Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Déterminant des séquences de molécules monocaténaires naissant de l’ADN Viral au cours du VIH-1 et 3'-Termini Reverse Transcription dans les cellules infectées

doi: 10.3791/58715 Published: January 30, 2019

Summary

Nous présentons une approche de séquençage en profondeur qui fournit une détermination impartiale du naissant 3'-termini ainsi que des profils de mutations des molécules d’ADN simple brin. L’application principale est la caractérisation de naissants DNAs rétrovirales complémentaires (ADNc), les intermédiaires générés lors du processus de transcription inverse rétrovirale.

Abstract

Surveillance des acides nucléiques intermédiaires au cours de la réplication du virus permet de mieux comprendre les effets et les mécanismes d’action des composés antiviraux et protéines de cellules hôtes sur la synthèse de l’ADN virale. Ici nous combler l’absence d’un essai sur les cellules, la haute-couverture et haute résolution qui peut être capable de définir des intermédiaires retroviral transcriptase inverse dans le contexte physiologique de l’infection par le virus. La méthode décrite capte la 3'-termini naissants complémentaires (ADNc) des molécules d’ADN dans les cellules infectés par le VIH-1 à la résolution de nucléotide. Le protocole consiste à récolter de l’ADN, enrichissement ciblée d’ADN virale via capture de l’hybride, ligation de l’adaptateur, fractionnement de taille par gel de purification, d’amplification PCR, séquençage en profondeur et analyse des données de la cellule entière. Une étape clé est la ligature efficace et impartiale des molécules d’adapteur pour ouvrir termini 3'-ADN. Application de la méthode décrite détermine l’abondance de transcription inverse de chaque longueur donnée dans un échantillon donné. Il fournit également des informations sur la variation de la séquence (interne) par transcription inverse et donc toute mutations potentielles. En général, le dosage est adapté pour toutes les questions relatives à l’ADN 3'-extension, pourvu que la séquence de modèle est connue.

Introduction

Pour disséquer et de comprendre la réplication virale entièrement, de plus en plus affiné les techniques qui rendent compte de réplication intermédiaires sont requis. En particulier, la définition précise des espèces acide nucléique viral dans le contexte des cellules infectées peut apporter un nouvel éclairage, étant donné que plusieurs mécanismes de réplication virale ont jusqu'à présent été examinés dans les réactions isolées in vitro . Un exemple typique est le processus de transcription inverse dans les rétrovirus, comme le virus d’immunodéficience humaine 1 (VIH-1). Les différentes étapes de la transcriptase inverse du VIH-1, au cours de laquelle l’enzyme virale la transcriptase inverse (RT) copie du génome d’ARN simple brin en ADN double-brin, ont été étudiés principalement lors d’essais extension amorce avec protéines purifiées et acides nucléiques les acides1,2,3,4,5. Alors que les principes fondamentaux ont été établis, ces tests n’intègrent pas tous les composants virus et cellulaires et peuvent ne pas refléter les stoechiométries biologiquement pertinentes des facteurs impliqués. Par conséquent, nous avons conçu une technique puissante pour déterminer le spectre de la transcription inverse intermédiaires avec leurs ADNc précise 3' termini-(p. ex., déterminer leurs longueurs précises) et des séquences de nucléotides dans le cadre des infections de la vie 6de cellules. Collecte des données de temps des expériences de cours peuvent être utilisés pour comparer le profil de transcriptions dans diverses conditions, telles que la présence de molécules antivirales ou de protéines, qui peuvent influer sur l’efficacité et la processivité de synthèse de l’ADN et accumulation. Cela permet une meilleure compréhension du cycle de vie naturel pathogène, qui est souvent la base pour la conception de médicaments ciblés et une intervention thérapeutique réussie.

Transcriptase inverse du VIH-1 comprend une série d’événements successifs initiée par recuit d’une amorce de tRNA pour le descripteur d’ARN génomique, qui est ensuite étendue par RT de produire une transcription court simple brin ADNc appelée un brin moins forte-stop (-sss) (voir La figure 1). Par la suite, l’ADNc - sss est transféré depuis le terminal 5'-longue répétition (LTR) à la LTR 3' de l’ARN génomique, où il recuits et sert comme l’amorce pour RT continue véhiculée par l’élongation de la minus brin ADN (voir les commentaires sur la transcription inverse1 , 2 , 3 , 4). ce premier transfert de brin est l’une des mesures limitant la vitesse de transcription inverse ; par conséquent, le cDNA - sss est connu pour s’accumuler. La conception de flux de travail et de la bibliothèque de base pour saisir les produits de transcription inverse dans les cellules infectées est décrit dans la Figure 2 a. Les amorces spécifiques et analyse les paramètres qui sont utilisés dans le protocole et figurant au tableau 1 ciblent tous tôt reverse transcription cDNA intermédiaires au sein de la gamme de longueur de 23 à 650 ~ nt, qui comprend le nt 180-182 - sss ADN. Toutefois, des adaptations mineures appropriées à la stratégie permettra demande non seulement des produits de transcription inverse fin mais aussi autres virus et systèmes, dont l’objectif est de détecter les extrémités de l’ADN contenant 3'-OH. Des restrictions importantes à considérer comprennent la gamme de longueur de l’amplicon final dans la bibliothèque ; en particulier, dans lequel la distance entre l’adaptateur sur l’ouvert 3'-terminale et le site de l’apprêt en amont dépasse 1000 ~ nt des modèles seront probablement moins efficacement séquencés, présentant potentiellement trompeuse biais techniques au cours de la préparation () bibliothèque voir la discussion pour plus de détails et de suggestions d’adaptation).

Précédemment techniques signalés pour la détermination systématique des extrémités 3' des brins d’acide nucléique ont mis l’accent sur l’ARN, pas l’ADN, les molécules. Un exemple est la 3' RACE (amplification rapide des extrémités d’ADNc)7, qui s’appuie sur la polyadénylation de l’ARNm. En outre, des stratégies axées sur la ligature d’adaptateur employant ligases RNA ont été développées, qui ont inclus le RLM-RACE (course de ligase-mediated RNA)8 ou9de la dentelle (axée sur la ligature de l’amplification des extrémités d’ADNc). Il est important de souligner que des amplifications axée sur la ligature sont sensibles à tout biais introduit par la réaction de ligature lui-même. Par exemple, la ligature peut s’avérer plus ou moins efficace selon un nucléotide donné dans la position 3', la séquence, longueur totale molécule ou structure locale. Ces préférences de ligase conduisent à capture incomplète des molécules et de la présentation inexacte des faits dans la lecture, qui nous et autres avons observé9,10. Pour minimiser les biais de ligature au cours des étapes d’addition adaptateur dans le protocole décrit ci-après, nous avons testé un certain nombre de stratégies de ligature et constaté l’utilisation de T4 DNA ligase avec un adaptateur d’ADN simple brin en épingle à cheveux (tel que décrit par Kwok et al. 11) d’être la seule procédure avec près de ligature quantitative qui n’a pas entraîné des différences significatives dans l’efficacité de la ligature lorsque évalué avec un ensemble de contrôle oligonucléotides6spécialement sélectionnés. Le choix de cette stratégie de ligature est donc un élément clé dans la réussite de ce protocole.

A ce jour, suivi de la progression du VIH-1 RT dans les cellules infectées a principalement été réalisé en mesurant les produits de la transcription inverse de longueur différentes avec la PCR quantitative (qPCR) en utilisant des ensembles de primer-sonde unique de mesurer plus ou moins longue (début et vers la fin, respectivement) cDNA produits12,13,14. Bien que cette approche de qPCR est appropriée pour déterminer l’efficacité intrinsèque du processus de transcription inverse dans les systèmes cellulaires, la sortie est de résolution relativement faible, sans informations de séquence étant dérivé. Notre nouvelle approche, basée sur la ligature adaptateur optimisé, génération de bibliothèque-mediated PCR et séquençage en profondeur adresses le fossé technologique et offre la possibilité de surveiller la transcription renversée au cours de l’infection à VIH-1 quantitativement et au nucléotide résolution.

Nous avons illustré l’utilité de cette méthode dans une étude qui a établi une distinction entre les deux modèles proposés pour la capacité du VIH-1 facteur de restriction APOBEC3G (enzyme édition apolipoprotéine B-ARNm catalytique polypeptide comme 3G) d’interférer avec le production de transcription inverse virale6.

Protocol

Remarque : Veuillez vous référer à la Table des matières des réactifs spécifiques et l’équipement utilisés dans le présent protocole.

1. virus Production et Infection de la cellule

Attention : Infectieux du VIH-1 seulement doit être manipulé que dans les laboratoires de confinement de biosécurité approuvé.

Remarque : La Production de particules de VIH-1 par transfection transitoire du rein embryonnaire humaine (HEK) 293 t cellules, conformément à l’étape 1.1, est une procédure standard et a été décrit précédemment15,16. Culture de cellules générales sont des procédures décrites précédemment17.

  1. Production de virus VIH-1.
    1. Maintenir les cellules 293 t de Dulbecco Eagle de milieu (DMEM) additionné de 10 % sérum fœtal (SVF) et 1 % la pénicilline/streptomycine (DMEM complet) dans un incubateur de culture cellulaire standard à 37 ° C et 5 % CO2 comme décrit plus haut17modifié.
    2. Dans une hotte à flux standard vitroplants Retirez le support de croissance et ajouter 3 mL de trypsine préchauffé (37 ° C) pour une boîte de Petri de cellule 10 cm près-anastomosé (~1.2 x 107 cellules) de cellules 293 t. Remettre le plat dans l’incubateur pendant 2-3 min.
    3. Reprendre le plat de l’incubateur dans la hotte de la culture de tissus et ajouter 7 mL de milieu complet. Pipetter monte et descend dans le plat plusieurs fois pour remettre en suspension les cellules. Fractionner les cellules 1:4 en ajoutant 2,5 mL de la suspension cellulaire à une autre boite de 10 cm et le remplir avec 7,5 mL de milieu complet.
    4. Le lendemain, mélanger 10 µg d’ADN proviral du VIH-1 plasmidique (comme pNL4.3) avec 1 mL de milieu sans sérum minimal essentiel et ajouter une solution polyéthylènimine (PEI) (25 000 mW, 1 mg/mL de pH 7) à 4,5 µL par 1 µg ADN. Incuber pendant 10 min à RT et ajouter goutte à goutte dans les cellules 293 t.
    5. 24h après la transfection, retirez le support et le remplacer par 6 mL de DMEM complet contenant DNase RNase-libre à 20 U/mL de milieu. Après 6 h, remplacer le support avec 10 mL de DMEM complet.
    6. 48 h après la transfection, récolter le surnageant et filtrer à travers un filtre de 0,22 µm, à l’aide d’une seringue de 10 mL, dans un tube de 15 mL en polypropylène.
    7. Ajouter 2 mL stérile 20 % de sucrose dans 1 x en solution saline tamponnée au phosphate (PBS) à un tube de toit ouvrant à parois minces ultracentrifugeuse. Lentement, superposer le saccharose avec la cellule filtrée surnageant.
    8. Centrifuger pendant 1 h 15 min à 134 000 x g à 4 ° C à l’aide d’une ultracentrifugeuse.
    9. Sortir les tubes de l’ultracentrifugeuse soigneusement. Retirer lentement le surnageant et le saccharose à l’aide d’une ventouse ou une pipette. Utiliser une pipette plus petite et incliner le tube lorsque vous retirez la dernière solution de saccharose. Laisser le virus granulé dans le fond du tube.
      Remarque : Le pellet ne sera pas visible.
    10. Ajouter 200 µL de PBS 1 x, laisser dans le réfrigérateur pendant 4 à 12 h, resuspendre et geler dans 20 µL d’extraits à-80 ° C.
    11. Déterminer p24Gag contenu à l’aide de l’un p24 VIH-1 antigène ELISA kit (suivant du fabricant).
  2. Infection de cellules T de ligne.
    1. La culture d’une lignée de T-cellules immortalisée (e.g., cellules CEM-SS) dans le milieu de Roswell Park Memorial Institute (RPMI) 1640 additionné de 10 % SVF et 1 % la pénicilline/streptomycine (RPMI complet). Compter les cellules à l’aide d’un hémocytomètre18 et graines 1 Eh bien par exemple avec 1 mL de RPMI complet avec 2 x 106 cellules/mL dans une plaque de culture de cellules de 12 puits format.
    2. Ajouter des particules de VIH-1 équivalent à 150 ng p24Gag et placer la plaque dans un balancement centrifuger seau avec couvercle de confinement biologique d’essorage-infecter par centrifugation dans une centrifugeuse de paillasse pendant 2 h à 2 000 x g à 30 ° C.
    3. Retirer la plaque de la centrifugeuse et laissez-la reposer pendant 1 h dans un incubateur de culture de tissus standard à 37 ° C et 5 % de CO2.
    4. Pour laver les virus d’entrée, prélever des cellules de transfert les suspensions cellulaires aux tubes de microcentrifuge et centrifugation dans un microcentrifuge à RT (RT) à 500 x g pendant 2 min. Décoller le surnageant sans déranger le culot cellulaire.
    5. Remettre en suspension les granules cellulaires dans 1 mL de pré chauffé (37 ° C), PBS stérile 1 x. Répétez la centrifugation, surnageant enlèvement et remise en suspension des mesures deux fois plus.
    6. Centrifuger à nouveau, retirez le surnageant et remettre en suspension les granules cellulaires dans 1 mL de RPMI complet. Ajouter chaque suspension dans un puits en une nouvelle plaque bien 12.
    7. À 6 h initial après addition de virus (centrifugation après 4 h), récolter les cellules par centrifugation comme fait à l’étape 1.2.4. Retirer et jeter le surnageant. Les granules cellulaires peuvent être congelés à-80 ° C ou traitées directement pour l’extraction de l’ADN.

2. ADN extraction, Quantification de l’ADN du VIH-1 et enrichissement par Hybrid Capture

  1. Extraire l’ADN des cellules entières avec un tissus et le sang total DNA extraction kit en suivant le manuel de la trousse pour les cellules de culture de tissus. Le seul changement est l’élution dans 200 µL d’exempte de nucléase H2O au lieu de la mémoire tampon d’élution fourni.
    Remarque : Après l’addition du tampon de lyse chaotropes (du kit « AL buffer ») et protéinase, échantillons peuvent être enlevés du laboratoire de confinement de biosécurité et traités dans un laboratoire de niveau de sécurité standard pour le reste du protocole.
  2. Déterminer le nombre de copies du VIH-1 cDNA de qPCR.
    1. Prendre 17 µL de l’éluat de l’étape 2.1 et ajouter 2 µL de tampon de restriction enzyme x 10 avec 1 µL d’enzyme de restriction DpnI. Incuber pendant 1 heure à 37 ° C pour enlever n’importe quel potentiel résiduel d’entrée l’ADN plasmidique de transfection.
    2. Effectuer de qPCR pour forte non-stop de cDNA moins-brin à l’aide de l’ensemble suivant de sonde primer : oHC64 (5′-taactagggaacccactgc-3′) et oHC65 (5′-gctagagattttccacactg-3′) et sonde oHC66 (5′-FAM-acacaacagacgggcacacacta-TAMRA-3′). installation de qPCR et conditions exactes se trouvent dans les références6,13. Transporter des échantillons avec une dilution en série de plasmide proviral pNL4.3 comme une courbe standard pour déterminer le nombre de copies de molécules de cDNA.
      Remarque : Voir la discussion pour les quantités attendues.
  3. Enrichissement d’ARN du VIH-1 par capture hybride.
    NOTE : Depuis cette avancée, il est préférable d’utiliser des tubes de microcentrifuge avec propriétés de liaison de faible teneur en acide nucléique comme pointes de pipette pour le filtre aérosol pour tous les échantillons d’ADN. Si possible, travailler dans un poste de travail PCR. Toutes les étapes et les réactifs sont à RT (RT), sauf indication contraire.
    1. Pour préparer un mélange maître de perles magnétiques streptavidine, pipetter 100 perles µL par échantillon dans un tube de microcentrifuge unique. Placer le tube sur un aimant pour microtubes à centrifuger.
    2. Après que les perles sont sont installés sur le côté de l’aimant du tube (~ 1 min), retirer le tampon de stockage, retirer le tube de l’aimant et remettre les billes en suspension dans 500 µL de bind et laver buffer (tampon de BW, 5 mM Tris-HCL pH 7.5, 0,5 mM EDTA 1 M NaCl) se laver.
    3. Placer le tube de retour sur l’aimant, éliminer le surnageant et ajouter 500 µL de solution de caséine. Prendre de l’aimant, resuspendre et incuber pendant 10 min à la droite, puis lavez avec un tampon BW.
      Remarque : Un lavage se réfère à placer le tube sur l’aimant, qui décollait le surnageant, en tenant le tube au large de l’aimant, ajoutant de la mémoire tampon et resuspendant.
    4. Placer le tube sur l’aimant, décoller le surnageant et remettre les billes en suspension dans 500 µL de tampon de BW. Ajouter 50 pmol de chaque capture oligonucléotides biotinylé (voir tableau 1, trois oligos dans ce cas) par exemple. (Par exemple, si 5 échantillons d’ADN doivent être traitées, utilisez 500 µL de billes magnétiques d’étape pmol 2.3.1 et 250 de chaque oligonucléotide).
    5. Incuber 30 min à ta tout bascule dans une table de mixage sur la fin.
    6. Laver les perles avec les oligonucléotides immobilisés deux fois avec 500 µL de tampon de dix du x 1 (10 mM Tris HCl, pH 8,0, 1 mM EDTA, 100 mM NaCl).
    7. Remettre en suspension les perles dans 10 µL de tampon dix de 1 x par exemple.
    8. Pour chaque échantillon l’étiquette un des tubes de microcentrifuge et ajouter 10 µL de suspension perles, 170 µL d’ADN (à l’étape 2.1) et 90 µL de 3 x tampon dix. Incuber dans un bloc de chaleur sèche à 92 ° C pendant 2 min dénaturer l’ADN.
    9. Déplacer les tubes à un bloc différent de chaleur sèche, qui est fixé à 52 ° C, et laisser incuber pendant 1 h. inverti de mélanger régulièrement (~ toutes les 10 min) au cours de l’incubation.
    10. Laver une fois avec 500 µL de 1 x tampon de dix et resuspendre dans 35 µL exempte de nucléase H2O.
    11. Pour éluer, incuber les tubes à 92 ° C dans un bloc de chaleur sèche pendant 2 min. Ensuite, passer rapidement les tubes sur l’aimant (un tube à la fois). Une fois que les perles sont liés à la paroi du tube, transférer le surnageant contenant l’ADN du VIH-1 pour un nouveau tube.
    12. Facultatif : Répéter qPCR (comme dans l’étape 2.2.2) pour déterminer l’ADNc récupéré de VIH-1.
      Remarque : Voir la discussion pour les quantités attendues.

3. adaptateur ligature

  1. Préparation de l’adaptateur
    1. Resuspendre adaptateur lyophilisée (voir tableau 1 « full Kwok + MiSeq ») à 100 µM en exempte de nucléase H2O.
    2. Par exemple, plus un seul témoin, combiner 0,45 µL de 10 x T4 DNA ligase tampon, 4 µL d’adaptateur et 0,05 µL d’exempte de nucléase H2O. chaleur à 92 ° C pendant 2 min et laisser refroidissent lentement.
      Remarque : Si l’option est disponible utiliser une machine PCR avec des taux de refroidissement réglable (taux de 2 % d’utilisation). Cela prend environ 30 min de 92 ° C à 16 ° C. Vous pouvez également utiliser un bloc de chaleur sèche à 92 ° C et éteint. Sortez l’adaptateur mastermix quand le bloc chauffant est de retour à température ambiante. Il s’agit de laisser l’adaptateur forment une structure en épingle à cheveux (voir Figure 2b).
  2. Préparer une réaction de contrôle avec un ensemble d’oligonucléotides synthétiques (voir tableau 2) au lieu de l’ADN extrait de cellules.
    1. Faire des stocks de 100 µM de chaque oligonucléotide. Mélanger 1 µL de chacune des 17 oligonucelotides et ajoutez 8 µL d’H2O pour un rapport équimolaire dans un volume final de 25 µL.
    2. Diluer le mélange 1:2,500 en exempte de nucléase H2O dans une dilution en série. Mélanger 1 µL du mélange avec 17,3 µL d’exempte de nucléase H2O d’utiliser dans la ligature d’échantillon de contrôle à l’étape 3.3.1 afin que chaque oligonucléotide est présent à 1,6 fmol (équivalent de 0,026 nM dans la réaction de 60 µL).
  3. Mise en place des trompes
    1. Pour 60 réactions de volume final µL dans des tubes PCR combinent 6 µL de 10 x T4 DNA ligase buffer, 24 µL de 40 % PEG, 6 µL de bétaïne de 5 M, 4,5 µL (400 pmol) de l’adaptateur (pre-annelead comme au point 3.1.2), 1,2 µL de T4 DNA ligase (2 000 000 unités/mL) et 18,3 µL d’ADN (à partir de étape 2.3.11)
      Remarque : Faites attention avec des solutions visqueuses par exemple 40 % PEG pour maintenir les volumes exacts. Ne faites pas un mastermix.
    2. Mettre en place la même réaction interprété à l’étape 3.3.1 mais avec le mélange d’oligonucléotide contrôle établi à l’étape 3.2.2.
    3. Bien mélanger les réactions et les incuber dans une machine PCR à 16 ° C durant la nuit.

4. adaptateur enlèvement et séparation de taille

  1. Électrophorèse sur gel dénaturant
    1. Ajouter 30 µL de gel d’ADN contenant du formamide tampon à chaque réaction de ligature de chargement. Mélangez bien en pipettant également.
    2. Chauffer pendant 2 min à 94 ° C dans la machine PCR, puis immédiatement mis sur la glace.
    3. Placer un préfabriqué 6 % Tris/borate/EDTA (TBE) dénaturant urée gel de polyacrylamide (peigne de 10 puits) dans une cuve gel approprié. Ajouter 1 tampon en cours d’exécution de x TBE (89 mM Tris-base, acide borique de 89 mM, 2 mM EDTA) et exécuter avant le gel pendant 20 min à température constante de 250 V/max.
    4. Laver les poches de gel avec tampon à l’aide d’une seringue et une aiguille de 21G.
    5. Charge de chaque échantillon de 90 µL dans trois puits (30 µL / puits) et exécuter pendant 20 min (250 V/max) jusqu'à l’avant du colorant bleu foncé est sujet à mi-chemin à travers le gel.
  2. Coloration et coupe des acides nucléiques du gel
    1. Préparer 3 tubes de microcentrifuge petit (0,5 mL) par échantillon en perçant de petits trous dans le fond à l’aide d’une aiguille de seringue de 21 G (faites attention lorsque vous travaillez avec des objets pointus ou tranchants). Chacun des tubes préparés insérer dans un tube de microtubes de 2,0 mL et étiqueter avec le nom de l’échantillon plus « faible », « moyenne » ou « élevée ».
    2. Sortez et ouvrir la cassette de gel. Couper le gel verticalement avec une lame de rasoir à l’accise généreusement la bande avec les 3 puits d’échantillons chargés. Ajouter la bande de gel dans un récipient avec 1 x TBE (environ 30 mL) et 5 µL de tache acide nucléique cyanine. Incuber pendant 3-5 min.
      Remarque : L’étape d’extraction gel est particulièrement sensible à la contamination croisée. Il est conseillé d’exécuter seulement 1 échantillon par le gel et en utilisant un récipient séparé et propre pour chaque coloration du gel. Gants doivent être modifiées si des particules de gel de contact doigts gantés.
    3. Nettoyer la surface d’un transilluminateur lumière bleue soigneusement avec les ddH2O. Prenez le morceau de gel hors du conteneur de coloration et l’ajouter à la boîte à lumière.
    4. Ouvrir la boite à lumière et inspecter les acides nucléiques tachées à travers le filtre orange.
      Remarque : L’adaptateur généralement semble surchargé et s’exécute comme gros « blob » avec ligaturé ADN du VIH-1 en cours d’exécution ci-dessus comme une traînée.
    5. À l’aide d’une lame de rasoir neuve, coupée les côtés du gel s’il y a des zones avec aucun échantillon chargé encore présents. Ensuite, couper juste au-dessus de l’adaptateur pour enlever l’adaptateur et gel inférieur de pièces. Enfin, coupez tout en haut du gel, y compris environ 1 mm du gel des poches, qui ont souvent un signal intense pointu de poids moléculaire plus élevé ADN.
    6. Diviser le morceau restant de gel contenant l’échantillon, qui est en général environ 2 x 3 cm de taille, horizontalement en trois morceaux de même : « faible », « milieu » et les zones de poids moléculaire « élevé ».
      Remarque : Chaque pièce sera désormais géré séparément [i.e., il y aura trois tubes (bas, milieu et haute)] par exemple d’origine.
    7. Chacun des fragments trois gel coupés en petits morceaux (environ 2 x 2 particules mm) et de les transférer dans les tubes de microcentrifuge préparée 0,5 mL (étape 4.2.1).
    8. Tourner à la vitesse supérieure avec des couvercles ouverts pendant 1 min à presser les morceaux de gel dans le trou dans le tube 2 mL pour créer une barbotine de gel. Si les particules de gel de resteront dans le fond du tube 0,5 mL, transférez-les sur le tube 2 mL manuellement à l’aide d’une pointe d’aiguille ou d’une pipette.
  3. Extraction d’ADN
    1. Ajouter 1 mL de tampon d’extraction urée gel (0,5 M NH4CH3CO2, 1 mM EDTA, 0,2 % SDS) à la neige fondante gel. Faire pivoter les tubes pendant un minimum de 3 h (pendant la nuit est acceptable) à ta avec une table de mixage sur la fin.
    2. Utiliser un jeu propre de pincettes pour ajouter un filtre en fibre de verre rond aux colonnes de la centrifugeuse avec des filtres de membrane de cellulose acetate (0,2 µm), qui évite le colmatage de la membrane. Mettre le filtre en place avec une pointe de pipette inversé.
    3. Brièvement, tourner les tubes de 2 mL avec le tampon de gel fondante et extraction dans une micro-centrifugeuse et transférer 700 µL du liquide surnageant pour les prêt de filtrer les colonnes. Garder le gel fondante et le surnageant restant.
    4. Centrifuger les filtrer les colonnes dans un microcentrifuge à vitesse maximale pendant 1 min. transfert des actions accréditives dans un nouveau tube de microtubes de 2,0 mL.
    5. Recharger les colonnes avec le surnageant restant. Essayez d’obtenir autant de liquide que possible de l’extraction de neige fondante. Transfert de morceaux de gel n’est pas un sujet de préoccupation. Tourner de nouveau et de combiner des flowthroughs des mêmes échantillons d’extraction.
  4. Précipitation de l’ADN
    1. Ajouter 3 µL de polyA RNA (1 µg/µL ; comme un transporteur), 1 µL de glycogène et 0,7 mL d’isopropanol pour la redistribution de l’étape 4.3.5. Vortex brièvement et congélation à-80 ° C la nuit.
    2. Prélever des échantillons du congélateur à-80 ° C et laissez-les décongeler brièvement. Mettez-les dans une micro-centrifugeuse refroidi (4 ° C) et un essorage pendant 30 min à la vitesse supérieure.
    3. Retirer et jeter le surnageant. Être très attention de ne pas retirer la pastille. Laissez 30 à 50 µL de liquide si on ne sait pas que pellet serait supprimée dans le cas contraire.
      Remarque : Tous les échantillons « élevés » présentent généralement une boulette de plus visible que les échantillons « moyenne » et « basses ».
    4. Ajouter 800 µL d’éthanol à 80 %. Inverser les tubes et un essorage à nouveau pendant 1 min à vitesse maximale. Enlever la plupart de l’éthanol avec une pipette, brièvement tourner les tubes et la suppression de plus d’éthanol avec une pipette de volume plus petite.
    5. Laissez tout l’éthanol restant s’évaporer en plaçant les tubes avec un couvercle ouvert dans un bloc de chaleur sèche de 55 ° C. Lorsque les échantillons sont sec (2 à 4 min) ajouter 20 µL d’exempte de nucléase H2O et propagation entre le fond du tube pour assurer le culot d’ADN est dissous. L’échantillon d’ADN peut être conservé à-20 ° C.

5. PCR Amplification et préparation de la bibliothèque

  1. Mettre en place une réaction de PCR de 40 µL avec 20 µL d’ADN polymérase pré-mix, 18 µL de précipité et redissous ADN de l’étape 4.4.5, 1 µL d’apprêt avant « MP1.0 + 22HIV » (10µM) (voir tableau 1) et 1 µL d’amorces oligo multiplex (amorces d’indice 1 à 24) (voir Table de Ma Terials).
    Remarque : Exécutez que les trois réactions (bas, moyen, élevé) de chaque échantillon dans les réactions de PCR séparées, mais avec le même indexé amorce. Utilisez un indice différent pour chacun des échantillons originaux infection.
    1. Exécuter les réactions de PCR dans les conditions suivantes : 2 min à 94 ° C dénaturation, puis 18 cycles de PCR 3 étapes ; 15 s à la dénaturation 94 ° C, 15 s recuit à 55 ° C et 30 s extension à 68 ° C.
  2. Comme une option de contrôle de la qualité, analyser les réactions de PCR avec haute sensibilité automatisée système d’électrophorèse de gel. Prendre 2 µL d’un échantillon de faible, moyenne et haut à exécuter selon les instructions du fabricant.
    Remarque : Les deux amorces doivent être visible et souvent courir à une longueur calculée d’environ 45 et 95 nt (longueur réelle diffère). En outre, l’ADN doit être détectable entre 150 et 500 nt. Si aucun signal n’est présent, il est conseillé d’ajouter d’autres cycles PCR, entre 2 et 10 cycles supplémentaires. N’ajoutez pas de cycles supplémentaires pour les échantillons de contrôle oligonucléotide créés à l’étape 3.3.2.
  3. Pour supprimer les amorces utilisent un système de nettoyage PCR paramagnétique axée sur le talon.
    1. Prenez 20 µL de chaque réaction de PCR et mettre en commun l’ensemble des échantillons (mélanger tous les échantillons à ce stade). Congeler les reste 20 µL des réactions comme les sauvegardes à-20 ° C.
    2. Laisser les billes paramagnétiques venu de RT et de mélanger les réactions de PCR regroupées avec 1.8 x le volume de la solution de perle. La composition de pipetage et incuber pendant 5 min.
      Remarque : Comme par exemple, si 4 échantillons ont été préparés et chacune ont des réactions faibles, moyens et élevées, le volume serait 4 x 3 x 20 µL = 240 réactions de PCR µL avec une 432 µL de solution de perle.
    3. Mettre les tubes sur un aimant de tubes de microcentrifuge, laisser les perles se lient pour ~ 1 min et décoller le surnageant de se défaire. Laisser les tubes sur l’aimant et ajouter 500 µL d’éthanol à 80 %.
    4. Laisser l’éthanol pour 30 s, puis décoller soigneusement et laissez l’airdry perles pour environ 5 min. ajouter 40 µL d’exempte de nucléase H2O, prenez les tuyaux au large de l’aimant et pipeter monter et descendre plusieurs fois.
    5. Maintenir la suspension pendant 5 min. Mettez le tube sur l’aimant, laisser les perles s’installer sur le côté et transférer le surnageant dans un nouveau tube. Il s’agit de la bibliothèque. Prendre un 10 µL aliquote pour les contrôles de qualité et congelez le reste à-20 ° C.

6. évaluation de la bibliothèque

  1. Déterminer la qualité de la bibliothèque, la concentration et la molarité.
    1. Utilisez une méthode de dosage fluorimétrique. Mesurer 1 µL et 3 µL de la bibliothèque avec un kit de test ADN double brin de haute sensibilité selon les instructions du fabricant.
      Remarque : Les concentrations typiques sont entre 1 et 10 ng/µL.
    2. Mesure du spectre de masse moléculaire ADN bibliothèque de haute sensibilité automatisée électrophorèse comme décrit ci-dessus (étape 5.2).
    3. Utilisation automatisée de l’analyse par électrophorèse pour déterminer le poids moléculaire moyen de la bibliothèque de gel et calculer pour diluer la bibliothèque en exempte de nucléase H2O à 4 nM. Plusieurs bibliothèques peuvent être combinés aussi longtemps que tous les indices sont uniques.
  2. Option débit faible contrôle de la qualité
    1. Sous réserve de la bibliothèque de l’ADN de TA clonage19 pour insérer des molécules de la bibliothèque dans des vecteurs pour l’amplification. Suivez les instructions du kit, grossissement environ 10-20 colonies et extrait l’ADN via miniprep protocoles, tel que décrit ici20.
    2. Vecteur de séquence à l’aide de services de séquençage local et vérifier que les inserts contiennent le désiré HIV-1 dérivé de séquences et adaptateurs spécifiques à cette bibliothèque.

7. course de séquençage haut débit

  1. Créez une feuille d’échantillon de séquençage avec les logiciels commerciaux fournies avec la plate-forme de séquençage.
    1. Indiquer le kit de séquençage sélectionnés. En général, choisissez un kit 150-cycle, mais d’autres sont adaptés selon la durée de lecture souhaitée.
    2. Sélectionnez « Fastq seulement » comme le workflow de la demande. Choisissez un des modèles qui contient les 24 indices présents dans les kits d’oligonucléotide multiplex (indiqués dans le manuel de la trousse).
    3. Sélectionnez « 25 nt » pour Read1 et « 125 nt » pour Read 2. Gardez 6 nt pour seul indice lu.
      Remarque : Dans l’analyse interne seulement Read 2 est utilisé dans l’analyse. Conserver Read1 à un minimum de 25 nt pour fins d’algorithme de plate-forme de séquençage.
  2. Suivez les instructions du fabricant précisément pour la préparation de la bibliothèque avant exécution et de configuration. Optez pour le maximum de 20 concentrations de pM et utiliser une pointe de PhiX de 15 %, que la bibliothèque est d’une complexité très faible.

8. analyse des données

  1. Vérifier si le pourcentage de filtre pass et le niveau de qualité moyenne Q30 est acceptables selon les instructions du fabricant de plate-forme de séquençage.
    Remarque : Le filtre passe-bas est typiquement > 90 % et Q30 scores sont généralement > 80 %.
  2. Télécharger le. fastq.gz fichiers de hub de séquençage par le fabricant.
  3. Mise en place du script de séquençage
    1. Créez un nouveau répertoire (dossier) nommé « AnalysisXYZ » et aller à https://github.com/malimlab/seqparse pour télécharger tous les fichiers de code source (parse_sam.pl, rc_extract.pl, parse.sh) dans ce répertoire.
    2. Télécharger l’aligneur de court-lire noeud papillon, version 1.1.2, de http://bowtie-bio.sourceforge.net/index.shtml dans le même répertoire.
    3. Le téléchargement crée un sous-répertoire dans « AnalysisXYZ » nommé « Noeud papillon-1.1.2 ». Dans ce répertoire, ouvrez le sous-répertoire « index » et télécharger les séquences du modèle fourni consistant en 6 fichiers avec les extensions .ebwt.
    4. Télécharger les lectures de courtes FASTQ/A prétraitement toolkit fastx-0.0.13 de http://hannonlab.cshl.edu/fastx_toolkit/download.html dans le répertoire « AnalysisXYZ ».
    5. Téléchargez Samtools (https://sourceforge.net/projects/samtools/files/) et bam-readcount (https://github.com/genome/bam-readcount) dans le répertoire « Documents ».
  4. Déplacer le. fastq.gz fichiers, téléchargés à l’étape 8.2, d’abord lire 2 s (se terminant en... _R2_001.fastq.gz) dans le répertoire « AnalysisXYZ ».
  5. Ouvrez la console/terminal de commande. Passer à la « AnalysisXYZ » comme répertoire courant à l’aide de commandes de cd. Type «./parse.sh. » d’exécuter les scripts.
  6. Trouver les fichiers .csv avec résumés de tous les échantillons sur les comptages totaux de lecture, longueur ajusté lire les chefs d’accusation et normalise les comtes lire, ainsi que des fichiers avec des variations de base, pour chaque échantillon dans un répertoire nommé parse_results dans le répertoire « Analyse XYZ ».
    Remarque : Se reporter pour plus d’informations sur le processus d’analyse. Le script retourne les fichiers csv avec des lectures totales pour chaque nucléotide le long des séquences de VIH-1NL4.3 forte-stop et le premier transfert de brin jusqu’au nucléotide 635. Comme une ligne directrice, 50 000 à 100 000 lectures uniques sont généralement observées dans les échantillons provenant des infections avec les numéros de la cellule indiquée et l’inoculum viral et sans protéines antivirales ou composés. Généralement, l’échantillon de contrôle oligonucléotide produit 100 000 à 200 000 lectures.

Representative Results

La technique décrite dans cet article a été appliquée à une étude plus large pour aborder les mécanismes sous-jacents à l’inhibition de la transcription inverse du VIH-1 par la protéine humaine antirétroviral APOBEC3G (A3G)6. La figure 3 illustre représentant résultats obtenus après employant le protocole dans les échantillons de CEM-SS T-cellules infectées avec vif-déficient VIH-1 en l’absence ou la présence de A3G. Le nombre total de lectures uniques provenant de chaque échantillon après filtrage de doublon PCR qui ont le même 6 nt codes à barres et la même longueur (interprété par le logiciel d’analyse fourni) sont tracées dans la Figure 3un. Des niveaux croissants de A3G réduisent le nombre total de lecture reflétant l’effet inhibiteur du A3G sur RT médiée par synthèse de cDNA précédemment décrit et mesuré par qPCR6,13,21,22. Figure 3b, la fraction des molécules à chaque longueur possible au sein de la première 182 nt sont divulgués. Pour l’infection à VIH-1 en l’absence de A3G, espèce la plus abondante est la principale 180 nt forte-stop molécule lui-même, avec une accumulation de lectures dans la gamme plus courte (23 à 40 nt) (histogrammes graphique, bleu en haut). L’ajout de modifications A3G ce profil comme une brusque hausse de court, tronqué de molécules de cDNA dans quelques positions très précises et reproductibles est détecté (graphiques moyens et inférieurs). A3G étant une désaminase cytidine, uridine-à-cytosine (identifié comme C-à-T) l’ADNc des mutations se produisent lorsque A3G est présent en l’infectant des virions21,23,24. En utilisant les informations obtenues de séquençage, le pourcentage des mutations C-à-T a été tracé sur le même graphe (rouge en pointillés). Il est à noter que le profil mutationnel est dérivé de lectures toutes uniques combinés et couverture de chaque nucléotide variera. Toutefois, si nécessaire des informations de séquence peuvent être associées à chaque molécule et en corrélation avec un spécifique 3'-terminale. Les données fournies ont été prises de Pollpeter et al. 6 et la corrélation entre mutation et profils de longueur de cDNA a été démontrée pour être en raison de la détection et le clivage de l’ADNc désaminé par le cellulaire ADN réparent des machines.

Un témoin positif de l’approche de 3'-cartographie réalisable facilement par un pool d’oligonucléotides synthétiques de séquence connue, concentration et longueur de traitement. Ce contrôle est ajouté à la ligature de l’adaptateur à l’étape 3.3.2 et conseillé à inclure dans toutes les bibliothèques multiplexés. Les données obtenues auprès d’un échantillon de contrôle doivent avoir tous les oligonucléotides à des ratios d’entrée attendues, avec des lectures de fond très mineures. La figure 4 montre les résultats d’un ensemble de contrôle positif de 17 chimiquement synthétisés oligonucléotides (pour les séquences, voir tableau 2), qui ont été mélangés à des taux équimolaires. Comme prévu, toutes les molécules apparaissent dans près égale abondance avec seulement de légères variations (graphique du haut). Alors que la plupart des postes au sein de la séquence d’ADN - sss qui n’étaient pas représentés par un oligonucléotide retournent zéro comtes de lecture, nous avons observé des espèces mineures qui sont 1 ou 2 nt plus courtes que les oligonucléotides de contrôle réel. Nous n’ont pas encore étudiées ces espèces mineures mais supposons qu’ils représentent les produits dégradés ou incomplètes potentiellement présents dans les stocks d’oligonucléotide fourni à l’achat (oligonucléotides ont été ordonnées comme HPLC purifiés, pour lesquels la référence du fabricant indique > 80 % de pureté). Le graphique du bas montre l’exemple de contrôle auprès d’une bibliothèque différente run, où la variation est légèrement plus élevée entre les 17 oligonucléotides et est en corrélation avec la longueur totale car plus longues molécules de contrôle sont détectés plus efficacement, puis courts. Cela peut être dû à un biais de mineur dans les réactions de PCR ou en clusters lors du séquençage de MiSeq, qui a un insert taille optimal et peut se produire avec les bibliothèques transportant insert particulièrement larges gammes. Une façon fondamentale d’aborder ce biais est l’application d’un facteur de normalisation fondé sur la pente qui indique le biais corrélées à la longueur de la molécule (ligne rose). Les calculs nécessaires sont inclus dans le programme d’analyse (voir étape 8.3 dans le protocole).

Figure 1
Figure 1: diagramme montrant les premiers pas du VIH-1 de transcription inverse. Le processus commence par un recuit de tRNA(Lys,3) (orange) pour le site de fixation de l’amorce (PBS) dans l’ARN génomique viral (étape 1), qui permet l’initiation et l’élongation de l’ADNc viral (bleu, étape 2). En même temps, l’ARN génomique du modèle est dégradée par l’activité RNaseH de RT (étape 3). Le premier intermédiaire complet dans le processus de transcription inverse est le brin moins forte-stop (-) sss cDNA, qui est terminée lorsque la polymérisation RT catalysée atteint l’extrémité 5' de la région de (R) répétition gRNA (étape 3). Le sss (-) intermédiaire est transféré à l’extrémité 3' du descripteur d’ARN génomique par recuit à la région de (LTR) R répéter 3' long terminale complémentaire. D’ici, polymérisation continue (étape 4). Dans la méthode décrite, la progression de la transcription inverse est déterminée en mappant la longueur exacte de l’ADNc viral naissant (bleu). PPT, appariement des voies ; U5, 5'-séquence unique ; U3, 3'-séquence unique. Ce chiffre est republié depuis une précédente publication6. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : Esquisse de flux de travail et des schémas de la ligature de l’adaptateur et la stratégie d’amplification PCR. b flux de travail décrivant les principales étapes de la technique décrite pour déterminer les extrémités 3' du VIH-1 inverse transcriptions dans les cellules infectées. La figure est une adaptation d’une précédente publication6. (b) le schéma de la ligature de l’adaptateur et la stratégie d’amplification PCR. Les molécules de cDNA naissant de longueur variable qui ont été purifiées dans les étapes précédentes sont ligaturés à un adaptateur d’ADN simple brin à l’aide de T4 DNA ligase. L’adaptateur de l’épingle à cheveux design (nommée « pleine Kwok + MiSeq », voir le tableau 1) a été inspiré par Kwok et al. 11. l’adaptateur porte un aléatoire 6 séquence de code à barres de nt, qui permet d’appariement de bases afin de faciliter la ligature et sert simultanément en tant qu’identificateur unique lectures. La 3'-termini de l’adaptateur porte une entretoise (SpC3) pour empêcher l’individu-ligature. Ligaturé produits sont séparées de l’adaptateur excès en dénaturant l’électrophorèse sur gel de polyacrylamide (PAGE). Acides nucléiques dans le gel sont colorées et couper en trois morceaux de gel distinct, de taille égale dans la région par le dessus de l’adaptateur au puits comme fait par25. Après élution, précipitations et remise en suspension, les produits sont amplifié avec recuit à la séquence connue de l’adaptateur des amorces PCR (amorce 1, kit de l’oligonucléotide multiplex, voir Table des matières) et une couche d’apprêt transportant les 22 premières nt du VIH-1 Séquence 5'-LTR qui suit immédiatement l’ARNt (apprêt 2, MP1.0 + 22HIV). Les 5'-terminus des amorces choisies portent des adaptateurs pour la plate-forme de séquençage choisie (P5 et P7) ainsi qu’une séquence d’indice pour distinguer les échantillons individuels dans la même bibliothèque. Points de départ du séquençage lire amorces sont indiqués. La boîte bleue indique la zone concernée pour déterminer l’origine 3'-termini de la molécule capturée. Ce chiffre est une adaptation d’une précédente publication6. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Résultats représentatifs. b le nombre total de lecture d’échantillons représentatifs traités avec le protocole décrit. Cela inclut toutes les séquences qui ont été identifiés comme uniques lectures de molécules HIV-1 avec leurs extrémités 3' au sein de la première 635 nt la MINUS strand cDNA (jusqu'à le PPT, voir Figure 1). Infection par le VIH-1 ne procédant pas A3G donne le plus grand nombre de lectures, alors que A3G inhibe la synthèse de cDNA et réduit ainsi le total lu comte. Les cellules non infectées servi comme témoin négatif, alors qu’un ensemble d’oligonucléotides synthétiques fournit un contrôle positif. b) l’abondance relative d’ADNc pour chaque longueur entre les positions de nt 23 et 182 (ADNc pleine longueur - sss est 180 à 182 nt) de l' HIV-1NL4.3 enchaînement (axe x) est indiqué dans les histogrammes bleus (échelle sur l’axe des ordonnées de gauche). L’abondance relative des ADNc a été calculée à partir du nombre absolu des séquences terminales à un nucléotide donné dans la séquence d’ADNc - sss divisée par la somme de toutes les lectures de mesure 182nt ou moins. Les pourcentages de lit porteuses de mutations C-à-T/U à la position respective (échelle sur les axes de droite y) sont présentées dans les lignes rouges en pointillés. Figure 3 b est republiée depuis une précédente publication6. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : Résultats représentatifs des échantillons témoins. Sont deux profils pour les piscines contenant des quantités équimolaires de 17 oligonucléotides synthétiques de différentes longueurs. Ces oligonucléotides ont des séquences de VIH-1NL4.3 et ont été choisis pour couvrir différentes longueurs et de présenter tous les 4 bases de 3'-nucléotide (voir tableau 2). Le graphique du haut montre l’échantillon de contrôle positif de la Figure 3a. Aucune correction significative vers la longueur de la molécule ou l’ouvrir 3'-termini n’est détectée. Le graphique du bas montre une autre bibliothèque exécutée, qui a produit un biais longueur mineures dans le séquençage. Dans ce cas, il est conseillé d’appliquer un facteur de normalisation, qui est dérivé de la pente (indiquée en rose) qui représente le parti pris de taille. Ce chiffre est republié depuis une précédente publication6. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Oligo nom Longueur en nt Séquence Objectif Référence du fabricant (Purification)
Full Kwok + MiSeq 61 5'-PHO-tgaagagcctagtcgctgttcannnnnnctgcccatagagagatcggaagagcacacgtct-SpC3-3' Adaptateur Technologies de l’ADN de l’IDT (HPLC)
2xBiotin SS appât 40 5'-biotine-cagtgtggaaaatctctagcagtggcgcccgaacagggac-biotine-3' Hybrid Capture Eurofins MWG (HPLC)
Biotine 1-16 ss 22 5'-cagtgtggaaaatctctagcag-BiTEG-3' Hybrid Capture Eurofins MWG (HPLC
TRNA de biotine + CTG 16 5'-cagtggcgcccgaaca-BITEG-3' Hybrid Capture Eurofins MWG (HPLC)
MP1.0 + 22HIV 82 5'-aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatctcactgctagagattttccacactg-3' Amplification par PCR Eurofins MWG (HPLC

Tableau 1 : tableau des oligonucléotides dont la longueur, séquences et les modifications qui sont utilisées dans le protocole décrit. La table est une adaptation d’une précédente publication6S’il vous plaît cliquez ici pour télécharger ce tableau comme un fichier excel.

Oligo nom Longueur en nt Séquence Référence du fabricant (Purification)
HTP con C long 120 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaagc-3' Eurofins MWG (HPLC)
HTP con G long 119 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaag-3' Eurofins MWG (HPLC)
HTP con T long 116 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggctt-3' Eurofins MWG (HPLC)
HTP con longs A 118 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaa-3' Eurofins MWG (HPLC)
Con HTP milieu C 76 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcac-3' Eurofins MWG (HPLC)
HTP con mi G (a) 71 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacg-3' Eurofins MWG (HPLC)
HTP con mi G (b) 72 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgg-3' Eurofins MWG (HPLC)
Con HTP milieu A 69 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacaga-3' Eurofins MWG (HPLC)
Con HTP mi T 85 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactt-3' Eurofins MWG (HPLC)
HTP con court A 40 5'-ctgctagagattttccacactgactaaaagggtctgaggga-3' Eurofins MWG (HPLC)
HTP con T court 33 5'-ctgctagagattttccacactgactaaaagggt-3' Eurofins MWG (HPLC)
HTP con G court 41 5'-ctgctagagattttccacactgactaaaagggtctgaggg-3' Eurofins MWG (HPLC)
HTP con C court 34 5'-ctgctagagattttccacactgactaaaagggtc-3' Eurofins MWG (HPLC)
HTP Con 46 (T) 46 5'-ctgctagagattttccacactg actaaaagggtctgagggatctct-3' Eurofins MWG (HPLC)
HTP Con 83 (C) 83 5'-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactac-3' Eurofins MWG (HPLC)
HTP Con 103 (C) 103 5'-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagc-3' Eurofins MWG (HPLC)
HTP Con 107 (A) 107 5'-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagcttta-3' Eurofins MWG (HPLC)

Tableau 2 : tableau des 17 oligonucléotides synthétiques contrôle utilisé comme un échantillon de contrôle positif. Les oligonucléotides haut 13 ont été choisis selon la taille [long (116 à 120 nt), mid (69 à 85 nt), court (33 à 41 nt)] ainsi que leurs extrémités 3'. La table est une adaptation d’une précédente publication6.  S’il vous plaît cliquez ici pour télécharger ce tableau comme un fichier excel.

Discussion

La disponibilité de séquençage rapide, fiable et rentable en profondeur a révolutionné beaucoup d’aspects dans le domaine des sciences de la vie, permettant à grande profondeur dans les analyses axées sur le séquençage. Un défi reste réside dans la conception innovante et la création du représentant les bibliothèques de séquençage. Nous décrivons ici un protocole visant à capturer les molécules de cDNA viral naissant, spécifiquement les intermédiaires du processus de transcriptase inverse du VIH-1.

L’étape la plus critique de cette stratégie est la ligature d’un adaptateur pour l’ouvrir 3'-termini de manière quantitative et non biaisée. Efficacité des trompes entre deux terminus d’ADN simple brin, inter- et intramoléculaires, ont été étudiés et optimisés pour différentes applications11,26,27,28,29. Le choix d’utiliser un adaptateur en épingle à cheveux avec T4 DNA ligase dans les conditions décrites à l’étape 3.3 est le résultat de l’optimisation empirique dont nous avons évalué différentes ligases, adaptateurs et réactifs pour la ligature des oligonucléotides synthétiques représentant Séquences de VIH-1 (tableau 2) (données non présentées). Dans ces réactions de test in vitro , nous avons confirmé que la T4 DNA ligase médiée par ligation de l’adaptateur de l’épingle à cheveux, tel que décrit par Kwok et al. 11a un écart très faible et réalise près de ligature complète de molécules accepteur lorsque l’adaptateur est utilisé en excès. L’efficacité de la ligature n’est pas affectée par l’ajout de séquence nucléotidique pour restituer l’adaptateur compatible pour le système d’amorçage multiplex (voir Figure 4). En comparaison, nous avons constaté qu’une ligase ADN/ARN thermostable de 5' (voir « Ligase A », Table des matières pour les ligases exactes par rapport ici), qui est une ligase machiné de RNA qui a été développé en partie d’améliorer efficacité ligature avec ADN simple brin comme accepteur 27, était en effet plus efficace à la ligature des deux molécules d’ADN simple brin de ligase RNA (« Ligase B »), mais avait un biais important, avec fortes différences dans l’efficacité de la ligature, même entre les oligonucléotides avec des différences de longueur de base individuelle [tableau 2 ; HTP con mi G (a) et (b)]. En outre, nous avons trouvé seulement un biais minime dans les réactions avec « Ligase C » combiné avec un adaptateur transportant un essai randomisé 5'-termini (une stratégie pour compenser les biais de nucléotides connue de « Ligase C » ; voir par exemple Ding et al. 30). Cependant, le « Ligase C »-médiation des trompes intermoléculaires étaient incomplètes, rendant le système de ligase d’ADN T4 le meilleur choix.

Plusieurs mesures de contrôle de la qualité sur le golf du protocole et de l’inclusion des témoins positifs et négatifs permettant de détecter des problèmes potentiels avant la poursuite de l’analyse et des directives pour le dépannage des efforts. Les quantifications de qPCR en étapes 2.2.2 et 2.3.12 veiller à ce que la quantité du matériel d’entrée suffit. Nombre de copies d’ADNc typiques dans la gamme d’élution (à l’étape 2.1) 200 µL d’environ 10 000 à 300 000 par µL. L’étape de capture hybride peut entraîner une perte globale du VIH-1 cDNA quantité mais devrait se traduire par un fort enrichissement spécifiques applicables à l’ARNC VIH-1 au cours de l’ADN cellulaire, qui peut être déterminé en utilisant des amorces appropriées pour quantifier l’ADN génomique, avant et après enrichissement par qPCR ou en mesurant la concentration totale de l’ADN. Récupéré le VIH-1 cDNA après l’hybride capture étapes devrait être au moins 10 % de l’apport. Faible à partir de matériel peut expliquer autrement un témoin positif de l’oligonucléotide réussie (voir étape 3.3.2) mais seulement limité lectures atteints dans les échantillons. Faible lire nombres globale pourrait également s’expliquer par une surestimation de la concentration de la bibliothèque en raison de la présence d’espèces d’ADN non pertinents sans MiSeq adaptateurs. Cela se traduirait par une densité faible de cluster et peut être améliorée par la détermination de la concentration des séquences de VIH-1 dans la bibliothèque de qPCR en plus de la quantité d’ADN totale par dosages fluorimétrique. En raison de la nature hautement délicate de la méthode, spécial il faut pour éviter la contamination même à basse altitude, les deux autres échantillons (en particulier, depuis les stocks oligonucléotide contrôle de concentration élevée) ainsi que de matériel de laboratoire. Travaillant dans une UV de stérilisation workstation PCR est bénéfique à cet égard. L’électrophorèse automatisée de la bibliothèque finale (étape 6.1.2) est une autre mesure de contrôle de la qualité. Le calibre de l’acide nucléique généralement observé est entre 150 et 500 nt. amorces qui peuvent être détectées dans le contrôle facultatif après le PCR et avant purification (voir la note à l’étape 5.2) convient désormais absente. Un résultat représentatif, la courbe d’intensité échantillon a un pic autour de 160 à 170 nt et une nette deuxième pic autour de 320 à 350 nt. Cela reflète probablement l’abondance plu souvent vus en relativement courte transcription inverse (longueur d’insert nt 1 à 20) et forte non-stop pleine longueur (longueur de 180 à 182 nt insert) (Figure 3b).

Alors que le protocole présenté et les amorces sélectionnées sont spécifiques pour des constructions de transcriptase inverse du VIH-1 au début, la méthode est généralement applicable à toute étude visant à déterminer ouvert 3'-termini d’ADN. Les principales modifications requises dans d’autres contextes sera la méthode de capture hybride et la stratégie de conception d’amorce. Par exemple, si la cible doit être adapté aux fin transcrits du VIH-1, un plus grand nombre de différents oligonucléotides biotinylé capture recuit sur toute la longueur de l’ADNc serait souhaitable et diminuera probablement la perte lors de l’étape de capture hybride. Tel que mentionné dans l’introduction, il est important de tenir compte des limitations lors de la conception de la gamme sur laquelle est les 3'-termini à détecter pour éviter les différentes sources de biais. Tout d’abord, il peut y avoir un biais dans les réactions de PCR si les modèles avec l’adaptateur sont de longueur très variable. Deuxièmement, la plate-forme de séquençage utilisée ici (p. ex., MiSeq) a une gamme de longueur d’insertion privilégiée pour le clustering optimale et significativement plus courtes et plus de produits ne peuvent pas être séquencés avec la même efficacité. En partie, cela peut être résolu par le calcul, comme l’a fait en calculant un facteur de correction du biais de longueur linéaire (voir la Figure 4, graphique du bas). Toutefois, si la région où 3'-termini cartographie est souhaitée est longue (> 1000 nt), il est plus judicieux de diviser les réactions avec les transcriptions ligaturées et utilisent plusieurs amorces en amont pour évaluer les extrémités 3' dans les sections.

Le programme d’analyse a été écrite à l’interne dans le but spécifique de l’analyse de ces deux derniers nucléotides de la séquence de HIV-1 adjacente à la séquence de l’adaptateur fixe ainsi que la variation de base de toutes les bases de détecter des mutations. Les différentes étapes, répartis comme suit : tout d’abord, les séquences de l’adaptateur sont taillés à l’aide de l’outil fastx-0.0.13 ; Ensuite, toutes les séquences qui sont en double (c'est-à-dire des séquences identiques, y compris le code à barres) sont supprimés. Toutes les lectures uniques restants sont alors alignés sur la séquence de VIH-1 en utilisant le nœud papillon (http://bowtie-bio.sourceforge.net/index.shtml) avec le décalage maximal fixé à trois bases. La séquence de modèle est composée de la première 635 nt du VIH-1 cDNA (souche NL4.3), qui comprend la séquence - sss et le premier produit de transfert de brin jusqu'à la piste d’appariement (U5-R-U3-PPT ; voir Figure 1). Ainsi, le logiciel fourni et modèles conviennent uniquement directement si la méthode est utilisée pour la même application (détection de début transcription inverse de l' HIV-1NL4.3). Ajustements devront être faites pour les autres séquences cibles. Les positions de la 3'-termini pour chaque lecture ont été déterminées par la position dans l’alignement. Les appels de base pour chaque position sont enregistrés et des taux de mutation sont calculés à partir de la couverture totale de chaque base, qui varie, comme lectures sont de différentes longueurs et inserts de longs ne peuvent pas être entièrement couverts par le séquençage de 125-base dans Read 2.

Pour conclure, nous pensons que la méthode décrite pour être un outil précieux pour de nombreux types d’études. Des applications évidentes comprennent des enquêtes sur les mécanismes sous-jacents à l’inhibition de la transcription inverse grâce à des médicaments antirétroviraux ou facteurs de restriction cellulaires. Cependant, des ajustements relativement mineurs devraient être nécessaires d’adapter le système à 3'-termini cartographie au sein d’autres intermédiaires virales ADN simple brin, qui sont présents, par exemple, dans la réplication de parvovirus. En outre, le principe de la méthode, en particulier son étape de ligature optimisé, peut fournir une partie essentielle de la conception de préparation de bibliothèque pour la caractérisation de toute extension de 3'-ADN, y compris les allongements catalysées par cellulaire ADN à double brin polymérases.

Disclosures

Les auteurs déclarent qu’ils n’ont rien à divulguer.

Acknowledgments

Les auteurs tiennent à souligner le soutien des membres du laboratoire Malim, Luis Apolonia, Jernej Ule et Rebecca Oakey. Les auteurs remercient Matt Arno au Centre génomique de la College de Londres du roi et Debbie Hughes à l’University College London (UCL), Institut de neurologie génération prochaine installation de séquençage, pour obtenir de l’aide MiSeq séquençage s’exécute. Le travail a été soutenu par le Conseil de recherches médicales UK (G1000196 et MR/M001199/1 à M.M.), le Wellcome Trust (106223/Z/14/Z à M.M.), septième Programme-cadre (7e PC/2007-2013) de la Commission européenne en vertu de la convention de subvention sans. PIIF-GA-2012-329679 (de D.P.) et le ministère de la santé via un instituts nationaux pour le prix de la santé recherche globale Biomedical Research Center à Guy et St. Thomas' NHS Foundation Trust en partenariat avec King College de Londres et du roi College Hospital NHS Foundation Trust.

Materials

Name Company Catalog Number Comments
293T cells ATCC CRL-3216
Dulbecco's Modified Eagle's Medium Gibco 31966-021
Penicillin/Streptomycin Gibco 15150-122
Fetal Bovine Serum Gibco 10270-106
HeraCell Vios 250i CO2 Incubator Thermo Scientific 51030966
Laminar flow hood - CAS BioMAT2 Wolflabs CAS001-C2R-1800
10mm TC-treated culture dish Corning 430167
TrypLE™ Express (1x), Stable Trypsin Replacement Enzyme Gibco 12605-010
OptiMEM® (Minimal Essential Medium) Gibco 31985-047
HIV-1 NL4-3 Infectious Molecular Clone (pNL4-3) NIH Aids reagent program 114
Polyethylenimine (PEI) - MW:25000 PolySciences Inc 23966-2 dissolved at 1mg/ml and adjusted to pH7
RQ1- Rnase free Dnase Promega M6101
Filter 0.22 μm Triple Red Limited FPE404025
15 mL polypropylene tubes Corning CLS430791
Sucrose Calbiochem 573113
Phosphate Buffered Saline (1x) Gibco 14190-094
Ultracentrifuge tubes Beckman Coulter 344060
Ultracentrifuge Sorval WX Ultra Series Th-641 Rotor
Alliance HIV-1 p24 antigen ELISA kit Perkin Elmer NEK050001KT
CEM-SS cells NIH Aids reagent program 776
Roswell Park Memorial Institute Medium Gibco 31870-025
CoStar® TC treated multiple well plates Corning CLS3513-50EA
Benchtop centrifuge: Heraus™ Multifuge™ X3 FR Thermo Scientific 75004536
TX-1000 Swinging Bucket Rotor Thermo Scientific 75003017
Microcentrifuge: 5424R Eppendorf 5404000060
Total DNA extraction kit (DNeasy Blood and Tissue kit) Qiagen 69504
Nuclease free H2O Ambion AM9937
Cutsmart buffer New England Biolabs (part of DpnI enzyme) R0176S
DpnI restriction enzyme New England Biolabs R0176S
Oligonucleotides for qPCR MWG Eurofins N/A HPSF purification
TaqMan PCR Universal Mastermix Thermo 4304437
LoBind Eppendorf® tubes Eppendorf 30108078
Axygen™ aerosol filter pipette tips, 1000 μL Fisher Scientific TF-000-R-S
Axygen™ aerosol filter pipette tips, 200 μL Fisher Scientific TF-200-R-S
Axygen™ aerosol filter pipette tips, 20 μL Fisher Scientific TF-20-R-S
Axygen™ aerosol filter pipette tips, 10 μL Fisher Scientific TF-10-R-S
PCR clean hood LabCaire Model PCR-62
DynaMag™2-magnet Thermo 12321D
Streptavidin MagneSphere® paramagnetic particles Promega Z5481
Casein Thermo Scientific 37582
End over end rotator, Revolver™ 360° Labnet H5600
Tris-Base Fisher Scientific BP152-5
Hydrochloric Acid Sigma H1758-100ML
EDTA disodium salt dihydrate Electran (VWR) 443885J
Sodium Chloride Sigma S3014
Dri-Block® Analog Block Heater Techne UY-36620-13
PCR tubes and domed caps Thermo Scientific AB0266
PCR machine Eppendorf Mastercycler® series
T4 DNA ligase New England Biolabs M0202M
40% Polyethylene glycol solution (PEG) in H2O, MW: 8000 Sigma P1458-25ML
Betaine solution, 5M Sigma B0300-1VL
Gel loading buffer II (formamide buffer) Thermo Scientific AM8546G
Precast 6% TBE urea gels Invitrogen EC6865BOX
Mini cell electrophoresis system Invitrogen, Novex XCell SureLock™
Tris/Borate/EDTA solution (10x) Fisher Scientific 10031223
Needle 21 G x1 1/2 VWR 613-2022
SYBR Gold nucleic acid stain (10000x) Life Technologies S11494
Dark Reader DR46B transilluminator Fisher Scientific NC9800797
Ammonium acetate Merck 101116
SDS solution 20% (w/v) Biorad 161-0418
Centrifuge tube filter Appleton Woods BC591
Filter Glass Fibre Gf/D 10mm Whatman (VWR) 512-0427
polyadenylic acid (polyA) RNA Sigma 10108626001
Glycogen, molecular biology grade Thermo Scientific R0561
Isopropanol (2-propanol) Fisher Scientific 15809665
Ethanol, molecular biology grade Fisher Scientific 10041814
Accuprime™ Supermix I (DNA polymerase premix) Life Technologies 12342-010
NEBNext® Multiplex Oligo for Illumina (Index Primer Set 1 and 2) New England Biolabs E7335S; E7500S
Tapestation D1000 Screentape High sensitivity Agilent Technologies 5067- 5584
Tapestation D1000 Reagents Agilent Technologies 5067- 5585
2200 Tapestation - automated gel electrophoresis system Agilent Technologies G2965AA
Agencourt® AMPure® beads XP Beckman Coulter A63880
Qubit™ dsDNA HS Assay Kit Invitrogen Q32851
Qubit™ 2.0 Fluorometer Invitrogen Q32866
Topo™ TA cloning Kit Invitrogen 450071
Sequencing platform: MiSeq System Illumina
Experiment Manager (Sample sheet software) Illumina Note: Use TruSeq LT as a template
Miseq™ Reagent kit V3 (150 cycle) Illumina MS-102-3001
Sequencing hub: Basespace Illumina https://basespace.illumina.com
Ligase A: Thermostable 5’ App DNA/RNA ligase NEB M0319S Not used in this protocol, but tested in optimization process with results described in the discussion.
Ligase B: T4 RNA ligase 1 NEB M0204 Not used in this protocol, but tested in optimization process with results described in the discussion.
Ligase C: CircLigase Epicentre CL4111K Not used in this protocol, but tested in optimization process with results described in the discussion.

DOWNLOAD MATERIALS LIST

References

  1. Herschhorn, A., Hizi, A. Retroviral reverse transcriptases. Cellular and Molecular Life Sciences. 67, (16), 2717-2747 (2010).
  2. Hu, W. S., Hughes, S. H. HIV-1 reverse transcription. Cold Spring Harbor Perspectives in Medicine. 2, (10), (2012).
  3. Levin, J. G., Mitra, M., Mascarenhas, A., Musier-Forsyth, K. Role of HIV-1 nucleocapsid protein in HIV-1 reverse transcription. RNA Biology. 7, (6), 754-774 (2010).
  4. Menendez-Arias, L., Sebastian-Martin, A., Alvarez, M. Viral reverse transcriptases. Virus Research. (2016).
  5. Telesnitsky, A., Goff, S. P. Retroviruses. Coffin, J. M., Hughes, S. H., Varmus, H. E. (1997).
  6. Pollpeter, D., et al. Deep sequencing of HIV-1 reverse transcripts reveals the multifaceted antiviral functions of APOBEC3G. Nature Microbiology. 3, (2), 220-233 (2018).
  7. Frohman, M. A., Dush, M. K., Martin, G. R. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proceedings of the National Academy of Sciences of the United States of America. 85, (23), 8998-9002 (1988).
  8. Liu, X., Gorovsky, M. A. Mapping the 5' and 3' ends of Tetrahymena thermophila mRNAs using RNA ligase mediated amplification of cDNA ends (RLM-RACE). Nucleic Acids Research. 21, (21), 4954-4960 (1993).
  9. Ince, I. A., Ozcan, K., Vlak, J. M., van Oers, M. M. Temporal classification and mapping of non-polyadenylated transcripts of an invertebrate iridovirus. Journal of General Virology. 94, Pt 1 187-192 (2013).
  10. Hafner, M., et al. RNA-ligase-dependent biases in miRNA representation in deep-sequenced small RNA cDNA libraries. RNA. 17, (9), 1697-1712 (2011).
  11. Kwok, C. K., Ding, Y., Sherlock, M. E., Assmann, S. M., Bevilacqua, P. C. A hybridization-based approach for quantitative and low-bias single-stranded DNA ligation. Analytical Biochemistry. 435, (2), 181-186 (2013).
  12. Abram, M. E., Tsiang, M., White, K. L., Callebaut, C., Miller, M. D. A cell-based strategy to assess intrinsic inhibition efficiencies of HIV-1 reverse transcriptase inhibitors. Antimicrobial Agents and Chemotherapy. 59, (2), 838-848 (2015).
  13. Bishop, K. N., Verma, M., Kim, E. Y., Wolinsky, S. M., Malim, M. H. APOBEC3G inhibits elongation of HIV-1 reverse transcripts. PLoS Pathogens. 4, (12), 1000231 (2008).
  14. Zack, J. A., Haislip, A. M., Krogstad, P., Chen, I. S. Incompletely reverse-transcribed human immunodeficiency virus type 1 genomes in quiescent cells can function as intermediates in the retroviral life cycle. Journal of Virology. 66, (3), 1717-1725 (1992).
  15. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of Virology. 59, (2), 284-291 (1986).
  16. Shah, V. B., Aiken, C. In vitro uncoating of HIV-1 cores. Journal of Visualized Experiments. (57), (2011).
  17. JoVE Science Education Database. Science Education Database: Basic Methods in Cellular and Molecular Biology: Passaging Cells. Journal of Visualized Experiments. (2018).
  18. JoVE Science Education Database. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology: Using a Hemocytometer to Count Cells. Journal of Visualized Experiments. (2018).
  19. Zhou, M. Y., Gomez-Sanchez, C. E. Universal TA cloning. Current Issues in Molecular Biology. 2, (1), 1-7 (2000).
  20. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  21. Mangeat, B., et al. Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts. Nature. 424, (6944), 99-103 (2003).
  22. Gillick, K., et al. Suppression of HIV-1 infection by APOBEC3 proteins in primary human CD4(+) T cells is associated with inhibition of processive reverse transcription as well as excessive cytidine deamination. Journal of Virology. 87, (3), 1508-1517 (2013).
  23. Harris, R. S., et al. DNA deamination mediates innate immunity to retroviral infection. Cell. 113, (6), 803-809 (2003).
  24. Zhang, H., et al. The cytidine deaminase CEM15 induces hypermutation in newly synthesized HIV-1 DNA. Nature. 424, (6944), 94-98 (2003).
  25. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  26. Troutt, A. B., McHeyzer-Williams, M. G., Pulendran, B., Nossal, G. J. Ligation-anchored PCR: a simple amplification technique with single-sided specificity. Proceedings of the National Academy of Sciences of the United States of America. 89, (20), 9823-9825 (1992).
  27. Zhelkovsky, A. M., McReynolds, L. A. Structure-function analysis of Methanobacterium thermoautotrophicum RNA ligase - engineering a thermostable ATP independent enzyme. BMC Molecular Biology. 13, (24), (2012).
  28. Li, T. W., Weeks, K. M. Structure-independent and quantitative ligation of single-stranded DNA. Analytical Biochemistry. 349, (2), 242-246 (2006).
  29. Gansauge, M. T., et al. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase. Nucleic Acids Research. 45, (10), 79 (2017).
  30. Ding, Y., Kwok, C. K., Tang, Y., Bevilacqua, P. C., Assmann, S. M. Genome-wide profiling of in vivo RNA structure at single-nucleotide resolution using structure-seq. Nature Protocols. 10, (7), 1050-1066 (2015).
Déterminant des séquences de molécules monocaténaires naissant de l’ADN Viral au cours du VIH-1 et 3'-Termini Reverse Transcription dans les cellules infectées
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pollpeter, D., Sobala, A., Malim, M. H. Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells. J. Vis. Exp. (143), e58715, doi:10.3791/58715 (2019).More

Pollpeter, D., Sobala, A., Malim, M. H. Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells. J. Vis. Exp. (143), e58715, doi:10.3791/58715 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter