Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Determinante 3'-Termini e sequências de moléculas de ADN Viral de Single-Stranded nascente durante o HIV-1 inverter transcrição em células infectadas

doi: 10.3791/58715 Published: January 30, 2019

Summary

Aqui nós apresentamos uma abordagem profunda de sequenciamento que fornece uma análise imparcial da nascente 3'-termini, bem como perfis mutacional de moléculas de DNA único-encalhado. A aplicação principal é a caracterização de DNAs complementares retrovirais nascentes (cDNAs), os intermediários gerados durante o processo de transcrição reversa retroviral.

Abstract

Monitoramento de ácido nucleico intermediários durante a replicação do vírus fornece insights sobre os efeitos e mecanismos de ação dos compostos antivirais e proteínas de célula do hospedeiro na síntese de DNA viral. Aqui abordamos a falta de um ensaio baseado em pilha, cobertura de alto e de alta resolução que é capaz de definir a transcrição reversa retroviral intermediários no âmbito fisiológico da infecção pelo vírus. O método descrito capta a 3'-termini de moléculas de DNA (cDNA) nascentes complementares dentro das células infectadas de HIV-1 em resolução de nucleotídeo único. O protocolo envolve a colheita de células inteiras DNA, alvo enriquecimento de viral DNA através do híbrido captura, ligadura de adaptador, fracionamento de tamanho por gel de purificação, amplificação do PCR, sequenciamento profundo e análise de dados. Um passo fundamental é a ligadura eficiente e imparcial das moléculas do adaptador para abrir termini 3'-DNA. Aplicação do método descrito determina a abundância de reversos transcrições de cada comprimento específico numa determinada amostra. Ele também fornece informações sobre a variação da sequência (interno) em transcrição reversa e, assim, qualquer potenciais mutações. Em geral, o ensaio é adequado para todas as questões relacionadas ao DNA 3'-extensão, desde que a sequência de modelo é conhecida.

Introduction

A fim de dissecar e compreender a replicação viral totalmente, cada vez mais refinadas técnicas que capturam replicação intermediários são necessários. Em particular, a definição precisa das espécies do ácido nucleico viral dentro do contexto das células infectadas pode fornecer novos insights, uma vez que muitos mecanismos de replicação viral têm até à data foram examinados em reações isoladas em vitro . Um exemplo é o processo de transcrição reversa em retrovírus, como o vírus de imunodeficiência humana 1 (HIV-1). As várias etapas de transcrição reversa do HIV-1, durante o qual o enzima viral transcriptase reversa (RT) copia o genoma de RNA de single-stranded DNA dupla-hélice, têm sido estudados principalmente em ensaios de extensão da primeira demão com proteínas purified e ácidos nucleicos ácidos1,2,3,4,5. Enquanto princípios fundamentais foram estabelecidos, tais ensaios não incorpora todos os componentes celulares e virais e podem não refletir stoichiometries biologicamente relevantes dos fatores envolvidos. Portanto, nós projetamos uma técnica poderosa para determinar o espectro de intermediários de transcrição reversa com seus precisos do cDNA 3'-termini (isto é, determinar seus comprimentos exatos) e sequências nucleotídicas no contexto das infecções da vida células6. Coleção de dados de tempo de experiências do curso podem ser utilizadas para comparar o perfil de transcritos sob várias condições, tais como a presença de moléculas antivirais ou proteínas, que possam influenciar a eficiência e processivity da síntese de DNA e acumulação. Isto permite uma compreensão mais detalhada do ciclo de vida natural do patógeno, que muitas vezes é a base para a concepção de medicação específica e intervenção terapêutica bem sucedida.

Transcrição reversa do HIV-1 é composto por uma série de eventos sucessivos, iniciada pelo recozimento de um primer de tRNA para o modelo de RNA genômico, que então é estendido por RT para produzir uma transcrição de cDNA de single-stranded curta chamada uma subtração-vertente forte-parada (-sss) (ver A Figura 1). Posteriormente, o cDNA - sss é transferido do terminal 5'-longa repetição (LTR) para a LTR 3' do RNA genômico, onde ele anneals e serve como o primer para RT continuada mediada alongamento de menos vertente DNA (ver comentários na transcrição reversa1 , 2 , 3 , 4). esta primeira transferência de vertente é um dos passos limitante de transcrição reversa; daí, o cDNA - sss é conhecido por se acumular. O projeto básico de fluxo de trabalho e biblioteca para capturar os produtos de transcrição reversa em células infectadas é descrito na Figura 2a. Os primers específicos e análise de configurações que são usadas no protocolo e listadas na tabela 1 alvo todos cedo reverso transcrição do cDNA intermediários dentro do intervalo de comprimento de 23 para ~ 650 nt, que inclui o nt 180-182 - sss DNA. No entanto, adaptações menores adequadas à estratégia permitirá que o aplicativo não só produtos de transcrição reversa atrasado, mas também outros vírus e sistemas, onde o objetivo é detectar as extremidades de DNA contendo 3'-OH. Limitações importantes a considerar incluem a escala de comprimento do produto final do PCR na biblioteca; em particular, modelos em que a distância entre o adaptador sobre o aberto 3'-terminal e o site cartilha montante exceder ~ 1000 nt irão provavelmente ser menos eficientemente sequenciados, introduzindo potencialmente enganosa preconceitos técnicos durante (preparação de biblioteca Veja a discussão para mais detalhes e sugestões de adaptação).

Anteriormente relatadas técnicas para a determinação sistemática dos 3'-termini de ácidos nucleicos concentraram-se no RNA, e não DNA, moléculas. Um exemplo é 3' corrida (amplificação rápida das extremidades do cDNA)7, o que depende a poliadenilação dos RNAm. Além disso, foram desenvolvidas estratégias baseadas em ligadura de adaptador empregando ligases de RNA, que incluíram RLM-corrida (RNA ligase-mediada)8 ou do laço (amplificação baseados em ligadura das extremidades do cDNA)9. É importante ressaltar que amplificações baseada em ligadura são sensíveis a qualquer viés introduzido pela reação da ligadura em si. Por exemplo, a ligadura pode ser mais ou menos eficiente, dependendo de um determinado nucleotídeo na posição 3', a sequência, comprimento total da molécula ou estrutura local. Tais preferências ligase levam a captura incompleta de moléculas e deturpação na leitura, o que nós e os outros têm observado9,10. Para minimizar o viés de ligadura durante as etapas de adição de adaptador no protocolo descrito neste documento, testou uma série de estratégias de ligadura e o uso de T4 DNA ligase com adaptador prendendor single-stranded DNA encontrado (como descrito por Kwok et al. 11) para ser o único procedimento com perto de ligadura quantitativa que não resultou em diferenças significativas na eficiência da ligadura quando avaliados com um conjunto especificamente selecionado de oligonucleotídeos de controle6. A escolha desta estratégia de ligadura é, portanto, um recurso-chave para o sucesso do presente protocolo.

Até à data, monitoramento da progressão do HIV-1 RT em células infectadas principalmente realizado medindo-se produtos da transcrição reversa de diversos comprimento com PCR quantitativo (qPCR) usando conjuntos de cartilha-sonda que medem exclusivamente mais curto ou mais longo (precoce e tarde, respectivamente) do cDNA produtos12,13,14. Enquanto essa abordagem qPCR é apropriada determinar a eficiência intrínseca do processo de transcrição reversa em sistemas celulares, a saída é de resolução relativamente baixa, sem informações de sequência sendo derivada. Nossa nova abordagem, com base no adaptador otimizada da ligadura, geração biblioteca mediada por PCR e sequenciamento profunda endereços o fosso tecnológico e oferece uma oportunidade para monitorar a transcrição reversa durante a infecção de HIV-1, quantitativamente e em único nucleotídeo resolução.

Ilustramos a utilidade desse método em um estudo que distingue-se entre dois propostos modelos para a capacidade do HIV-1 factor de restrição APOBEC3G (apolipoprotein B mRNA edição enzima catalítica do polypeptide, como 3G) para interferir com o produção de transcrição reversa viral6.

Protocol

Nota: Consulte a Tabela de materiais para reagentes específicos e equipamentos utilizados no presente protocolo.

1. vírus produção e infecção de célula

Cuidado: Infecciosas HIV-1 só deve ser manipulado em laboratórios de contenção de biossegurança aprovado.

Nota: A produção de partículas de HIV-1 por transfecção transiente de rim embrionário humano (HEK) 293T células, conforme descrito na etapa 1.1, é um procedimento padrão e tem sido descrito anteriormente15,16. Cultura de pilha geral são procedimentos descritos anteriormente17.

  1. Produção de vírus HIV-1.
    1. Manter 293T células de Dulbecco modificado Eagle suplementado (DMEM) com 10% de soro fetal bovino (FBS) e 1% penicilina/estreptomicina (DMEM completo) em uma incubadora de cultura de célula padrão em 37 ° C e 5% CO2 conforme descrito anteriormente,17.
    2. Em uma capa de cultura de tecidos de padrão de fluxo laminar, remova a mídia de crescimento e adicionar 3 mL de tripsina pré-aquecido (37 ° C) numa placa de cultura de célula perto confluente 10cm (~1.2 x 107 células) de células 293T. Coloque o prato de volta na incubadora para 2-3 min.
    3. Leve o prato de incubadora volta para a capa de cultura de tecidos e adicionar 7 mL de meio completo. Pipete acima e para baixo dentro do prato várias vezes para Ressuspender as células. Dividir as células 1:4, adicionando 2,5 mL da suspensão de célula para um novo prato de 10 cm e preenchê-lo com 7,5 mL de meio completo.
    4. No dia seguinte, misture 10 µ g proviral HIV-1 do ADN do plasmídeo (como pNL4.3) com 1 mL de meio essencial mínimo isento de soro e adicione o polyethylenimine (PEI) solução (25.000 mW, 1 mg/mL pH 7) em 4,5 µ l por 1 µ g de DNA. Incubar durante 10 minutos a RT e adicionar gota a gota para as células de 293T.
    5. 24 h após a transfeccao, remover o meio e substituí-lo com 6 mL de DMEM completo contendo RNase-livre de DNase em 20 U/mL de meio. Após 6 h, substitua o médio com 10 mL de DMEM completo.
    6. 48 h após a transfeccao, colher o sobrenadante e filtrar através de um filtro de 0,22 µm, utilizando uma seringa de 10 mL, em um tubo de polipropileno de 15 mL.
    7. Adicione 2 mL de estéril 20% de sacarose em 1 x salina tamponada fosfato (PBS) para um tubo se open-tops de paredes finas. Lentamente a sobreposição a sacarose com a célula filtrada sobrenadante.
    8. Centrífuga para 1 h 15 min a 134.000 x g a 4 ° C, usando um se.
    9. Retire os tubos do se cuidadosamente. Lentamente, tire o sobrenadante e sacarose usando uma aspiração ou uma pipeta. Usar uma pipeta menor e incline o tubo quando estiver retirando a última solução de sacarose. Deixe o vírus granulado no fundo do tubo.
      Nota: A pelota não será visível.
    10. Adicionar 200 µ l de PBS 1x, deixe na geladeira por 4 a 12 h, resuspenda e congelar em 20 alíquotas µ l a-80 ° C.
    11. Determinar a p24Gag conteúdo usando o kit de um antigénio p24 do HIV-1 ELISA (seguir indicações do fabricante).
  2. Infecção de linha de células T.
    1. Cultura de uma linha de células T imortalizada (ex., células CEM-SS) em meio de Roswell Park Memorial Institute (RPMI) 1640 suplementado com 10% FBS e 1% penicilina/estreptomicina (RPMI completo). Conte as células usando um hemocytometer18 e sementes 1 bem por amostra com 1 mL de RPMI completo com 2 x 106 células/mL em uma placa de cultura de células de formato 12-bem.
    2. Adicionar partículas de HIV-1 equivalente a 150 ng p24amordaçar e coloque a placa em um balanço centrifugar balde com tampas de biocontenção spin-infectar por centrifugação em uma centrífuga de bancada para 2 h a 2.000 x g a 30 ° C.
    3. Remover a placa da centrífuga e deixe-a descansar por 1h em uma incubadora de padrão de cultura de tecidos em 37 ° C e 5% de CO2.
    4. Para lavar entrada vírus, recolher pilhas, transferindo as suspensões celulares de microcentrifuga tubos e centrifugação numa microcentrifuga no RT (RT) a 500 x g por 2 min. Tire o sobrenadante sem perturbar o centrifugado.
    5. Resuspenda as pelotas de células em 1 mL de pré-aquecido (37 ° C), PBS 1x estéril. Repeti a centrifugação, remoção de sobrenadante e ressuspensão passos mais duas vezes.
    6. Centrifugue novamente, retire o sobrenadante e ressuspender as pelotas de células em 1 mL de RPMI completo. Adicione cada suspensão a um poço em um prato bem 12 novos.
    7. Em adição pós inicial de 6 h de vírus (post-centrifugação de 4h), colha as células por centrifugação como feito na etapa 1.2.4. Remover e descartar o sobrenadante. As pelotas de célula podem ser congeladas a-80 ° C ou processadas diretamente para extração de DNA.

2. DNA extração, quantificação de DNA do HIV-1 e enriquecimento por captura híbrida

  1. Extrair o DNA de células inteiras com um tecido e sangue total DNA extração kit seguindo o manual do kit para células de cultura de tecidos. A única mudança é a eluição em 200 µ l de nuclease livre H2O, em vez do tampão de eluição fornecido.
    Nota: Após a adição de tampão de Lise caotrópicas (do kit "AL tampão") e da protease, amostras podem ser removidas do laboratório de contenção de biossegurança e manipuladas em um laboratório de nível de segurança padrão para o resto do protocolo.
  2. Determine o número de cópia de cDNA de HIV-1 por qPCR.
    1. Leve 17 µ l do eluato da etapa 2.1 e adicionar 2 µ l de tampão de enzima de restrição x 10 juntamente com 1 µ l da enzima de restrição DpnI. Incube durante 1 h a 37 ° C para remover qualquer potencial residual entrado plasmídeo de transfeccao.
    2. Realizar qPCR para subtração-vertente forte-paragem do cDNA usando o seguinte conjunto de sonda de primeira demão: oHC64 (5 '-taactagggaacccactgc-3 ') e oHC65 (5 '-gctagagattttccacactg-3 ') e sonda oHC66 (5 '-FAM-acacaacagacgggcacacacta-TAMRA-3. '). instalação de qPCR e condições exatas podem ser encontradas nas referências6,13. Transporte ao longo de amostras com uma diluição serial do plasmídeo proviral pNL4.3 como uma curva padrão para determinar o número de cópias de moléculas de cDNA.
      Nota: Veja a discussão para as quantidades esperadas.
  3. Enriquecimento do DNA do HIV-1 por captura híbrida.
    Nota: Deste passo em frente, é preferível usar microcentrifuga tubos com propriedades de vinculação de baixo teor de ácido nucleico, bem como pontas de pipetas de filtro de aerossol para todas as amostras de DNA. Se possível, trabalha em uma estação de trabalho do PCR. Todas as etapas e os reagentes estão no RT (RT) a menos que indicado o contrário.
    1. Para preparar uma mistura de mestre de grânulos magnético streptavidin, Pipete 100 grânulos µ l por amostra em um tubo único microcentrifuga. Coloca o tubo em um ímã adequado para tubos microcentrifuga.
    2. Depois que os grânulos se instalaram em direção ao lado do ímã do tubo (~ 1 min), tire o buffer de armazenamento, retire o tubo do ímã e Resuspenda grânulos em 500 µ l do bind e lavar buffer (buffer de BW, 5 mM Tris-HCL pH 7,5, 0.5 mM EDTA 1 M NaCl) para lavar.
    3. Colocar o tubo no ímã, remover o sobrenadante e adicionar 500 µ l de solução de caseína. Tomar do íman, resuspenda e incubar durante 10 minutos a RT e, em seguida, lave com buffer de BW.
      Nota: Uma lavagem refere-se a colocação do tubo sobre o ímã, tirando o sobrenadante, tendo o tubo fora do ímã, adicionando o buffer e resuspending.
    4. Coloque o íman em forma de tubo, tire o sobrenadante e ressuspender grânulos em 500 µ l de tampão de BW. Adicione 50 pmol de cada captura oligonucleotides biotinilado (ver tabela 1, três oligos neste caso) por amostra. (Por exemplo, se 5 amostras de DNA devem ser processadas, 500 µ l de grânulos magnéticos de passo 2.3.1 e 250 pmol de cada do oligonucleotide de usar).
    5. Incube durante 30 min à RT enquanto balançando em um misturador de extremidade-sobre-extremidade.
    6. Lave os grânulos com os oligonucleotides imobilizados duas vezes com 500 µ l de buffer dez de x 1 (10 mM Tris HCl pH 8,0, 1 mM EDTA, 100 mM de NaCl).
    7. Resuspenda grânulos em 10 µ l de buffer de 10 x 1 por amostra.
    8. Para cada amostra rotular um tubo de microcentrifugadora e adicionar 10 µ l de suspensão de grânulos, 170 µ l de DNA (da etapa 2.1) e 90 µ l de 3x do buffer de dez. Incube em um bloco de calor seco a 92 ° C por 2 min desnaturar o DNA.
    9. Mover-se para um bloco diferente de calor seco, que é definido como a 52 ° C, os tubos e incube durante 1 h. invertido para misturar regularmente (~ cada 10min) durante esta incubação.
    10. Lave uma vez com 500 µ l de tampão de dez 1x e Resuspenda em µ l 35 livre de nuclease H2O.
    11. Para eluir, incube os tubos a 92 ° C, em um bloco de calor seco por 2 min. Em seguida, mover-se rapidamente os tubos para o ímã (um tubo de cada vez). Depois que os grânulos estão vinculados ao lado do tubo, transferi o sobrenadante contendo o DNA do HIV-1 para um tubo de fresco.
    12. Opcional: Repetir qPCR (como feito no passo 2.2.2) para determinar o cDNA recuperado do HIV-1.
      Nota: Veja a discussão para as quantidades esperadas.

3. adaptador ligadura

  1. Preparando o adaptador
    1. Resuspenda adaptador liofilizado (ver tabela 1 "Kwok full + MiSeq") em 100 µM em livre de nuclease H2O.
    2. Por exemplo, mais uma amostra de controlo, combinar 0,45 µ l de 10 x T4 DNA ligase buffer, 4 µ l do adaptador e 0,05 µ l de nuclease livre H2o calor O. a 92 ° C por 2 min e deixe cada arrefecer lentamente.
      Nota: Se a opção estiver disponível, use uma máquina PCR com taxa de resfriamento ajustável (2% de taxa de uso). Isso leva cerca de 30 min de 92 ° C a 16 ° C. Como alternativa, use um bloco de calor seco a 92 ° C e desligue. Retire o adaptador mastermix quando o bloco de calor está de volta ao RT Isto é deixar o adaptador formam uma estrutura de gancho de cabelo (ver Figura 2b).
  2. Prepare uma reação de controle com um conjunto de oligonucleotídeos sintetizados (ver quadro 2), em vez de DNA extraído de células.
    1. Fazer reservas de 100 µM do oligonucleotide cada. Misture 1 µ l de cada um dos 17 oligonucleotídeos e adicione 8 µ l de H2O para uma relação equimolar em um volume final de 25 µ l.
    2. Dilua a mistura 1:2,500 em livre de nuclease H2O, em uma diluição de série. Combine 1 µ l da mistura com 17,3 µ l de nuclease livre H2O usar na ligadura de amostra de controle na etapa 3.3.1 para que cada oligonucleotide está presente em fmol 1.6 (equivalente a 0,026 nM na reação de 60 µ l).
  3. Criação de ligadura
    1. Para reações de volume final 60 µ l em cadeia da polimerase combinam 6 µ l de 10 x T4 DNA ligase buffer, µ l 24 de 40% PEG, 6 µ l de 5m betaína, 4,5 µ l (400 pmol) do adaptador (pre-annelead como na etapa 3.1.2), 1,2 μL de T4 DNA ligase (2.000.000 unidades/mL) e 18.3 µ l de DNA (a partir de Passo 2.3.11)
      Nota: Tenha especial cuidado com soluções viscosas, como 40% PEG manter volumes precisos. Não faça um mastermix.
    2. Configura a mesma reação como realizado na etapa 3.3.1 mas com o controle do oligonucleotide mistura preparada no passo 3.2.2.
    3. Misture as reações bem e incubar durante uma noite em uma máquina PCR a 16 ° C.

4. adaptador remoção e separação de tamanho

  1. Eletroforese em gel de desnaturalização
    1. Adicione 30 µ l de formamida, contendo gel de ADN carregando buffer para cada reação da ligadura. Misture bem por pipetagem.
    2. Aqueça por 2 min a 94 ° C, na máquina PCR e, em seguida, colocar imediatamente no gelo.
    3. Coloque um pré-moldado 6% Tris/borato/EDTA (TBE) desnaturação ureia gel de poliacrilamida (pente 10-bem) em um tanque de gel apropriado. Adicionar 1 buffer de execução x TBE (89 mM Tris-base, o ácido bórico 89 mM, EDTA 2 mM) e pre-funcione o gel por 20 min em constante de 250 V/máx.
    4. Lave os bolsos de gel com executando o buffer usando uma seringa e agulha 21G.
    5. Carga cada 90 µ l da amostra em três poços (30 µ l por alvéolo) e executar por 20 min (250 V/max) até a frente do corante azul escuro é sobre incompletamente através do gel.
  2. Coloração e corte os ácidos nucleicos do gel
    1. Prepare 3 tubos pequenos microcentrifuga (0,5 mL) por exemplo, abrindo buracos na parte inferior, usando uma agulha de seringa 21G (tome cuidado ao trabalhar com objectos cortantes). Cada um dos tubos preparados inserir um tubo de microcentrifugadora de 2,0 mL e rotulá-los com o nome de amostra mais "baixo", "mid" ou "alta".
    2. Tirar e abrir a gaveta do gel. Corte o gel verticalmente com uma lâmina de barbear para excisar generosamente a tira com 3 poços de amostras carregados. Adicione a faixa de gel para um recipiente com 1x TBE (cerca de 30 mL) e 5 µ l de mancha de ácido nucleico cianina. Incube durante 3-5 min.
      Nota: A etapa de extração do gel é particularmente sensível à contaminação. É aconselhável executar somente 1 amostra por gel e usando um recipiente limpo, separado para cada coloração do gel. Luvas devem ser mudadas se partículas de gel de contato de dedos com a luva.
    3. Limpe a superfície de um transiluminador de luz azul com DDQ2O. Pegue o pedaço de gel de fora do recipiente de coloração e adicioná-lo para a caixa de luz.
    4. Ative a caixa de luz e inspecionar os ácidos nucleicos manchados através do filtro laranja.
      Nota: O adaptador normalmente aparece sobrecarregado e é executado como uma grande "bolha" com ligados DNA HIV-1, correndo acima como uma raia.
    5. Usar uma nova lâmina de barbear, cortar os lados do gel se existem áreas com nenhuma amostra carregada ainda presente. Em seguida, corte logo acima do adaptador para remover o adaptador e menor gel peças. Finalmente, cortar o topo do gel, incluindo cerca de 1 mm do gel bolsos, que muitas vezes têm um sinal intenso afiada de maior peso molecular DNA.
    6. Dividir a parte restante do gel que contém a amostra, que é tipicamente ~ 2 x 3 cm no tamanho, na horizontal em três partes mesmo: "baixa", "média" e "alto" peso molecular áreas.
      Nota: Cada peça vai agora ser tratada separadamente [IE., haverá três tubos (baixa, média e alta)] por amostra original.
    7. Cada um dos fragmentos do gel de três cortar em pedaços menores (~ 2 x 2 partículas mm) e transferi-los para os tubos de microcentrifuga preparado 0,5 mL (passo 4.2.1).
    8. Girar em alta velocidade com tampas abertas por 1 min espremer os pedaços de gel através do orifício do tubo de 2 mL para criar uma gel de lama. Se qualquer gel de partículas permanecem no fundo do tubo de 0,5 mL, transferi-los para o tubo 2 mL manualmente usando uma ponta de agulha ou pipeta.
  3. Extração de DNA
    1. Adicione 1 mL de tampão de extração de gel de ureia (0,5 M NH4CH3CO2, 1 mM EDTA, 0,2% SDS) para a gel de lama. Gire os tubos por um período mínimo de 3 h (durante a noite é aceitável) em RT com um misturador de extremidade-sobre-extremidade.
    2. Use um limpo conjunto de pinças para adicionar um filtro de fibra de vidro redonda pequena para colunas de centrífuga com filtros de membrana de acetato de celulose (0,2 µm), que evita o entupimento da membrana. Coloque o filtro no lugar com uma ponta da pipeta invertida.
    3. Brevemente, girar os tubos de 2 mL com amortecedor de lama e extração de gel numa microcentrifuga e transferir 700 µ l do sobrenadante para as colunas de filtro preparado. Mantenha o gel de lama e restante sobrenadante.
    4. Centrifugar as colunas do filtro em microcentrifuga à velocidade máxima de 1 min. o flowthrough de transferência para um novo tubo de microcentrifuga de 2,0 mL.
    5. Recarrega as colunas com o restante do sobrenadante. Tente obter tanto líquido quanto possível da extração de lama. Transferência de gel de peças não é uma preocupação. Gire novamente e combinar flowthroughs das mesmas amostras de extração.
  4. Precipitação do DNA
    1. Adicione 3 µ l de polyA RNA (1 µ g / µ l; como um portador), 1 µ l de glicogênio e 0,7 mL de isopropanol para o flowthrough da etapa 4.3.5. Vórtice brevemente e congelar a-80 ° C durante a noite.
    2. Tirar amostras do freezer-80 ° C e deixe-os descongelar brevemente. Colocá-los em uma microcentrifuga de refrigeração (4 ° C) e a centrifugação por 30 min na velocidade máxima.
    3. Remover e descartar o sobrenadante. Tenha muito cuidado para não retirar o chumbo. Deixe de 30 a 50 µ l de líquido se é incerto de que pelotas seria removida caso contrário.
      Nota: Normalmente todas as amostras de "altas" mostram uma pelota mais visível do que amostras "mid" e "baixas".
    4. Adicione 800 µ l de etanol 80%. Inverta os tubos e girar novamente por 1 minuto na velocidade máxima. Remover a maioria de etanol com uma pipeta, brevemente girar os tubos novamente e remova mais etanol com uma pipeta de volume menor.
    5. Deixe qualquer restante etanol evaporam, colocando os tubos com uma tampa aberta em um bloco de calor seco de 55 ° C. Quando as amostras são seco (2-4 min) adicionar 20 µ l de nuclease livre H2O e espalhados em redor da parte inferior do tubo para assegurar a pelota do ADN é dissolvido. A amostra de DNA pode ser armazenada a-20 ° C.

5. PCR amplificação e preparação de biblioteca

  1. Configurar uma reação de PCR de 40 µ l com 20 µ l de DNA polimerase pré-mix, 18 µ l de precipitado e evapora o DNA da etapa 4.4.5, 1 µ l de primer para a frente "MP1.0 + 22HIV" (10) (ver tabela 1) e 1 µ l de oligo multiplex primers (iniciadores de índice 1 a 24) (ver tabela de Ma materiais).
    Nota: Execute as três reações (baixo, médio, alto) de cada amostra em reações de PCR separadas, mas com o mesmo indexados a primeira demão. Use um índice diferente para cada uma das amostras infecção original.
    1. Executar as reações de PCR nas seguintes condições: 2 min a desnaturação de 94 ° C e, em seguida, 18 ciclos de PCR 3-passo; 15 s à desnaturação de 94 ° C, 15 s recozimento a 55 ° C e 30 s extensão a 68 ° C.
  2. Como uma opção de controle de qualidade, analise as reações de PCR com alta sensibilidade automatizado sistema de electroforese do gel. Tome 2 µ l de amostra de baixa, média e alta para executar conforme instruções do fabricante.
    Nota: As duas primeiras demão devem ser visível e muitas vezes executar em uma extensão calculada sobre 45 e 95 nt (comprimento real é diferente). Além disso, o DNA deve ser detectada entre 150 a 500 nt. Se o sinal não está presente, é aconselhável adicionar adicionais ciclos PCR, entre 2 e 10 ciclos adicionais. Não adicione ciclos adicionais para as amostras de controle do oligonucleotide criados na etapa 3.3.2.
  3. Para remover as primeiras demão usam um sistema de limpeza PCR baseado no grânulo paramagnético.
    1. Tome 20 µ l de cada reação de PCR e piscina as amostras juntas (misturar todas as amostras neste ponto). Congelar as restantes 20 reações de µ l como backups a-20 ° C.
    2. Deixe os grânulos paramagnéticos vir a RT e misturar as reações de PCR em pool com 1,8 x o volume da solução do grânulo. Misture por pipetagem e incubar durante 5 min.
      Nota: Como um exemplo, se 4 amostras foram preparadas e cada um tem reações de baixas, média e altas, o volume seria 4 x 3 x 20 µ l = 240 reações de PCR µ l com uma solução de grânulo de 432 µ l.
    3. Colocar os tubos em um ímã de tubo microcentrifuga, deixe os grânulos bind para ~ 1 min e tirar o sobrenadante para descarte. Deixe os tubos sobre o ímã e adicione 500 µ l de etanol 80%.
    4. Deixe o etanol por 30 s, então tire completamente e deixe-o muito de grânulos para ~ 5 min. Adicione 40 µ l de nuclease livre H2O, levar os tubos fora do ímã e pipetar subindo e descendo várias vezes.
    5. Deixar a suspensão por 5 min. Coloque o tubo de volta sobre o ímã, deixe os grânulos resolver para o lado e transferir o sobrenadante para um tubo novo. Esta é a biblioteca. Tirar um 10 µ l alíquota para controles de qualidade e congelar o resto a-20 ° C.

6. avaliar a biblioteca

  1. Determine a qualidade da biblioteca, concentração e molaridade.
    1. Use um método de quantificação fluorométrica. Medir 1 µ l e 3 µ l da biblioteca com um kit de ensaio de dsDNA de alta sensibilidade conforme as instruções do fabricante.
      Nota: Concentrações típicas estão entre 1 e 10 ng / µ l.
    2. Medida do espectro de peso molecular de DNA Biblioteca pela alta sensibilidade automatizado electroforese do gel como descrito acima (passo 5.2).
    3. Uso o automatizado análise de eletroforese para determinar o peso molecular médio da biblioteca do gel e calcular para diluir a biblioteca livre de nuclease H2O 4 nM. Várias bibliotecas podem ser combinadas, enquanto todos os índices são exclusivos.
  2. Opcional baixa taxa de transferência controle de qualidade
    1. Sujeito a biblioteca de DNA para TA19 de clonagem para inserir moléculas de biblioteca de vetores para a amplificação. Siga as instruções do kit, crescem para fora de ~ 10-20 colônias e extrato de DNA através de miniprep protocolos, conforme descrito aqui20.
    2. Vetor de sequência usando serviços de sequenciamento local e verificar que as inserções contenham o HIV-1 desejada derivada sequências e adaptadores específicas da biblioteca.

7. high-Throughput sequenciamento Run

  1. Crie uma folha de amostra de sequenciamento com o software comercial fornecido com a plataforma de sequenciamento.
    1. Indica o kit de sequenciamento selecionado. Normalmente, escolher um kit de 150-ciclo, mas outros são apropriados dependendo o comprimento desejado e leia.
    2. Selecione "Só Fastq" como o fluxo de trabalho do aplicativo. Escolha um dos modelos que contém os 24 índices presentes nos kits do oligonucleotide multiplex (indicados no manual do jogo).
    3. Selecione "25 nt" para Read1 e "125 nt" para Read2. Manter 6 nt para índice único ler.
      Nota: Na análise interna apenas Read2 é utilizado na análise. Manter Read1 com um mínimo de 25 nt para fins de algoritmo de plataforma de sequenciamento.
  2. Siga as instruções do fabricante, precisamente para a preparação de biblioteca pre-execução e instalação. Optar por no máximo 20 pM concentração e uso um pico de PhiX de 15%, como a biblioteca é de pouca complexidade.

8. análise de dados

  1. Verifica se a porcentagem do filtro de passagem e pontuação de qualidade média Q30 é aceitáveis conforme orientações do fabricante de plataforma de sequenciamento.
    Nota: O filtro passa normalmente é > 90% e Q30 pontuações são tipicamente > 80%.
  2. Baixar o. fastq.gz arquivos de cubo de sequenciamento do fabricante.
  3. Configurar o script de sequenciamento
    1. Criar um novo diretório (pasta) chamado "AnalysisXYZ" e ir para https://github.com/malimlab/seqparse para baixar todos os arquivos de código fonte (parse_sam.pl, rc_extract.pl, parse.sh) para este diretório.
    2. Baixe o alinhador curto-leitura Bowtie, versão 1.1.2, http://bowtie-bio.sourceforge.net/index.shtml no mesmo diretório.
    3. A transferência cria um subdiretório dentro de "AnalysisXYZ" chamado "Bowtie-1.1.2". Dentro deste diretório aberto subdiretório "índices" e baixe as sequências de modelo fornecido consistindo de 6 arquivos com extensões de .ebwt.
    4. Baixe o lê curto FASTQ/A pré-processamento toolkit fastx-0.0.13 do http://hannonlab.cshl.edu/fastx_toolkit/download.html para o diretório "AnalysisXYZ".
    5. Faça o download de bam-readcount (https://github.com/genome/bam-readcount) e Samtools (https://sourceforge.net/projects/samtools/files/) para o diretório "Documentos".
  4. Mover o. fastq.gz arquivos, baixados no passo 8.2, de tudo ler 2s (terminados em... _R2_001.fastq.gz) para o diretório "AnalysisXYZ".
  5. Abra o terminal/console de comando. Mover para o "AnalysisXYZ" como o diretório atual usando comandos de cd. Digite "./parse.sh." para executar os scripts.
  6. Encontrar os arquivos. csv com resumos para todas as amostras na contagem total de leitura, comprimento ajustado ler contagens e normaliza as contagens de leitura, bem como arquivos com a variação de base, para cada amostra em um diretório chamado parse_results dentro do diretório "Análise XYZ".
    Nota: Veja a discussão para mais informações sobre o processo de análise. O script retorna arquivos csv com totais leituras para cada nucleotídeo ao longo do HIV-1NL4.3 forte-paragem sequências e primeira vertente transferência até nucleotídeo 635. Como uma orientação, leituras originais de 50.000 a 100.000 são normalmente observadas em amostras de infecções com os números de telemóvel indicado e inóculos virais e sem proteínas antivirais ou compostos. As amostras de controlo do oligonucleotide geralmente produz leituras de 100.000 a 200.000.

Representative Results

A técnica descrita neste artigo foi aplicada a um estudo mais amplo para abordar os mecanismos subjacentes a inibição da transcrição reversa de HIV-1 pela proteína humana anti-retroviral APOBEC3G (A3G)6. A Figura 3 mostra os resultados representativos obtidos após empregando o protocolo em amostras de CEM-SS T-células infectadas com vif-HIV-1 deficiente na ausência ou presença de A3G. O número total de leituras originais obtidos de cada amostra após filtrar quaisquer duplicatas PCR que têm o mesmo 6 nt código de barras e o mesmo comprimento (interpretada pelo software de análise fornecido) são plotados na Figura 3um. Os níveis crescentes de A3G reduzem o número total de leitura refletindo o efeito inibitório de A3G na síntese de cDNA RT mediada anteriormente descrito e medido por qPCR6,13,21,22. Na Figura 3b, a fração de moléculas em cada comprimento possível dentro da primeira 182 nt são mostrados. Para a infecção de HIV-1 na ausência de A3G, a espécie mais abundante é a principal 180 nt forte-paragem molécula em si, com um acúmulo de leituras no intervalo mais curto (23 a 40 nt) (top histogramas de gráfico, azul). A adição de alterações A3G este perfil como um aumento acentuado de mais curto, truncado de moléculas de cDNA em algumas posições muito específicas, podem ser reproduzidas é detectado (gráficos de médios e baixos). Desde A3G é um deaminase citidina, citosina-para-uridina (identificado como C-a-T) ocorrer mutações no cDNA quando A3G está presente na infectante virions21,23,24. Usando as informações obtidas em sequência, a percentagem de mutações G-para-T foi plotada no gráfico mesmo (linha pontilhada vermelha). Deve notar-se que o perfil mutacional é derivado de leituras todos originais combinadas e cobertura de cada nucleotídeo irá variar. No entanto, se necessário, informações de sequência podem ser relacionadas para cada molécula e correlacionadas com um específico 3'-terminal. Os dados fornecidos foram tirados de Pollpeter et al . 6 e a correlação entre mutacional e perfis de comprimento do cDNA demonstrou-se ser devido à deteção e clivagem do cDNA desaminada pelo celular máquinas de reparação do DNA.

Um controle positivo para a abordagem de 3'-mapeamento facilmente pode ser produzido por um pool de oligonucleotides sintéticos de sequência conhecida, comprimento e concentração de processamento. Este controle é adicionado durante a ligadura do adaptador na etapa 3.3.2 e aconselhado a ser incluído em todas as bibliotecas multiplexadas. Dados obtidos de uma amostra de controle devem ter todos os oligonucleotides dos rácios de entrada esperados, com leituras de fundo apenas muito pequenas. A Figura 4 mostra os resultados de um conjunto de controlo positivo de 17 oligonucleotides quimicamente sintetizados (sequências, ver tabela 2), que foram misturadas em relações equimolar. Como esperado, todas as moléculas aparecem no próximo igual abundância com apenas pequenas variações (gráfico superior). Enquanto a maioria das posições dentro da sequência de DNA - sss não foram representados por do oligonucleotide retornam zero contagens de leitura, observamos espécies menores que são 1 ou 2 nt mais curto que os oligonucleotides controle real. Nós não temos investigado ainda mais estas espécies menores, mas suponha que eles representam degradados ou incompletos produtos potencialmente presentes nas ações do oligonucleotide fornecido na compra (oligonucleotídeos foram ordenados como HPLC purificado, para que o fabricante indica > 80% de pureza). O gráfico de baixo mostra a amostra de controle de uma biblioteca diferente de correr, onde a variação é ligeiramente mais elevada entre os 17 oligonucleotides e correlaciona-se com o comprimento total, em que mais moléculas de controle são detectadas com mais eficiência e curtos. Isto pode ser devido a um menor viés em reações de PCR ou em cluster durante o sequenciamento de MiSeq, que tem uma inserção ótima de tamanho e pode ocorrer com bibliotecas carregando particularmente amplo inserir intervalos. Uma forma básica para abordar este viés é a aplicação de um factor de normalização com base na encosta que indica o viés correlacionando ao comprimento da molécula (linha rosa). Os cálculos necessários estão incluídos no programa de análise (ver passo 8.3 no protocolo).

Figure 1
Figura 1: diagrama mostrando os primeiros passos do HIV-1 inverter transcrição. O processo começa com o recozimento de tRNA(Lys,3) (laranja) para o sítio de ligação do primer (PBS) no genoma RNA viral (etapa 1), que permite a iniciação e alongamento do cDNA viral (azul, passo 2). Concomitantemente, o modelo RNA genômico é degradado pela atividade RNaseH do RT (etapa 3). O primeiro intermediário completo no processo de transcrição reversa a subtração-vertente forte-stop (-) do cDNA de sss, que é completa quando a polimerização RT catalisada atinge o 5'-terminal da região de (R) repetição gRNA (etapa 3). O sss (-) intermediário é transferido para o 3'-terminal do modelo de RNA genômico por recozimento para complementares terminal 3'-longa repetição (LTR) R região. A partir daqui, a polimerização continua (passo 4). O método descrito a progressão de transcrição reversa é determinada pelo mapeamento o comprimento exato do cDNA viral nascente (azul). PPT, trato de polypurine; U5, 5'-sequência única; U3, 3'-sequência única. Esta figura é republicada de uma anterior publicação6. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : Contorno de fluxo de trabalho e esquemas da ligadura do adaptador e estratégia de amplificação do PCR. (a) trabalho delineando as principais etapas da técnica descrita para determinar 3'-termini do HIV-1 inverter transcritos em células infectadas. A figura é uma adaptação de uma anterior publicação6. (b) diagrama esquemático da estratégia de amplificação do PCR e ligadura do adaptador. Moléculas de cDNA nascente de comprimento variável que foram purificadas nas etapas anteriores são ligadas a um adaptador de single-stranded DNA usando T4 DNA ligase. O adaptador do gancho de cabelo (nomeado "cheia Kwok + MiSeq", ver tabela 1) projeto foi inspirado por Kwok et al. 11. o adaptador carrega uma aleatória 6 sequência de código de barras nt, que permite o emparelhamento de base para facilitar a ligadura e simultaneamente, serve como um identificador para leituras originais. O 3'-termini do adaptador carrega um espaçador (SpC3) para evitar auto da ligadura. Produtos ligados são separados em excesso adaptador por desnaturação de eletroforese em gel de poliacrilamida (PAGE). Ácidos nucleicos no gel são manchados e corte em três pedaços de gel separados, de tamanho igual na área acima do adaptador para o poço como feito em25. Após a eluição, precipitação e ressuspensão, os produtos são PCR amplificado com primers recozimento para a sequência conhecida do adaptador (cartilha 1, kit de multiplex do oligonucleotide, consulte Tabela de materiais) e uma primeira demão carregando a primeira 22 nt do HIV-1 Sequência de 5'-LTR imediatamente após o tRNA (cartilha 2, MP1.0 + 22HIV). O 5'-termini dos primers escolhidos levar adaptadores para a plataforma de sequenciamento escolhido (P5 e P7) bem como uma sequência de índice para distinguir amostras individuais executadas na mesma biblioteca. Pontos de partida da sequenciação de ler cartilhas são indicadas. A caixa azul indica a região de interesse, para determinar a original 3'-termini da molécula capturada. Esta figura é uma adaptação de uma anterior publicação6. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 : Resultados representativos. (a) a contagem total de leitura de amostras representativas, processadas com o protocolo descrito. Isso inclui todas as sequências que foram identificadas como únicas leituras de moléculas de HIV-1, com seus 3'-termini dentro o primeiro 635 nt de menos vertente do cDNA (até o PPT, ver Figura 1). Infecção com HIV-1 não carregando A3G produz o maior número de leituras, Considerando que A3G inibe a síntese do cDNA e reduzindo o total de ler a contagem. Células não infectadas serviram como um controle negativo, enquanto um conjunto de oligonucleotídeos sintéticos fornece um controlo positivo. b) a abundância relativa de cDNAs para cada comprimento entre as posições nt 23 e 182 (cDNA completos - sss é 180 a 182 nt) do HIV-1NL4.3 sequência (eixo x) é mostrada em azuis histogramas (escala no eixo y esquerdo). A abundância relativa de cDNA foi calculada a partir do número absoluto de sequências de terminação em um determinado nucleotídeo dentro da sequência de cDNA - sss, dividido pela soma de todas as leituras de medição 182nt ou menos. São mostradas em linhas vermelhas tracejadas as percentagens de leituras carregando mutações C-a-T/U na respectiva posição (escala nos eixos certo y). Figura 3 b for republicada de uma anterior publicação6. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4 : Resultados representativos das amostras controle. São mostrados dois perfis para piscinas, contendo uma quantidade equimolar de 17 oligonucleotides sintéticos de comprimento diferente. Estes oligonucleotídeos ter sequências de HIV-1NL4.3 e foram selecionados para cobrir vários comprimentos e apresentar todas as 4 bases como um 3'-nucleotídeo (ver quadro 2). O gráfico superior mostra a amostra de controle positivo da Figura 3uma. Nenhum viés significativo no sentido do comprimento da molécula ou a aberto 3'-termini é detectado. O gráfico inferior mostra uma biblioteca diferente executar, que produziu um viés de menor comprimento de sequenciamento. Neste caso, é aconselhável aplicar um fator de normalização, que é derivado de encosta (mostrada em rosa) que representa o viés de tamanho. Esta figura é republicada de uma anterior publicação6. Clique aqui para ver uma versão maior desta figura.

Nome de oligo Comprimento no nt Sequência de Finalidade Fabricante (purificação)
Full Kwok + MiSeq 61 5'-PHO-tgaagagcctagtcgctgttcannnnnnctgcccatagagagatcggaagagcacacgtct-SpC3-3' Adaptador Tecnologias de DNA de IDT (HPLC)
2xBiotin SS isca 40 5'-biotina-cagtgtggaaaatctctagcagtggcgcccgaacagggac-biotina-3' Captura híbrida MWG Eurofins (HPLC)
Ss de biotina 1-16 22 5'-cagtgtggaaaatctctagcag-BiTEG-3' Captura híbrida MWG Eurofins (HPLC
TRNA biotina + CTG 16 5'-cagtggcgcccgaaca-BITEG-3' Captura híbrida MWG Eurofins (HPLC)
MP1.0 + 22HIV 82 5'-aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatctcactgctagagattttccacactg-3' Amplificação por PCR MWG Eurofins (HPLC

Tabela 1: tabela de oligonucleotídeos incluindo comprimento, sequências e modificações que são utilizadas no protocolo descrito. A tabela é adaptada de uma anterior publicação6Clique aqui para baixar esta tabela como um arquivo do excel.

Nome de oligo Comprimento no nt Sequência de Fabricante (purificação)
HTP con C longo 120 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaagc-3' MWG Eurofins (HPLC)
HTP con longa G 119 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaag-3' MWG Eurofins (HPLC)
HTP con T tempo 116 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggctt-3' MWG Eurofins (HPLC)
HTP engodo de um longo 118 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaa-3' MWG Eurofins (HPLC)
Golpe HTP meados C 76 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcac-3' MWG Eurofins (HPLC)
HTP con meado G (a) 71 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacg-3' MWG Eurofins (HPLC)
HTP con meado G (b) 72 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgg-3' MWG Eurofins (HPLC)
Golpe HTP meados A 69 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacaga-3' MWG Eurofins (HPLC)
Golpe HTP meados T 85 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactt-3' MWG Eurofins (HPLC)
HTP engodo um curto 40 5'-ctgctagagattttccacactgactaaaagggtctgaggga-3' MWG Eurofins (HPLC)
HTP con T curto 33 5'-ctgctagagattttccacactgactaaaagggt-3' MWG Eurofins (HPLC)
HTP con G curto 41 5'-ctgctagagattttccacactgactaaaagggtctgaggg-3' MWG Eurofins (HPLC)
HTP con curta C 34 5'-ctgctagagattttccacactgactaaaagggtc-3' MWG Eurofins (HPLC)
HTP Con 46 (T) 46 5'-ctgctagagattttccacactg actaaaagggtctgagggatctct-3' MWG Eurofins (HPLC)
HTP-Con 83 (C) 83 5'-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactac-3' MWG Eurofins (HPLC)
HTP-Con 103 (C) 103 5'-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagc-3' MWG Eurofins (HPLC)
HTP Con 107 (A) 107 5'-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagcttta-3' MWG Eurofins (HPLC)

Tabela 2: tabela de 17 oligonucleotides de controle sintético usado como um exemplo positivo de controle. Os oligonucleotides top 13 foram escolhidos com base no tamanho [longo (116 a 120 nt), mid (69 a 85 nt), curto (33 a 41 nt)] assim como seus 3'-termini. A tabela é adaptada de uma anterior publicação6.  Clique aqui para baixar esta tabela como um arquivo do excel.

Discussion

A disponibilidade de rápido, confiável e econômica profunda sequenciamento revolucionou muitos aspectos no campo das Ciências da vida, permitindo grande profundidade nas análises baseada no sequenciamento. Um desafio restante situa-se no design inovador e criação de representante bibliotecas de sequenciamento. Aqui descrevemos um protocolo para capturar moléculas de cDNA viral nascente, especificamente os intermediários do processo de transcrição reversa do HIV-1.

O passo mais crítico no âmbito desta estratégia é a ligadura de um adaptador para o aberto 3'-termini de forma quantitativa e imparcial. Eficiências de ligadura entre dois ssDNA termini, ambos intere intramolecular, foram investigados e otimizado para várias aplicações11,26,,27,28,29. A escolha de usar um adaptador de gancho de cabelo com T4 DNA ligase nas condições descritas na etapa 3.3 resulta da otimização empírica, no qual foram avaliados diferentes ligases, adaptadores e reagentes para a ligadura dos oligonucleotides sintéticos que representam Sequências de HIV-1 (tabela 2) (dados não mostrados). Nessas reacções teste em vitro , confirmamos que o T4 DNA ligase mediada da ligadura do adaptador de grampo de cabelo, conforme descrito por Kwok et al. 11, tem um viés muito baixo e atinge perto de ligadura completa de moléculas aceitador quando o adaptador é usado em excesso. A eficiência da ligadura não foi afetada pela adição de uma sequência de nucleotídeos para processar o adaptador compatível para o sistema de multiplex da primeira demão (ver Figura 4). Em comparação, nós encontramos que um thermostable 5' do DNA/RNA ligase ("Ligase A", veja Tabela de materiais para exatas ligases comparado aqui), que é uma engenharia ligase de RNA que foi desenvolvido em parte para melhorar a eficiência da ligadura com ssDNA como o aceitador 27, foi realmente mais eficaz no ligando duas ssDNA moléculas do RNA ligase do ("Ligase B"), mas teve um viés significativo, com fortes diferenças na eficiência da ligadura nem oligonucleotides com diferenças de comprimento de base única [tabela 2 ; HTP con meados G (a) e (b)]. Além disso, encontramos apenas um mínimo viés em reações com "Ligase C", combinado com um adaptador carregando um estudo randomizado 5'-termini (uma estratégia usada para compensar o viés de nucleotídeos conhecidos de "Ligase C"; Veja, por exemplo, Ding et al. 30). no entanto, o "Ligase C"-mediada por ligadura intermoleculares estava incompletas, tornando o sistema de T4 DNA ligase a escolha superior.

Várias etapas de controle de qualidade sobre o curso do protocolo e a inclusão de controles positivos e negativos de permitam a detecção de problemas potenciais antes de continuação de ensaio e fornecem orientação para solucionar problemas de esforços. As quantificações de qPCR em passos 2.2.2 e 2.3.12 certifique-se que a quantidade de material a entrada é suficiente. Número de cópias de cDNA típicas na faixa de eluição (da etapa 2.1) 200 µ l de 10.000 cerca de 300.000 por µ l. A etapa de captura híbrida pode resultar em alguma perda de HIV-1 global do cDNA quantidade mas deve resultar em um forte enriquecimento do cDNA específico do HIV-1 sobre o DNA celular, que pode ser determinado usando-se primers adequados para quantificar o DNA genômico, antes e depois de enriquecimento por qPCR ou medindo a concentração de DNA total. Recuperado cDNA de HIV-1 após o híbrido capturar etapas deve ser pelo menos 10% da entrada. Baixa material começar caso contrário pode explicar um controlo positivo de sucesso do oligonucleotide (consulte a etapa 3.3.2) mas só limitado leituras alcançadas nas amostras. Baixo Leia números globais também poderiam ser explicados pela superestimação da concentração biblioteca devido à presença de espécies de DNA irrelevantes sem adaptadores de MiSeq. Isto resultaria em densidade baixa de cluster e pode ser melhorado através da determinação da concentração de sequências do HIV-1 na biblioteca por qPCR além da quantidade total de DNA por ensaios fluorométrica. Devido à natureza altamente sensível do método, especial cuidado para evitar contaminação nem de baixo nível, tanto a partir de outras amostras (em particular, as alta concentração controle do oligonucleotide das existências de), bem como de equipamento de laboratório. Nesse sentido, trabalhando em um UV para esterilização de estação de trabalho do PCR é benéfico. A eletroforese em gel automatizado da biblioteca final (etapa 6.1.2) é uma medida adicional de controle de qualidade. A gama de tamanho de ácido nucleico tipicamente observada é entre 150 a 500 nt. Primers que podem ser detectados no controle opcional após a PCR, e antes de purificação (ver nota na etapa 5.2) agora deve estar ausente. Em um resultado representativo, a curva de intensidade de amostra tem um pico em torno de 160 a 170 nt e uma segunda maior pico em torno de 320 a 350 nt. Isto provavelmente reflete a abundância superior muitas vezes visto em transcrições de reverso relativamente curtas (comprimento de inserção de nt de 1 a 20) e completos no forte-parada (comprimento de inserção de nt de 180 a 182) (Figura 3b).

Enquanto o protocolo apresentado e primers selecionados são específicos para início construções de transcrição reversa do HIV-1, o método é geralmente aplicável para qualquer estudo com o objetivo de determinar aberto 3'-termini de DNA. As principais modificações necessárias em outros contextos será o método de captura híbrida e a estratégia de projeto da primeira demão. Por exemplo, se o destino é ser adaptada ao finais transcrições de HIV-1, um número maior de diferentes capturando os oligonucleotides biotinilado recozimento em todo o comprimento do cDNA seria aconselhável e provavelmente irá diminuir a perda na etapa de captura híbrida. Como mencionado na introdução, é importante considerar as limitações ao projetar a gama sobre as quais 3'-termini é para ser detectado para evitar diferentes fontes de viés. Primeiro, pode haver um viés nas reações de PCR se os modelos com o adaptador são de comprimento vastamente diferentes. Em segundo lugar, a plataforma de sequenciamento usada aqui (por exemplo, MiSeq) tem uma gama de comprimento de inserção preferencial para clustering optimal, e significativamente mais curtos e mais produtos não podem ser sequenciados com a mesma eficiência. Em parte, isto pode ser resolvido computacionalmente, como foi feito através do cálculo de um fator de correção para o viés de comprimento linear (ver Figura 4, o gráfico inferior). No entanto, se a região de onde 3'-termini mapeamento é desejada é longa (> 1000 nt), é mais aconselhável dividir as reações com as transcrições ligadas e usar múltiplos primers upstream para avaliar 3'-termini em seções.

O programa de análise foi escrito internamente para a finalidade específica de analisar tanto o último nucleotídeo da sequência de HIV-1, adjacente à sequência de adaptador fixo, bem como a variação de base de todas as bases para identificar quaisquer mutações. Os passos individuais incluem o seguinte: primeiro, as sequências de adaptador são aparadas usando o toolkit de fastx-0.0.13; em seguida, as sequências que são duplicadas (significando sequências idênticas, incluindo o código de barras) são removidas. Todas as restantes leituras exclusivas então estão alinhadas para a sequência do HIV-1 usando gravata borboleta (http://bowtie-bio.sourceforge.net/index.shtml) com a incompatibilidade máxima definido em três bases. A sequência do modelo é composta o primeiro 635 nt do cDNA de HIV-1 (estirpe NL4.3), que inclui a sequência - sss e o primeiro produto de transferência de fio até a faixa de polypurine (U5-R-U3-PPT; consulte a Figura 1). Desse modo, o software fornecido e modelos são diretamente adequados se o método é usado para o mesmo aplicativo (detecção de início transcrições inversa do HIV-1NL4.3). Ajustes vão ter que ser feito para outras sequências de destino. As posições de 3'-termini para cada leitura foram determinadas pela posição no alinhamento. Chamadas de base para cada posição são gravadas e taxas de mutação são calculadas a partir da cobertura total de cada base, que varia, como as leituras são de comprimentos diferentes e inserções longas não podem ser inteiramente cobertas pelo sequenciamento de 125-base em Read2.

Para concluir, acreditamos que o método descrito para ser uma ferramenta valiosa para muitos tipos de estudos. Aplicações óbvias incluem investigações sobre os mecanismos subjacentes a inibição da transcrição reversa através de drogas anti-retrovirais ou fatores de restrição do celular. No entanto, apenas relativamente pequenos ajustes devem ser necessários adaptar o sistema de 3'-termini mapeamento dentro de outros single-stranded DNA viral produtos intermédios, que estão presentes, por exemplo, em replicação de Parvovírus. Além disso, o princípio do método, particularmente sua etapa de ligadura otimizada, pode fornecer uma parte do núcleo de design de preparação de biblioteca para a caracterização de quaisquer extensões de 3'-DNA, incluindo alongamentos catalisados por celular DNA dupla-hélice polimerases.

Disclosures

Os autores declaram que eles não têm nada para divulgar.

Acknowledgments

Os autores reconhecem o apoio de membros do laboratório Martins, Luis Apolonia, Jernej Ule e Rebecca Oakey. Os autores graças a Matt Arno do rei faculdade Londres Centro de genômica e Debbie Hughes no University College London (UCL), Instituto de Neurologia próxima geração sequenciamento facilidade, pela ajuda com o sequenciamento de MiSeq é executado. O trabalho foi apoiado por o UK Medical Research Council (G1000196 e senhor/M001199/1 a M.M.), a Wellcome Trust (106223/Z/14/Z a M.M.), sétimo programa-quadro da Comissão Europeia (FP7/2007-2013) no âmbito do acordo de concessão não. PIIF-GA-2012-329679 (a D.P.) e o departamento de saúde através de um institutos nacionais para atribuição de saúde abrangente de pesquisa Biomedical Research Center para o cara e St Thomas' NHS Foundation Trust em parceria com faculdade Londres do rei e do rei Hospital Universitário NHS Foundation Trust.

Materials

Name Company Catalog Number Comments
293T cells ATCC CRL-3216
Dulbecco's Modified Eagle's Medium Gibco 31966-021
Penicillin/Streptomycin Gibco 15150-122
Fetal Bovine Serum Gibco 10270-106
HeraCell Vios 250i CO2 Incubator Thermo Scientific 51030966
Laminar flow hood - CAS BioMAT2 Wolflabs CAS001-C2R-1800
10mm TC-treated culture dish Corning 430167
TrypLE™ Express (1x), Stable Trypsin Replacement Enzyme Gibco 12605-010
OptiMEM® (Minimal Essential Medium) Gibco 31985-047
HIV-1 NL4-3 Infectious Molecular Clone (pNL4-3) NIH Aids reagent program 114
Polyethylenimine (PEI) - MW:25000 PolySciences Inc 23966-2 dissolved at 1mg/ml and adjusted to pH7
RQ1- Rnase free Dnase Promega M6101
Filter 0.22 μm Triple Red Limited FPE404025
15 mL polypropylene tubes Corning CLS430791
Sucrose Calbiochem 573113
Phosphate Buffered Saline (1x) Gibco 14190-094
Ultracentrifuge tubes Beckman Coulter 344060
Ultracentrifuge Sorval WX Ultra Series Th-641 Rotor
Alliance HIV-1 p24 antigen ELISA kit Perkin Elmer NEK050001KT
CEM-SS cells NIH Aids reagent program 776
Roswell Park Memorial Institute Medium Gibco 31870-025
CoStar® TC treated multiple well plates Corning CLS3513-50EA
Benchtop centrifuge: Heraus™ Multifuge™ X3 FR Thermo Scientific 75004536
TX-1000 Swinging Bucket Rotor Thermo Scientific 75003017
Microcentrifuge: 5424R Eppendorf 5404000060
Total DNA extraction kit (DNeasy Blood and Tissue kit) Qiagen 69504
Nuclease free H2O Ambion AM9937
Cutsmart buffer New England Biolabs (part of DpnI enzyme) R0176S
DpnI restriction enzyme New England Biolabs R0176S
Oligonucleotides for qPCR MWG Eurofins N/A HPSF purification
TaqMan PCR Universal Mastermix Thermo 4304437
LoBind Eppendorf® tubes Eppendorf 30108078
Axygen™ aerosol filter pipette tips, 1000 μL Fisher Scientific TF-000-R-S
Axygen™ aerosol filter pipette tips, 200 μL Fisher Scientific TF-200-R-S
Axygen™ aerosol filter pipette tips, 20 μL Fisher Scientific TF-20-R-S
Axygen™ aerosol filter pipette tips, 10 μL Fisher Scientific TF-10-R-S
PCR clean hood LabCaire Model PCR-62
DynaMag™2-magnet Thermo 12321D
Streptavidin MagneSphere® paramagnetic particles Promega Z5481
Casein Thermo Scientific 37582
End over end rotator, Revolver™ 360° Labnet H5600
Tris-Base Fisher Scientific BP152-5
Hydrochloric Acid Sigma H1758-100ML
EDTA disodium salt dihydrate Electran (VWR) 443885J
Sodium Chloride Sigma S3014
Dri-Block® Analog Block Heater Techne UY-36620-13
PCR tubes and domed caps Thermo Scientific AB0266
PCR machine Eppendorf Mastercycler® series
T4 DNA ligase New England Biolabs M0202M
40% Polyethylene glycol solution (PEG) in H2O, MW: 8000 Sigma P1458-25ML
Betaine solution, 5M Sigma B0300-1VL
Gel loading buffer II (formamide buffer) Thermo Scientific AM8546G
Precast 6% TBE urea gels Invitrogen EC6865BOX
Mini cell electrophoresis system Invitrogen, Novex XCell SureLock™
Tris/Borate/EDTA solution (10x) Fisher Scientific 10031223
Needle 21 G x1 1/2 VWR 613-2022
SYBR Gold nucleic acid stain (10000x) Life Technologies S11494
Dark Reader DR46B transilluminator Fisher Scientific NC9800797
Ammonium acetate Merck 101116
SDS solution 20% (w/v) Biorad 161-0418
Centrifuge tube filter Appleton Woods BC591
Filter Glass Fibre Gf/D 10mm Whatman (VWR) 512-0427
polyadenylic acid (polyA) RNA Sigma 10108626001
Glycogen, molecular biology grade Thermo Scientific R0561
Isopropanol (2-propanol) Fisher Scientific 15809665
Ethanol, molecular biology grade Fisher Scientific 10041814
Accuprime™ Supermix I (DNA polymerase premix) Life Technologies 12342-010
NEBNext® Multiplex Oligo for Illumina (Index Primer Set 1 and 2) New England Biolabs E7335S; E7500S
Tapestation D1000 Screentape High sensitivity Agilent Technologies 5067- 5584
Tapestation D1000 Reagents Agilent Technologies 5067- 5585
2200 Tapestation - automated gel electrophoresis system Agilent Technologies G2965AA
Agencourt® AMPure® beads XP Beckman Coulter A63880
Qubit™ dsDNA HS Assay Kit Invitrogen Q32851
Qubit™ 2.0 Fluorometer Invitrogen Q32866
Topo™ TA cloning Kit Invitrogen 450071
Sequencing platform: MiSeq System Illumina
Experiment Manager (Sample sheet software) Illumina Note: Use TruSeq LT as a template
Miseq™ Reagent kit V3 (150 cycle) Illumina MS-102-3001
Sequencing hub: Basespace Illumina https://basespace.illumina.com
Ligase A: Thermostable 5’ App DNA/RNA ligase NEB M0319S Not used in this protocol, but tested in optimization process with results described in the discussion.
Ligase B: T4 RNA ligase 1 NEB M0204 Not used in this protocol, but tested in optimization process with results described in the discussion.
Ligase C: CircLigase Epicentre CL4111K Not used in this protocol, but tested in optimization process with results described in the discussion.

DOWNLOAD MATERIALS LIST

References

  1. Herschhorn, A., Hizi, A. Retroviral reverse transcriptases. Cellular and Molecular Life Sciences. 67, (16), 2717-2747 (2010).
  2. Hu, W. S., Hughes, S. H. HIV-1 reverse transcription. Cold Spring Harbor Perspectives in Medicine. 2, (10), (2012).
  3. Levin, J. G., Mitra, M., Mascarenhas, A., Musier-Forsyth, K. Role of HIV-1 nucleocapsid protein in HIV-1 reverse transcription. RNA Biology. 7, (6), 754-774 (2010).
  4. Menendez-Arias, L., Sebastian-Martin, A., Alvarez, M. Viral reverse transcriptases. Virus Research. (2016).
  5. Telesnitsky, A., Goff, S. P. Retroviruses. Coffin, J. M., Hughes, S. H., Varmus, H. E. (1997).
  6. Pollpeter, D., et al. Deep sequencing of HIV-1 reverse transcripts reveals the multifaceted antiviral functions of APOBEC3G. Nature Microbiology. 3, (2), 220-233 (2018).
  7. Frohman, M. A., Dush, M. K., Martin, G. R. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proceedings of the National Academy of Sciences of the United States of America. 85, (23), 8998-9002 (1988).
  8. Liu, X., Gorovsky, M. A. Mapping the 5' and 3' ends of Tetrahymena thermophila mRNAs using RNA ligase mediated amplification of cDNA ends (RLM-RACE). Nucleic Acids Research. 21, (21), 4954-4960 (1993).
  9. Ince, I. A., Ozcan, K., Vlak, J. M., van Oers, M. M. Temporal classification and mapping of non-polyadenylated transcripts of an invertebrate iridovirus. Journal of General Virology. 94, Pt 1 187-192 (2013).
  10. Hafner, M., et al. RNA-ligase-dependent biases in miRNA representation in deep-sequenced small RNA cDNA libraries. RNA. 17, (9), 1697-1712 (2011).
  11. Kwok, C. K., Ding, Y., Sherlock, M. E., Assmann, S. M., Bevilacqua, P. C. A hybridization-based approach for quantitative and low-bias single-stranded DNA ligation. Analytical Biochemistry. 435, (2), 181-186 (2013).
  12. Abram, M. E., Tsiang, M., White, K. L., Callebaut, C., Miller, M. D. A cell-based strategy to assess intrinsic inhibition efficiencies of HIV-1 reverse transcriptase inhibitors. Antimicrobial Agents and Chemotherapy. 59, (2), 838-848 (2015).
  13. Bishop, K. N., Verma, M., Kim, E. Y., Wolinsky, S. M., Malim, M. H. APOBEC3G inhibits elongation of HIV-1 reverse transcripts. PLoS Pathogens. 4, (12), 1000231 (2008).
  14. Zack, J. A., Haislip, A. M., Krogstad, P., Chen, I. S. Incompletely reverse-transcribed human immunodeficiency virus type 1 genomes in quiescent cells can function as intermediates in the retroviral life cycle. Journal of Virology. 66, (3), 1717-1725 (1992).
  15. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of Virology. 59, (2), 284-291 (1986).
  16. Shah, V. B., Aiken, C. In vitro uncoating of HIV-1 cores. Journal of Visualized Experiments. (57), (2011).
  17. JoVE Science Education Database. Science Education Database: Basic Methods in Cellular and Molecular Biology: Passaging Cells. Journal of Visualized Experiments. (2018).
  18. JoVE Science Education Database. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology: Using a Hemocytometer to Count Cells. Journal of Visualized Experiments. (2018).
  19. Zhou, M. Y., Gomez-Sanchez, C. E. Universal TA cloning. Current Issues in Molecular Biology. 2, (1), 1-7 (2000).
  20. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  21. Mangeat, B., et al. Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts. Nature. 424, (6944), 99-103 (2003).
  22. Gillick, K., et al. Suppression of HIV-1 infection by APOBEC3 proteins in primary human CD4(+) T cells is associated with inhibition of processive reverse transcription as well as excessive cytidine deamination. Journal of Virology. 87, (3), 1508-1517 (2013).
  23. Harris, R. S., et al. DNA deamination mediates innate immunity to retroviral infection. Cell. 113, (6), 803-809 (2003).
  24. Zhang, H., et al. The cytidine deaminase CEM15 induces hypermutation in newly synthesized HIV-1 DNA. Nature. 424, (6944), 94-98 (2003).
  25. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  26. Troutt, A. B., McHeyzer-Williams, M. G., Pulendran, B., Nossal, G. J. Ligation-anchored PCR: a simple amplification technique with single-sided specificity. Proceedings of the National Academy of Sciences of the United States of America. 89, (20), 9823-9825 (1992).
  27. Zhelkovsky, A. M., McReynolds, L. A. Structure-function analysis of Methanobacterium thermoautotrophicum RNA ligase - engineering a thermostable ATP independent enzyme. BMC Molecular Biology. 13, (24), (2012).
  28. Li, T. W., Weeks, K. M. Structure-independent and quantitative ligation of single-stranded DNA. Analytical Biochemistry. 349, (2), 242-246 (2006).
  29. Gansauge, M. T., et al. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase. Nucleic Acids Research. 45, (10), 79 (2017).
  30. Ding, Y., Kwok, C. K., Tang, Y., Bevilacqua, P. C., Assmann, S. M. Genome-wide profiling of in vivo RNA structure at single-nucleotide resolution using structure-seq. Nature Protocols. 10, (7), 1050-1066 (2015).
Determinante 3'-Termini e sequências de moléculas de ADN Viral de Single-Stranded nascente durante o HIV-1 inverter transcrição em células infectadas
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pollpeter, D., Sobala, A., Malim, M. H. Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells. J. Vis. Exp. (143), e58715, doi:10.3791/58715 (2019).More

Pollpeter, D., Sobala, A., Malim, M. H. Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells. J. Vis. Exp. (143), e58715, doi:10.3791/58715 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter