000060
Total DNA extraction kit (DNeasy Blood and Tissue kit) Qiagen 69504
Nuclease free H2O Ambion AM9937
Cutsmart buffer New England Biolabs (part of DpnI enzyme) R0176S
DpnI restriction enzyme New England Biolabs R0176S
Oligonucleotides for qPCR MWG Eurofins N/A HPSF purification
TaqMan PCR Universal Mastermix Thermo 4304437
LoBind Eppendorf® tubes Eppendorf 30108078
Axygen™ aerosol filter pipette tips, 1000 μL Fisher Scientific TF-000-R-S
Axygen™ aerosol filter pipette tips, 200 μL Fisher Scientific TF-200-R-S
Axygen™ aerosol filter pipette tips, 20 μL Fisher Scientific TF-20-R-S
Axygen™ aerosol filter pipette tips, 10 μL Fisher Scientific TF-10-R-S
PCR clean hood LabCaire Model PCR-62
DynaMag™2-magnet Thermo 12321D
Streptavidin MagneSphere® paramagnetic particles Promega Z5481
Casein Thermo Scientific 37582
End over end rotator, Revolver™ 360° Labnet H5600
Tris-Base Fisher Scientific BP152-5
Hydrochloric Acid Sigma H1758-100ML
EDTA disodium salt dihydrate Electran (VWR) 443885J
Sodium Chloride Sigma S3014
Dri-Block® Analog Block Heater Techne UY-36620-13
PCR tubes and domed caps Thermo Scientific AB0266
PCR machine Eppendorf Mastercycler® series
T4 DNA ligase New England Biolabs M0202M
40% Polyethylene glycol solution (PEG) in H2O, MW: 8000 Sigma P1458-25ML
Betaine solution, 5M Sigma B0300-1VL
Gel loading buffer II (formamide buffer) Thermo Scientific AM8546G
Precast 6% TBE urea gels Invitrogen EC6865BOX
Mini cell electrophoresis system Invitrogen, Novex XCell SureLock™
Tris/Borate/EDTA solution (10x) Fisher Scientific 10031223
Needle 21 G x1 1/2 VWR 613-2022
SYBR Gold nucleic acid stain (10000x) Life Technologies S11494
Dark Reader DR46B transilluminator Fisher Scientific NC9800797
Ammonium acetate Merck 101116
SDS solution 20% (w/v) Biorad 161-0418
Centrifuge tube filter Appleton Woods BC591
Filter Glass Fibre Gf/D 10mm Whatman (VWR) 512-0427
polyadenylic acid (polyA) RNA Sigma 10108626001
Glycogen, molecular biology grade Thermo Scientific R0561
Isopropanol (2-propanol) Fisher Scientific 15809665
Ethanol, molecular biology grade Fisher Scientific 10041814
Accuprime™ Supermix I (DNA polymerase premix) Life Technologies 12342-010
NEBNext® Multiplex Oligo for Illumina (Index Primer Set 1 and 2) New England Biolabs E7335S; E7500S
Tapestation D1000 Screentape High sensitivity Agilent Technologies 5067- 5584
Tapestation D1000 Reagents Agilent Technologies 5067- 5585
2200 Tapestation - automated gel electrophoresis system Agilent Technologies G2965AA
Agencourt® AMPure® beads XP Beckman Coulter A63880
Qubit™ dsDNA HS Assay Kit Invitrogen Q32851
Qubit™ 2.0 Fluorometer Invitrogen Q32866
Topo™ TA cloning Kit Invitrogen 450071
Sequencing platform: MiSeq System Illumina
Experiment Manager (Sample sheet software) Illumina Note: Use TruSeq LT as a template
Miseq™ Reagent kit V3 (150 cycle) Illumina MS-102-3001
Sequencing hub: Basespace Illumina https://basespace.illumina.com
Ligase A: Thermostable 5’ App DNA/RNA ligase NEB M0319S Not used in this protocol, but tested in optimization process with results described in the discussion.
Ligase B: T4 RNA ligase 1 NEB M0204 Not used in this protocol, but tested in optimization process with results described in the discussion.
Ligase C: CircLigase Epicentre CL4111K Not used in this protocol, but tested in optimization process with results described in the discussion.

DOWNLOAD MATERIALS LIST

References

  1. Herschhorn, A., Hizi, A. Retroviral reverse transcriptases. Cellular and Molecular Life Sciences. 67, (16), 2717-2747 (2010).
  2. Hu, W. S., Hughes, S. H. HIV-1 reverse transcription. Cold Spring Harbor Perspectives in Medicine. 2, (10), (2012).
  3. Levin, J. G., Mitra, M., Mascarenhas, A., Musier-Forsyth, K. Role of HIV-1 nucleocapsid protein in HIV-1 reverse transcription. RNA Biology. 7, (6), 754-774 (2010).
  4. Menendez-Arias, L., Sebastian-Martin, A., Alvarez, M. Viral reverse transcriptases. Virus Research. (2016).
  5. Telesnitsky, A., Goff, S. P. Retroviruses. Coffin, J. M., Hughes, S. H., Varmus, H. E. (1997).
  6. Pollpeter, D., et al. Deep sequencing of HIV-1 reverse transcripts reveals the multifaceted antiviral functions of APOBEC3G. Nature Microbiology. 3, (2), 220-233 (2018).
  7. Frohman, M. A., Dush, M. K., Martin, G. R. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proceedings of the National Academy of Sciences of the United States of America. 85, (23), 8998-9002 (1988).
  8. Liu, X., Gorovsky, M. A. Mapping the 5' and 3' ends of Tetrahymena thermophila mRNAs using RNA ligase mediated amplification of cDNA ends (RLM-RACE). Nucleic Acids Research. 21, (21), 4954-4960 (1993).
  9. Ince, I. A., Ozcan, K., Vlak, J. M., van Oers, M. M. Temporal classification and mapping of non-polyadenylated transcripts of an invertebrate iridovirus. Journal of General Virology. 94, Pt 1 187-192 (2013).
  10. Hafner, M., et al. RNA-ligase-dependent biases in miRNA representation in deep-sequenced small RNA cDNA libraries. RNA. 17, (9), 1697-1712 (2011).
  11. Kwok, C. K., Ding, Y., Sherlock, M. E., Assmann, S. M., Bevilacqua, P. C. A hybridization-based approach for quantitative and low-bias single-stranded DNA ligation. Analytical Biochemistry. 435, (2), 181-186 (2013).
  12. Abram, M. E., Tsiang, M., White, K. L., Callebaut, C., Miller, M. D. A cell-based strategy to assess intrinsic inhibition efficiencies of HIV-1 reverse transcriptase inhibitors. Antimicrobial Agents and Chemotherapy. 59, (2), 838-848 (2015).
  13. Bishop, K. N., Verma, M., Kim, E. Y., Wolinsky, S. M., Malim, M. H. APOBEC3G inhibits elongation of HIV-1 reverse transcripts. PLoS Pathogens. 4, (12), 1000231 (2008).
  14. Zack, J. A., Haislip, A. M., Krogstad, P., Chen, I. S. Incompletely reverse-transcribed human immunodeficiency virus type 1 genomes in quiescent cells can function as intermediates in the retroviral life cycle. Journal of Virology. 66, (3), 1717-1725 (1992).
  15. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of Virology. 59, (2), 284-291 (1986).
  16. Shah, V. B., Aiken, C. In vitro uncoating of HIV-1 cores. Journal of Visualized Experiments. (57), (2011).
  17. JoVE Science Education Database. Science Education Database: Basic Methods in Cellular and Molecular Biology: Passaging Cells. Journal of Visualized Experiments. (2018).
  18. JoVE Science Education Database. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology: Using a Hemocytometer to Count Cells. Journal of Visualized Experiments. (2018).
  19. Zhou, M. Y., Gomez-Sanchez, C. E. Universal TA cloning. Current Issues in Molecular Biology. 2, (1), 1-7 (2000).
  20. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  21. Mangeat, B., et al. Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts. Nature. 424, (6944), 99-103 (2003).
  22. Gillick, K., et al. Suppression of HIV-1 infection by APOBEC3 proteins in primary human CD4(+) T cells is associated with inhibition of processive reverse transcription as well as excessive cytidine deamination. Journal of Virology. 87, (3), 1508-1517 (2013).
  23. Harris, R. S., et al. DNA deamination mediates innate immunity to retroviral infection. Cell. 113, (6), 803-809 (2003).
  24. Zhang, H., et al. The cytidine deaminase CEM15 induces hypermutation in newly synthesized HIV-1 DNA. Nature. 424, (6944), 94-98 (2003).
  25. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  26. Troutt, A. B., McHeyzer-Williams, M. G., Pulendran, B., Nossal, G. J. Ligation-anchored PCR: a simple amplification technique with single-sided specificity. Proceedings of the National Academy of Sciences of the United States of America. 89, (20), 9823-9825 (1992).
  27. Zhelkovsky, A. M., McReynolds, L. A. Structure-function analysis of Methanobacterium thermoautotrophicum RNA ligase - engineering a thermostable ATP independent enzyme. BMC Molecular Biology. 13, (24), (2012).
  28. Li, T. W., Weeks, K. M. Structure-independent and quantitative ligation of single-stranded DNA. Analytical Biochemistry. 349, (2), 242-246 (2006).
  29. Gansauge, M. T., et al. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase. Nucleic Acids Research. 45, (10), 79 (2017).
  30. Ding, Y., Kwok, C. K., Tang, Y., Bevilacqua, P. C., Assmann, S. M. Genome-wide profiling of in vivo RNA structure at single-nucleotide resolution using structure-seq. Nature Protocols. 10, (7), 1050-1066 (2015).
Afgørende 3'-Termini og sekvenser af spirende enkeltstrenget Viral DNA molekyler i HIV-1 omvendt transkription i inficerede celler
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pollpeter, D., Sobala, A., Malim, M. H. Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells. J. Vis. Exp. (143), e58715, doi:10.3791/58715 (2019).More

Pollpeter, D., Sobala, A., Malim, M. H. Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells. J. Vis. Exp. (143), e58715, doi:10.3791/58715 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter