Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Avgörande 3'-Termini och sekvenser av begynnande enkelsträngat virala DNA-molekyler under HIV-1 omvänd Transkription i infekterade celler

doi: 10.3791/58715 Published: January 30, 2019

Summary

Här presenterar vi en djupsekvensering strategi som ger en objektiv bestämning av begynnande 3'-termini samt mutationsanalys profiler enkelsträngat DNA-molekyler. Huvudprogrammet är karakterisering av begynnande retrovirala kompletterande DNAs (cDNAs), de intermediärer som genereras under processen för retrovirala omvänd Transkription.

Abstract

Övervakning av nukleinsyra intermediärer under virusreplikation ger insikter om de effekter och verkningsmekanismer av antivirala substanser och värd cellproteiner på virala DNA-syntes. Här åtgärda vi bristen på en cell-baserat, hög-täckning och högupplösta analysen som kan definiera retrovirala omvänd Transkription intermediärer inom fysiologiska samband med virusinfektion. Den beskrivna metoden fångar 3'-termini begynnande kompletterande DNA (cDNA)-molekyler inom HIV-1 infekterade celler enda nukleotid upplösning. Protokollet innebär skörd hela cellens DNA, riktade anrikning av virala DNA via hybrid capture, adapter ligatur, storlek fraktionering av gel rening, PCR-amplifiering, djupsekvensering och dataanalys. Ett viktigt steg är den effektiv och opartisk ligering av adapter molekyler att öppna 3'-DNA termini. Tillämpningen av den beskrivna metoden avgör överflödet av omvänd avskrifter av varje särskild längd i ett givet prov. Det ger också information om (intern) sekvens variationen i omvänd avskrifter och därmed eventuella potentiella mutationer. I allmänhet är analysen lämplig för alla frågor som avser DNA 3'-extension, förutsatt att sekvensen mall är kända.

Introduction

För att analysera och förstå virusreplikation helt, allt mer raffinerade metoder som fångar replikering krävs intermediärer. Särskilt den exakta definitionen av viral nukleinsyra arter inom ramen av infekterade celler kan ge nya insikter, eftersom många virusreplikation mekanismer har hittills varit undersökt i isolerade in vitro- reaktioner. Ett paradexempel är processen för omvänd Transkription i retrovirus, såsom humant immunbristvirus 1 (HIV-1). De olika stegen i HIV-1 omvänd Transkription, under vilken den virala enzymet omvänt transkriptas (RT) kopierar enkelsträngat RNA genomet till dubbelsträngat DNA, har varit studerade framförallt primer filändelsen analyser med renade proteiner och nucleic syror1,2,3,4,5. Medan grundläggande principer fastställdes, sådana analyser införliva inte alla viral och cellulära komponenter och kanske inte återspeglar biologiskt relevanta stoichiometries inblandade faktorer. Därför utformade vi en kraftfull teknik för att bestämma spektra av omvänd Transkription intermediärer med sin precisa cDNA 3'-termini (dvs. att bestämma deras exakta längder) och nukleotidsekvenser i samband med infektioner i levande celler6. Insamling av data från tid kursen experiment kan utnyttjas för att jämföra profilen för utskrifter på olika villkor, till exempel förekomsten av antivirala molekyler eller proteiner, som kan påverka effektiviteten och processivity av DNA-syntes och ackumulation. Detta tillåter en mer detaljerad förståelse av naturliga patogen livscykel, som ofta ligger till grund för riktade läkemedelsdesign och framgångsrika terapeutisk intervention.

HIV-1 omvänd Transkription består av en serie på varandra följande händelser som initierats av glödgning av en tRNA primer till genomisk RNA mallen som förlängs sedan med RT att producera en kort enkelsträngat cDNA avskrift kallas minus-strand stark-stopp (-sss) (se (Se figur 1). Därefter, den - sss cDNA överförs från 5'-lång terminalen upprepa (LTR) till den 3'-LTR av genomisk RNA, där det anneals och serverar som primer för fortsatt RT medierad töjning av minus strand DNA (se recensioner på omvänd Transkription1 , 2 , 3 , 4). denna första strand-överföring är en av de hastighetsbegränsande stegen i omvänd Transkription; Därför kallas den - sss cDNA ansamlas. Den grundläggande arbetsflöde och bibliotek designen att fånga omvänd Transkription produkter i infekterade celler beskrivs i figur 2a. Den specifika primers och analys inställningar som används i protokollet och som anges i tabell 1 rikta alla tidigt omvänd Transkription cDNA intermediärer inom intervallet längd på 23 till ~ 650 nt, som inkluderar de 180-182 nt - sss DNA. Lämpliga mindre anpassningar till strategin kommer dock tillåta program att inte bara sena omvänd Transkription produkter, men även andra virus och system, där målet är att upptäcka 3'-OH innehållande DNA-ändarna. Viktiga begränsningar att tänka inkludera längd spänna av den slutliga PCR-produkten i biblioteket. i synnerhet kommer mallar där avståndet mellan adaptern på den öppna 3'-terminus och webbplatsen uppströms primer överstiga ~ 1000 nt sannolikt mindre effektivt sekvenseras, potentiellt införa vilseledande tekniska fördomar under bibliotek förberedelse ( Se diskussion för mer detaljer och anpassning förslag).

Tidigare har rapporterade metoder för systematisk bestämning av 3'-termini nukleinsyra kardeler fokuserat på RNA, inte DNA, molekyler. Ett exempel är 3' RACE (snabb förstärkning av cDNA slutar)7, som bygger på polyadenylation mRNA. Dessutom utvecklades adapter ligation-baserade strategier anställa RNA ligases, som har inkluderat RLM-RACE (RNA ligase-medierad RACE)8 eller spetsar (ligation-baserade förstärkning av cDNA slutar)9. Det är viktigt att betona att ligation-baserade kompletteringar är känsliga för någon bias som införts av ligering reaktionen själv. Till exempel kan ligering vara mer eller mindre effektiv beroende på en viss nukleotid i position 3', sekvens, totala molekyl längd eller lokala struktur. Sådan ligase inställningar leda till ofullständig fånga av molekyler och förvrängning i utläsningen, som vi och andra har observerat9,10. För att minimera ligering bias under adapter tillägg stegen i det protokoll som beskrivs häri, vi testat ett antal ligering strategier och hittade användningen av T4 DNA-ligase med en hårnål enkelsträngat DNA adapter (som beskrivs av Kwok et al. 11) vara det enda förfarandet med nära kvantitativa ligering som inte ledde till betydande skillnader i ligatur effektivitet när bedömas med en särskilt vald uppsättning kontroll oligonukleotider6. Valet av denna ligatur strategi är därför en viktig del i framgången för detta protokoll.

Hittills har övervakningen av HIV-1 RT progression i infekterade celler har främst åstadkommits genom att mäta omvänd Transkription produkter av olika längd med kvantitativ PCR (qPCR) använda primer-probe uppsättningar som unikt mäter kortare eller längre (tidiga och sent, respektive) cDNA produkter12,13,14. Medan detta qPCR tillvägagångssätt är lämpligt att fastställa inneboende effektivitetsvinster av omvänd Transkription processen i cellulära system, är utdata av relativt låg upplösning, utan sekvens information kommer. Vår nya strategi, baserad på optimerad adapter ligatur, PCR-medierad bibliotek generation och djupsekvensering adresser teknikklyftan och erbjuder en möjlighet att övervaka omvänd Transkription under HIV-1 infektion kvantitativt och på enda nukleotid upplösning.

Vi har illustrerat nyttan av denna metod i en studie som skiljer mellan två föreslagna modeller med kapacitet av HIV-1 begränsning faktorn APOBEC3G (apolipoprotein B mRNA redigering enzym katalytisk polypeptid-liknande 3G) att ingripa med den produktion av viral omvänd avskrifter6.

Protocol

Obs: Vänligen se Tabell av material för specifika reagens och utrustning som används i detta protokoll.

1. virus produktion och Cell infektion

FÖRSIKTIGHET: Infektiös HIV-1 bör endast hanteras i godkända biosäkerhet inneslutning laboratorier.

Obs: Produktion av HIV-1 partiklar av övergående transfection mänskliga embryonala njure (HEK) 293T celler, som beskrivs i steg 1.1, är ett standardförfarande och har tidigare beskrivits15,16. Allmän cellkultur förfaranden beskrivs tidigare17.

  1. HIV-1-virus produktion.
    1. Upprätthålla 293T celler i Dulbecco's modified Eagle medium (DMEM) kompletteras med 10% fetalt bovint serum (FBS) och 1% penicillin/streptomycin (full DMEM) i en vanlig cell kultur inkubator vid 37 ° C och 5% CO2 som tidigare beskrivits17.
    2. I en standard vävnadsodling LAF ta bort tillväxt medier och tillsätt 3 mL före värmde (37 ° C) trypsin till en nära-konfluenta 10 cm cell kultur maträtt (~1.2 x 107 celler) av 293T celler. Sätt skålen tillbaka inkubatorn för 2-3 min.
    3. Ta skålen från inkubatorn tillbaka i vävnadsodling huven och tillsätt 7 mL full medium. Pipettera upp och ner i skålen flera gånger för att resuspendera cellerna. Dela celler 1:4 genom att lägga till 2,5 mL cellsuspension till en ny maträtt som 10 cm och fyll den med 7,5 mL full medium.
    4. Nästa dag, blanda 10 µg av proviral HIV-1 plasmid DNA (t.ex. pNL4.3) med 1 mL serum-fri minimal viktigt medium och lägger polyethylenimine (PEI) lösning (25 000 mW, 1 mg/mL pH 7) på 4,5 µL per 1 µg DNA. Inkubera i 10 min på RT och tillsätt droppvis i 293T celler.
    5. 24 h efter transfection, ta bort mediet och ersätta det med 6 mL full DMEM innehållande RNase-fri DNAS på 20 U/mL medium. Efter 6 h, ersätta mediet med 10 mL full DMEM.
    6. 48 h efter transfection, skörda supernatanten och filtrera den genom ett 0,22 µm filter, med en 10 mL spruta, in i en 15 mL polypropylen rör.
    7. Tillsätt 2 mL steril 20% sackaros 1 x fosfatbuffrad saltlösning (PBS) till en öppen topp tunnväggiga ultracentrifugen röret. Långsamt overlay sackaros med cellen filtrerade supernatant.
    8. Centrifugera i 1 h 15 min på 134.000 x g vid 4 ° C med en ultracentrifugen.
    9. Ta bort rören från ultracentrifugen noggrant. Ta långsamt bort både supernatanten och sackaros med en sug eller en pipett. Använd en mindre pipetten och lutning röret när du tar den sista sackaroslösning. Lämna pelleterat viruset i botten av röret.
      Obs: Pelleten syns inte.
    10. Tillsätt 200 µL av 1 x PBS, lämna i kylskåpet för 4 till 12 h, Omsuspendera och frysa i 20 µL alikvoter vid-80 ° C.
    11. Bestämma p24Gag innehåll med den en p24 HIV-1-antigen ELISA kit (följande tillverkarens instruktioner).
  2. T-cell linje infektion.
    1. Kultur en förevigade T-cell linje (t.ex., CEM-SS celler) i Roswell Park Memorial Institute (RPMI) 1640 medium kompletteras med 10% FBS och 1% penicillin/streptomycin (full RPMI). Räkna cellerna med en hemocytometer18 och utsäde 1 väl per prov med 1 mL full RPMI med 2 x 106 celler/mL i en 12-väl format cell kultur plattan.
    2. Lägg till HIV-1 partiklar motsvarar 150 ng p24Gag och placera plattan i en svängig Centrifugera hink med biocontainment lock till spin-smitta genom centrifugering i en bänkmonterade centrifug för 2 h vid 2000 x g i 30 ° C.
    3. Avlägsna plattan från centrifugen och låt den vila i 1 h i en standard vävnadsodling inkubator vid 37 ° C och 5% CO2.
    4. För att tvätta bort ingående virus, samla celler genom att överföra cellsuspensioner till mikrocentrifugrör och centrifugering i en mikrocentrifug på RT (RT) vid 500 x g i 2 min. Ta bort supernatanten utan att störa cellpelleten.
    5. Återsuspendera cell pellets i förväg värmde (37 ° C), 1 mL steril 1 x PBS. Upprepa de centrifugering, supernatanten borttagning och resuspension steg två gånger.
    6. Centrifugera igen, avlägsna supernatanten och återsuspendera cell pellets i 1 mL av full RPMI. Lägg till varje suspension till en brunn i en ny 12 väl platta.
    7. På 6 h efter första tillägg av virus (4 h efter centrifugering), skörda cellerna genom centrifugering som gjort steg 1.2.4. Avlägsna och Kassera supernatanten. Cell pellets kan vara fryst vid-80 ° C eller bearbetade direkt för DNA-extraktion.

2. DNA-extraktion, HIV-1 DNA kvantifiering och anrikning av Hybrid Capture

  1. Extrahera hela cellen DNA med en blod- och vävnadsprover totala DNA extraction kit genom att följa kit i vävnadskultur celler handbok. Den enda förändringen är eluering i 200 µL av nuclease-fri H2O i stället för den medföljande eluering buffert.
    Obs: Efter tillägg av chaotropic lyseringsbuffert (kit's ”AL buffert”) och proteinas, prover kan tas bort från biosäkerhet inneslutning laboratoriet och hanteras i ett standard säkerhet nivå laboratorium för resten av protokollet.
  2. Bestämma antalet HIV-1 cDNA kopia av qPCR.
    1. Ta 17 µL av eluatet från steg 2.1 och tillsätt 2 µL 10 x restriktionsenzym buffert tillsammans med 1 µL DpnI restriktionsenzym. Inkubera i 1 timme vid 37 ° C att ta bort alla potentiella kvarstående ingående plasmid DNA från transfection.
    2. Utföra qPCR för minus-strand stark-stop cDNA använder följande primer sonden uppsättning: oHC64 (5′-taactagggaacccactgc-3′) och oHC65 (5′-gctagagattttccacactg-3′) och sond oHC66 (5′-FAM-acacaacagacgggcacacacta-TAMRA-3′). qPCR setup och de exakta villkoren kan hittas i referenser6,13. Bära längs prover med en seriell utspädning av pNL4.3 proviral plasmid som en standardkurva att bestämma kopia nummer av cDNA molekyler.
      Obs: Se diskussion för förväntade kvantiteter.
  3. HIV-1 DNA anrikning av hybrid capture.
    Obs: Från detta steg framåt, det är bättre att använda mikrocentrifugrör med låg nukleinsyra bindande egenskaper samt aerosol filter pipettspetsar för alla DNA-prover. Om möjligt, arbeta i en PCR-arbetsstation. Alla steg och reagenser är på RT (RT) om inte annat anges.
    1. För att förbereda en master mix av magnetiska streptividin pärlor, Pipettera 100 µL pärlor per prov i ett enda mikrocentrifug rör. Placera röret på en magnet passar mikrocentrifugrör.
    2. Efter pärlorna har kvittats mot den magnet sidan av röret (~ 1 min) ta av lagring bufferten, ta bort röret från magneten och återsuspendera pärlor i 500 µL av binda och tvätta buffert (BW buffert, 5 mM Tris-HCL pH 7.5, 0,5 mM EDTA 1 M NaCl) att tvätta.
    3. Placera röret tillbaka på magnet, avlägsna supernatanten och tillsätt 500 µL kasein lösning. Ta av magneten, Omsuspendera och inkubera i 10 min på RT och sedan tvätta med BW buffert.
      Obs: En tvätt avser att placera röret på magneten, ta bort supernatanten, tar röret ut magneten, lägga till bufferten och omblandning.
    4. Placera röret tillbaka på magneten, ta bort supernatanten och återsuspendera pärlor i 500 µL av BW buffert. Lägga till 50 pmol för varje fånga biotinylerade oligonukleotider (se tabell 1, tre oligos i detta fall) per prov. (Exempelvis om 5 DNA-prover som ska bearbetas, använda 500 µL magnetiska pärlor från steg 2.3.1 och 250 pmol för varje oligonukleotiden).
    5. Inkubera i 30 min på RT medan gunga i en över slut mixer.
    6. Tvätta pärlor med de immobiliserade oligonukleotider två gånger med 500 µL av 1 x tio buffert (10 mM Tris HCl pH 8,0, 1 mM EDTA, 100 mM NaCl).
    7. Återsuspendera pärlor i 10 µL 1 x tio buffert per prov.
    8. För varje prov etikett ett mikrocentrifug rör och tillsätt 10 µL av pärlor suspensionen, 170 µL av DNA (från steg 2.1) och 90 µL med 3 x tio buffert. Inkubera i en torr värme block på 92 ° C i 2 min att denaturera DNA.
    9. Flytta rören till en annan torr värme block, som ställs till 52 ° C, och inkubera i 1 h. Invertera att blanda regelbundet (~ varje 10 min) under denna inkubation.
    10. Tvätta en gång med 500 µL av 1 x tio buffert och återsuspendera i 35 µL nuclease-fri H2O.
    11. För att eluera, inkubera rören på 92 ° C i ett torr värme i 2 min. Sedan flytta snabbt rören på magneten (ett rör i taget). När pärlor är bundna till sidan av röret, överföra supernatanten innehållande HIV-1 DNA till en färsk röret.
    12. Valfritt: Upprepa qPCR (som gjort i steg 2.2.2) för att avgöra den återvunna HIV-1-cDNA.
      Obs: Se diskussion för förväntade kvantiteter.

3. adapter ligatur

  1. Förbereda adaptern
    1. Återsuspendera frystorkade adapter (se tabell 1 ”full Kwok + MiSeq”) vid 100 µM i nuclease-fri H2O.
    2. Per prov plus ett kontrollprov, kombinera 0,45 µL 10 x T4 DNA ligase buffert 4 µL av adapter och 0,05 µL av nuclease-fri H varje2O. värme till 92 ° C i 2 min och låt svalna långsamt.
      Obs: Om alternativet är tillgängligt använda en PCR-maskin med justerbar kylningshastigheten (användning 2% ränta). Detta tar ca 30 min från 92 ° C till 16 ° C. Alternativt, Använd en torr värme block på 92 ° C och stänga av. Ta den adapter mastermix ut när kvarteret värmen är tillbaka på RT. Detta är att låta adaptern bildar en hårnål struktur (se bild 2b).
  2. Förbereda en kontroll reaktion med en uppsättning av syntetiserade oligonukleotider (se tabell 2) i stället för DNA extraheras från celler.
    1. Gör lager av 100 µM av varje oligonukleotiden. Blanda 1 µL av varje av de 17 oligonucelotides och 8 µL av H2O för en equimolar i en slutlig volym av 25 µL.
    2. Späd den mix 1:2,500 i nuclease-fri H2O en seriell utspädning. Kombinera 1 µL mixen med 17,3 µL av nuclease-fri H2O att använda i den kontroll prov ligation i steg 3.3.1 så att varje oligonukleotid är närvarande vid 1,6 fmol (motsvarar 0,026 nM i 60 µL reaktionen).
  3. Ställa in nering
    1. För 60 µL slutlig volym reaktioner i PCR-rören kombinera 6 µL 10 x T4 DNA-ligase buffert, 24 µL av 40% PEG, 6 µL 5 M betain, 4,5 µL (400 pmol) av adapter (pre-annelead som i steg 3.1.2), 1,2 µL av T4 DNA-ligase (2.000.000 enheter/mL) och 18,3 µL av DNA (från steg 2.3.11)
      Obs: Var särskilt försiktig med trögflytande lösningar såsom 40% PEG att upprätthålla korrekta volymer. Gör inte en mastermix.
    2. Ställ in samma reaktion som utförs i steg 3.3.1 men med kontroll oligonukleotiden mix bereddes i steg 3.2.2.
    3. Blanda reaktionerna väl och inkubera i en PCR-maskin på 16 ° C över natten.

4. adapter borttagning och storlek Separation

  1. Denatureringen gelelektrofores
    1. Tillsätt 30 µL av formamid-innehållande DNA gel lastning buffert till varje ligatur reaktion. Blanda väl genom pipettering.
    2. Värme i 2 min vid 94 ° C i PCR-maskin, sedan omedelbart lägga på is.
    3. Placera en prefabricerad 6% Tris/Borat/EDTA (TBE) denatureringen urea polyakrylamidgel (10-bra kam) i en lämplig gel tank. Lägg till 1 x TBE (89 mM Tris-bas, 89 mM borsyra, 2 mM EDTA) kör buffert och pre kör gelen i 20 min på 250 V/max konstant.
    4. Tvätta ur gel fickor med rinnande buffert med en spruta och 21G nål.
    5. Ladda varje 90 µL prov i tre brunnar (30 µL per brunn) och kör i 20 min (250 V/max) tills mörkblå dye fram handlar om halvvägs genom gelen.
  2. Färgningen och skärande nukleinsyra från gelen
    1. Förbered 3 små mikrocentrifugrör (0,5 mL) per prov genom att peta hål i botten med en 21 G sprutans nål (ta försiktighet medan du arbetar med vassa föremål). Infoga varje beredd rören i en 2,0 mL mikrocentrifug rör och märka dem med prov namn plus ”låg”, ”mid” eller ”hög”.
    2. Ta ut och bända öppna gel kassett. Klipp gelen vertikalt med ett rakblad till generöst punktskatt remsan med 3 brunnarna laddade prover. Lägg till gel remsan i en behållare med 1 x TBE (ca 30 mL) och 5 µL cyanin nukleinsyra fläcken. Inkubera under 3-5 min.
      Obs: Steget gel utvinning är särskilt känsliga för förorening. Det är tillrådligt att bara köra 1 prov per gel och använder en separat och ren behållare för varje gel färgning. Handskarna ska bytas om gel partiklar kontakta behandskade fingrar.
    3. Ren ytan på en blå ljus transilluminator noggrant med ddH2O. Ta gel bit ur behållaren färgning och lägga till ljuslåda.
    4. Slå på den lätta lådan och inspektera de färgade nukleinsyror genom det orange filtret.
      Obs: Adaptern vanligtvis visas överbelastade och körs som stora ”blob” med sammanskrivna HIV-1 DNA kör ovan som en strimma.
    5. Använda ett nytt rakblad, skär bort sidorna av gelen om det finns områden med inget prov laddade kvar. Nästa, skär strax ovan adaptern för att koppla bort adaptern och lägre gel delar. Slutligen skär bort toppen av den gel inklusive ca 1 mm av gel fickor, som ofta har en skarp intensiv signal med högre molekylvikt DNA.
    6. Dela den återstående gel bit med provexemplaret, som normalt är ~ 2 x 3 cm i storlek, horisontellt i tre även bitar: ”låg”, ”mid” och ”hög” molekylvikt områden.
      Obs: Varje bit kommer nu att hanteras separat [dvs., det kommer att finnas tre rör (lågt, mitten och höga)] per ursprungliga provet.
    7. Skär varje tre gel fragment i mindre bitar (~ 2 x 2 mm partiklar) och överföra dem till de preppad 0,5 mL mikrocentrifugrör (steg 4.2.1).
    8. Snurra på toppfart med öppet lock för 1 min att pressa gel bitar genom hålet i 2 mL röret till skapa en gel slush. Om någon gel partiklar kvar i botten av 0,5 mL röret, överföra dem till 2 mL röret manuellt med en nål eller pipetten spets.
  3. DNA-extraktion
    1. Tillsätt 1 mL karbamid gel utvinning buffert (0,5 M NH4CH3CO2, 1 mM EDTA, 0,2% SDS) till den gel slush. Rotera rören för minst 3 h (över natten är acceptabelt) på RT med en över slut mixer.
    2. Använda en ren pincett för att lägga en liten runda glas fiber filter till centrifug kolumner med cellulosaacetat membranfilter (0,2 µm), vilket undviker membran igensättning. Placera filtret på plats med en inverterad pipettspetsen.
    3. Kort snurra 2 mL tuberna med gel slush och utvinning buffert i en mikrocentrifug och överför 700 µL av supernatanten till kolumnerna beredda filter. Håll gel slush och återstående supernatanten.
    4. Centrifugera filter kolumnerna i en mikrocentrifug högsta hastighet för 1 min. att överföring till en ny 2,0 mL mikrocentrifug rör.
    5. Ladda kolonnerna med återstående supernatanten. Försök få så mycket vätska som möjligt från utvinning slush. Överföring av gel bitar är inte ett problem. Snurra igen och kombinera flowthroughs av samma utvinning proverna.
  4. DNA nederbörd
    1. Tillsätt 3 µL polyA RNA (1 µg/µL; som bärare), 1 µL av glykogen och 0,7 mL isopropanol till att från steg 4.3.5. Vortex kort och frysa vid-80 ° C över natten.
    2. Ta prover ur frysen-80 ° C och låt dem Tina kort. Lägg dem i en kyld (4 ° C) mikrocentrifug och snurra i 30 min på högsta hastighet.
    3. Avlägsna och Kassera supernatanten. Vara mycket noga med att inte ta bort pelleten. Lämna 30 till 50 µL vätska om det är osäkert att pellets skulle tas bort annars.
      Obs: Alla ”hög” prover visar vanligtvis en mer synlig pellet än ”mid” och ”låg” prover.
    4. Tillsätt 800 µL av 80% etanol. Invertera rör och snurra igen för 1 min på högsta hastighet. Ta bort majoriteten av etanol med en pipett, kort snurra rören igen och ta bort mer etanol med en mindre volym pipett.
    5. Låt alla återstående etanol avdunsta genom att placera rören med öppet lock i ett 55 ° C torr värme block. När proverna är torr (2-4 min) Tillsätt 20 µL av nuclease-fri H2O och spridningen runt botten av röret för att säkerställa DNA pelleten är upplöst. DNA-provet kan förvaras vid-20 ° C.

5. PCR-amplifiering och bibliotek förberedelse

  1. Ställa in en 40 µL PCR-reaktion med 20 µL av DNA-polymeras förblandning, 18 µL fälls ut och löses på nytt upp DNA från steg 4.4.5, 1 µL framåt primer ”MP1.0 + 22HIV” (10µM) (se tabell 1), och 1 µL av multiplex oligo primers (index grundfärger 1 – 24) (se tabellen av Ma material).
    Obs: Köra de tre reaktionerna (låg, medel, hög) av varje prov separat PCR-reaktioner, men med samma indexerade primer. Använd ett annat index för varje av de ursprungliga infektion proverna.
    1. Köra PCR reaktioner under följande förhållanden: 2 min vid 94 ° C denaturering, då 18 cykler av 3-steg PCR. 15 s vid 94 ° C denaturering, 15 s glödgning vid 55 ° C och 30 s förlängning vid 68 ° C.
  2. Som ett alternativ för kvalitetskontroll, analysera PCR-reaktioner med hög känslighet automatiserad gel electrophoresis system. Ta 2 µL av ett lågt, mitten och höga prov köra enligt tillverkarens instruktioner.
    Obs: Två primers bör vara synliga och ofta körs i en beräknad längd av ca 45 och 95 nt (faktiska längd skiljer sig). Dessutom DNA bör upptäckas mellan 150 till 500 nt. Om ingen signal är närvarande, är det lämpligt att lägga till ytterligare PCR cykler, mellan 2 och 10 ytterligare cykler. Lägg inte till extra cykler för oligonukleotiden kontrollproverna skapade i steg 3.3.2.
  3. Ta bort med primers en paramagnetiska pärla-baserade PCR sanering system.
    1. Ta 20 µL av varje PCR-reaktion och pool proverna grupp (blanda alla prover på denna punkt). Frysa resterande 20 µL reaktionerna som säkerhetskopior vid-20 ° C.
    2. Låt paramagnetiska pärlorna komma till RT och blanda de poolade PCR reaktionerna med 1,8 x volymen av pärla lösningen. Blanda genom pipettering och inkubera i 5 min.
      Obs: Som ett exempel, om 4 prover var beredda och har lågt, mitten och höga reaktioner, volymen skulle vara 4 x 3 x 20 µL = 240 µL PCR-reaktioner med en 432 µL pärla lösning.
    3. Lägga rören på en mikrocentrifug rör magnet, låt pärlorna binda för ~ 1 min, och ta bort supernatanten att kassera. Lämna rören på magneten och tillsätt 500 µL av 80% etanol.
    4. Lämna etanolen för 30 s, sedan ta bort noggrant och låt den pärlor airdry för ~ 5 min. Tillsätt 40 µL nuclease-fri H2O, ta rören av magneten och Pipettera upp och ner flera gånger.
    5. Lämna suspensionen för 5 min. Lägg röret tillbaka på magneten, låt pärlorna bosätta sig på sidan, och överför supernatanten till en ny tub. Detta är biblioteket. Ta en 10 µL alikvotens för kvalitetskontroller och frysa resten vid-20 ° C.

6. utvärdera biblioteket

  1. Fastställa bibliotek kvalitet, koncentration och molariteten.
    1. Använd en fluorometric kvantifiering. Mäta 1 µL och 3 µL av biblioteket med en hög känslighet dsDNA analyssats enligt tillverkarens instruktioner.
      Obs: Typiska koncentrationer är mellan 1 och 10 ng/µL.
    2. Åtgärd bibliotek DNA molekylvikt spektrumet av hög känslighet automatiserad gelelektrofores som beskrivs ovan (steg 5.2).
    3. Användning av automatiserade gel elektrofores analys för att avgöra den genomsnittliga molekylvikten av biblioteket och beräkna för att späda ut biblioteket i nuclease-fri H2O 4 nM. Flera bibliotek kan kombineras så länge alla index som är unika.
  2. Valfria låg genomströmning kvalitetskontroll
    1. Omfattas DNA biblioteket TA kloning19 infoga bibliotek molekyler i vektorer för förstärkning. Följ kit's instruktioner, växa ut ~ 10-20 kolonier och extrahera DNA via miniprep protokoll, som beskrivs här20.
    2. Sekvens vector med lokala sekvensering tjänster och kontrollera att skären innehåller den önska HIV-1 härrör sekvenser och bibliotek-specifika adaptrar.

7. hög genomströmning sekvensering kör

  1. Skapa ett ark med sekvensering i provet med kommersiell programvara som medföljde sekvensering plattformen.
    1. Ange den valda sekvensering kit. Vanligtvis väljer en 150-cykel kit, men andra är lämpliga beroende på önskad Läs längd.
    2. Välj ”endast Fastq” som ansökan arbetsflödet. Välj en av mallarna som innehåller 24 indexen i multiplex oligonukleotiden Kit (anges i kit manual).
    3. Välj ”25 nt” för Read1 och ”125 nt” för Read2. Hålla 6 nt för enda index Läs.
      Obs: I den interna analysen endast Read2 används i analysen. Hålla Read1 på minst 25 nt för sekvensering plattform algoritm ändamål.
  2. Följ tillverkarens anvisningar exakt för pre kör bibliotek förberedelse och setup. Välja den maximala 20 pM koncentration och användning en 15% PhiX spike, som biblioteket är av mycket låg komplexitet.

8. dataanalys

  1. Kontrollera om pass filter procent och genomsnittlig Q30 kvalitetsresultat är godtagbara enligt sekvensering plattform tillverkarens riktlinjer.
    Obs: Pass filter är normalt > 90% och Q30 noter är vanligtvis > 80%.
  2. Hämta den. fastq.gz filer från tillverkarens sekvensering hub.
  3. Ställa in skriptet sekvensering
    1. Skapa en ny katalog (mapp) som heter ”AnalysisXYZ” och gå till https://github.com/malimlab/seqparse att ladda ner alla källkodsfiler (parse_sam.pl, rc_extract.pl, parse.sh) i denna katalog.
    2. Hämta den kort-Läs aligner Bowtie, version 1.1.2, från http://bowtie-bio.sourceforge.net/index.shtml till samma katalog.
    3. Ladda ner skapar en underkatalog inom ”AnalysisXYZ” heter ”Bowtie-1.1.2”. I denna katalog öppna underkatalog ”index” och hämta de medföljande mall sekvenser som består av 6 filer med .ebwt.
    4. Ladda ner den FASTQ/A korta läser förbehandling toolkit fastx-0.0.13 från http://hannonlab.cshl.edu/fastx_toolkit/download.html i katalogen ”AnalysisXYZ”.
    5. Hämta både Samtools (https://sourceforge.net/projects/samtools/files/) och bam-readcount (https://github.com/genome/bam-readcount) i katalogen ”dokument”.
  4. Flytta de. fastq.gz filer, hämtade i steg 8.2, av alla läsa 2s (som slutar på... _R2_001.fastq.gz) i katalogen ”AnalysisXYZ”.
  5. Öppna kommandot konsolen/terminal. Flytta till den ”AnalysisXYZ” som den aktuella katalogen med cd-kommandon. Typ ”./parse.sh”. för att köra skript.
  6. Hitta till CSV-filer med sammanfattningar för alla prover totalt Läs räknas, längd justeras läsa räknas, och normaliserar Läs räknas, samt filer med bas variationen, för varje prov i en katalog som heter parse_results i katalogen ”analys XYZ”.
    Obs: Se diskussionen ytterligare information om analysprocessen. Skriptet returnerar CSV-filer med totalt läser för varje nukleotid längs HIV-1NL4.3 stark-stop sekvenser och första strand överföring tills nukleotid 635. Som en vägledning observeras vanligen 50.000 till 100.000 unika läsningar i prover från infektioner med angiven cell nummer och viral inokulat och utan antivirala proteiner eller föreningar. Det oligonukleotid stickprovet ger vanligen 100.000 till 200.000 läsningar.

Representative Results

Tekniken som beskrivs i denna artikel har tillämpats på en bredare studie för att ta itu med de mekanismerna bakom hämning av HIV-1 omvänd Transkription av antiretroviral mänskliga proteinet APOBEC3G (A3G)6. Figur 3 visar representativa resultat erhålls efter sysselsätter protokollet i prover från CEM-SS T-celler som smittats med vif-bristfälliga HIV-1 i frånvaron eller närvaron av A3G. Det totala antalet unika läsningar erhålls från varje prov efter filtrera bort eventuella PCR dubbletter som har den samma 6 nt streckkod och samma längd (framförd av analys programvara tillhandahåller) ritas i figur 3en. Ökande nivåer av A3G minska totala Läs återspeglar den hämmande effekten av A3G på RT medierad cDNA syntes tidigare beskrivs och mätt med qPCR6,13,21,22. I figur 3bvisas fraktionen molekyler vid varje möjligt längd inom de första 182 nt. För HIV-1 infektion i avsaknad av A3G, de vanligast förekommande arterna är den huvudsakliga 180 nt stark-stop molekylen själv, med vissa ackumulering av läser i intervallet kortare (23 till 40 nt) (övre grafen, blå histogram). Tillägg av A3G förändringar denna profil som en kraftig ökning av kortare, trunkerade cDNA molekyler på några mycket specifika, reproducerbara positioner är upptäckt (mellersta och nedre grafer). Eftersom A3G är en cytidindeaminas, cytosin-till-uridin (identifieras som C-till-T) uppstå mutationer i cDNA när A3G är närvarande i den infekterande virioner21,23,24. Använder den erhållna sekvensinformation, var procentandelen av C-till-T mutationer ritad på i samma graf (röd streckad linje). Det bör noteras att mutationsanalys profilen härleds från alla unika läsningar kombinerat och täckning av varje nukleotid varierar. Dock om det behövs information om aktivitetssekvens kan vara relaterade till varje molekyl och korrelerade med en specifik 3'-terminus. Uppgifterna togs från Pollpeter et al. 6 och korrelationen mellan mutationsanalys och cDNA längd profiler påvisades för att bero på upptäckt och klyvning av deaminated cDNA av cellulära DNA reparerar maskiner.

En positiv kontroll för metoden 3'-mappning kan enkelt produceras genom att bearbeta en pool av syntetiska oligonukleotider av känd sekvens, längd och koncentration. Denna kontroll läggs på den adapter ligation i steg 3.3.2 och rekommenderas att ingå i alla multiplexade bibliotek. Data som erhållits från ett kontrollprov bör ha alla oligonukleotider de beräknade ingående nyckeltal, med endast mycket mindre bakgrunden läser. Figur 4 visar resultaten av en positiv kontroll uppsättning 17 kemiskt syntetiserade oligonukleotider (för sekvenser, se tabell 2), som blandades vid equimolar förhållanden. Som förväntat, visas alla molekyler i nära lika överflöd med endast små variationer (övre diagrammet). Medan de flesta befattningar inom - sss DNA-sekvensen som inte var företrädda av en oligonukleotid returnerar noll Läs räknas, observerat vi mindre arter som är 1 eller 2 nt som är kortare än de faktiska kontroll oligonukleotider. Vi har inte ytterligare undersökt dessa mindre arter men antar att de representerar försämrade eller ofullständig produkter som potentiellt finns i medföljande oligonukleotiden lagren vid köpet (oligonukleotider beställdes som HPLC renas, för vilka den tillverkaren anger > 80% renhet). Nedre diagrammet visar stickprov från ett annat bibliotek köra, där variationen är något högre mellan de 17 oligonukleotider och korrelerar med Totallängd däri längre kontroll molekyler upptäcks mer effektivt då kortare sådana. Detta kan bero på en mindre bias i PCR-reaktioner eller i kluster under MiSeq sekvensering, som har en Infoga storlek optimal och uppstå med bibliotek bär särskilt bred infoga spänner. Ett grundläggande sätt att åtgärda denna snedvridning är tillämpningen av en normalisering faktor utifrån lutningen som anger bias korrelera till molekyl längd (rosa linje). Beräkningarna som krävs ingår i programmet analys (se steg 8,3 i protokollet).

Figure 1
Figur 1: Diagram som visar de första stegen av HIV-1 omvänd Transkription. Processen börjar med glödgning av tRNA(Lys,3) (orange) till primer bindningsstället (PBS) i den genomiska viral RNA (steg 1), som tillåter initiering och töjning av viral cDNA (blå, steg 2). Samtidigt bryts mall genomisk RNA av RNaseH aktivitet av RT (steg 3). Den första fullständiga mellanliggande i processen omvänd Transkription är minus-strand stark-hållplatsen (-) sss cDNA, som är komplett när RT katalyseras polymerisation når 5'-slutstationen för gärna upprepa (R) regionen (steg 3). Den (-) sss mellanliggande överförs till 3'-slutstationen för mallen genomisk RNA av glödgning till kompletterande 3'-long terminal upprepa (LTR) R regionen. Här fortsätter polymerisation (steg 4). I den beskrivna metoden bestäms omvänd Transkription progression genom att mappa den exakta längden på den begynnande viral cDNA (blå). PPT, polypurine tarmkanalen; U5, unika 5'-sekvens; U3, unik 3'-sekvensen. Denna siffra publiceras från en tidigare publikation6. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : Arbetsflöde disposition och scheman över den adaptern ligering och PCR-amplifiering strategi. (a) arbetsflöde beskriver huvudsteg av beskrivs tekniken att avgöra 3'-termini av HIV-1 omvänt avskrifter i infekterade celler. Siffran är anpassade från en tidigare publikation6. (b) Schematisk av adapter ligering och PCR-amplifiering strategi. Begynnande cDNA molekyler av varierande längd som har renats i föregående steg är sammanskrivna till ett enkelsträngat DNA adapter använder T4 DNA-ligase. Hårnål adaptern (namngiven ”full Kwok + MiSeq”, se tabell 1) design inspirerad av Kwok et al. 11. adaptern bär ett slumpmässigt 6 nt streckkod sekvens, som möjliggör base-ihopkoppling för att underlätta ligering och samtidigt fungerar som en identifierare för unik läsningar. 3'-termini adapterns bär en spacer (SpC3) för att förhindra själv ligering. Sammanskrivna produkter är separerade från överflödigt adapter med denatureringen polyakrylamid gelelektrofores (sidan). Nukleinsyror i gel är målat och skär i tre separata, lika-storlek gel bitar i området från ovan adaptern till brunnen som gjort i25. Efter eluering, nederbörd och resuspension, produkterna är PCR amplifieras med grundfärg glödgning till den känd sekvensen av adaptern (primer 1, multiplex oligonukleotiden kit, se Tabell av material) och en primer som transporterar de första 22 nt av HIV-1 5'-LTR sekvens omedelbart efter tRNAen (primer 2, MP1.0 + 22HIV). 5'-termini av valda primers bär adaptrar för den valda sekvensering plattformen (P5 och P7) samt en index-sekvens för att särskilja enskilda prover som kör i samma bibliotek. Utgångspunkterna för sekvensering Läs primers indikeras. Den blå rutan anger regionen av intresse att bestämma de ursprungliga 3'-termini av infångade molekylen. Denna siffra är anpassade från en tidigare publikation6. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : Representativa resultat. (a) den totala Läs räkningen av representativa prover bearbetas med protokollet beskrivs. Detta inkluderar alla sekvenser som identifierades som unika läsningar av HIV-1 molekyler med sina 3'-termini inom de första 635 nt av minus strand cDNA (upp till PPT, se figur 1). Infektion med HIV-1 inte bära A3G ger det högsta antalet läsningar, medan A3G hämmar cDNA syntes och därmed minskar den totala antal läsningar. Oinfekterade celler tjänade som en negativ kontroll, medan ett antal syntetiska oligonukleotider ger en positiv kontroll. (b) det relativa överflödet av cDNAs för varje längd mellan nt positioner 23 och 182 (fullängds - sss cDNA är 180 – 182 nt) av de HIV-1NL4.3 sekvens (x-axeln) visas i blå histogram (skala på vänster y-axeln). Det relativa överflödet av cDNA beräknades från det absoluta antalet sekvenser terminerande på en given nukleotid inom - sss cDNA sekvensen dividerat med summan av alla läser mäta 182nt eller mindre. Visas i streckade röda linjer är procentsatserna av läser transporterar C-till-T/U mutationer på respektive position (skala på höger yaxlarna). Figur 3 b är publiceras från en tidigare publikation6. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4 : Representativa resultat av kontrollprover. Visas två profiler för pooler som innehåller equimolar mängder av 17 olika längd syntetiska oligonukleotider. Dessa oligonukleotider har sekvenser från HIV-1NL4.3 och valdes ut för att täcka olika längder och presentera alla 4 baser som en 3'-nukleotid (se tabell 2). Översta grafen visar positiv kontrollprovet från figur 3en. Inga betydande bias mot molekylen längd eller öppen 3'-termini upptäcks. Den nedre grafen visar ett annat bibliotek kör, som producerade en mindre längd bias i sekvensering. I detta fall är det lämpligt att tillämpa en normalisering faktor, som härrör från backen (visas i rosa) som representerar storlek bias. Denna siffra publiceras från en tidigare publikation6. Klicka här för att se en större version av denna siffra.

Oligo namn Längd i nt Sekvens Syfte Tillverkaren (rening)
full Kwok + MiSeq 61 5'-PHO-tgaagagcctagtcgctgttcannnnnnctgcccatagagagatcggaagagcacacgtct-SpC3-3' Adapter IDT DNA teknik (HPLC)
2xBiotin SS bete 40 5'-biotin-cagtgtggaaaatctctagcagtggcgcccgaacagggac-biotin-3' Hybrid Capture MWG Eurofins (HPLC)
Biotin 1-16 ss 22 5'-cagtgtggaaaatctctagcag-BiTEG-3' Hybrid Capture MWG Eurofins (HPLC
Biotin tRNA + CTG 16 5'-cagtggcgcccgaaca-BITEG-3' Hybrid Capture MWG Eurofins (HPLC)
MP1.0 + 22HIV 82 5'-aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatctcactgctagagattttccacactg-3' PCR-amplifiering MWG Eurofins (HPLC

Tabell 1: tabell över oligonukleotider inklusive längd, sekvenser och modifieringar som utnyttjas i protokollet beskrivs. Tabellen är anpassade från en tidigare publikation6Vänligen klicka här för att ladda ner tabellen som en excel-fil.

Oligo namn Längd i nt Sekvens Tillverkaren (rening)
HTP con lång C 120 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaagc-3' MWG Eurofins (HPLC)
HTP con lång G 119 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaag-3' MWG Eurofins (HPLC)
HTP con lång T 116 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggctt-3' MWG Eurofins (HPLC)
HTP con long A 118 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaa-3' MWG Eurofins (HPLC)
HTP con mitten av C 76 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcac-3' MWG Eurofins (HPLC)
HTP con mitten av G (a) 71 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacg-3' MWG Eurofins (HPLC)
HTP con mitten av G (b) 72 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgg-3' MWG Eurofins (HPLC)
HTP con mitten A 69 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacaga-3' MWG Eurofins (HPLC)
HTP con mid T 85 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactt-3' MWG Eurofins (HPLC)
HTP con kort A 40 5'-ctgctagagattttccacactgactaaaagggtctgaggga-3' MWG Eurofins (HPLC)
HTP con kort T 33 5'-ctgctagagattttccacactgactaaaagggt-3' MWG Eurofins (HPLC)
HTP con kort G 41 5'-ctgctagagattttccacactgactaaaagggtctgaggg-3' MWG Eurofins (HPLC)
HTP con kort C 34 5'-ctgctagagattttccacactgactaaaagggtc-3' MWG Eurofins (HPLC)
HTP Con 46 (T) 46 5'-ctgctagagattttccacactg actaaaagggtctgagggatctct-3' MWG Eurofins (HPLC)
HTP Con 83 (C) 83 5'-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactac-3' MWG Eurofins (HPLC)
HTP Con 103 (C) 103 5'-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagc-3' MWG Eurofins (HPLC)
HTP Con 107 (A) 107 5'-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagcttta-3' MWG Eurofins (HPLC)

Tabell 2: tabell över 17 syntetiska kontroll oligonukleotider används som positivt kontrollprov. De topp 13 oligonukleotider valdes utifrån storlek [lång (116-120 nt), mid (69-85 nt), kort (33 – 41 nt)] samt deras 3'-termini. Tabellen är anpassade från en tidigare publikation6.  Vänligen klicka här för att ladda ner tabellen som en excel-fil.

Discussion

Tillgängligheten för snabb, tillförlitlig och kostnadseffektiv djupsekvensering har revolutionerat många aspekter inom biovetenskap, vilket gör att djupet i sekvensering-baserade analyser. En återstående utmaning ligger i den innovativa design och skapande av representant sekvensering bibliotek. Här beskriver vi ett protokoll för att fånga begynnande viral cDNA molekyler, särskilt intermediärer av HIV-1 omvänd Transkription processen.

Det mest kritiska steget i denna strategi är ligering av en adapter till de öppna 3'-termini i ett kvantitativt och objektivt sätt. Effektivitetsvinsterna av nering mellan två ssDNA termini, både inter- och intramolekylära, har undersökt och optimerad för olika tillämpningar11,26,27,28,29. Val av att använda en hårnål adapter med T4 DNA-ligase enligt de villkor som beskrivs i steg 3.3 är resultatet av empiriska optimering där vi utvärderade olika ligases, adaptrar och reagenser för ligering av syntetiska oligonukleotider som representerar HIV-1 sekvenser (tabell 2), (inga data anges). I dessa in vitro- test reaktioner bekräftat vi att den T4 DNA-ligase medierad ligering av hårnål adaptern, som beskrivs av Kwok et al. 11, har en mycket låg bias, och uppnår nära komplett ligering av acceptor molekyler när adaptern används i överskott. Ligatur effektivitet var opåverkad genom tillsats av nukleotidsekvensen att återge adaptern kompatibel för multiplex primer system (se figur 4). I jämförelse fann vi att en termostabila 5' DNA/RNA ligase (”Ligase A”, se Tabell för material för exakta ligases jämfört med här), som är en konstruerad RNA ligase som utvecklades delvis förbättra ligering effektivitet med ssDNA som acceptorn 27, var verkligen effektivare på ligating två ssDNA molekyler än RNA ligase (”Ligase B”) men hade en betydande bias, med starka skillnader i ligatur effektivitet även mellan oligonukleotider med enda bas längd skillnader [tabell 2 ; HTP con mid G (a) och (b)]. Vidare, Vi hittade endast en minimal bias i reaktioner med ”Ligase C” kombinerat med en adapter som transporterar en randomiserad 5'-termini (en strategi användas för att avräkna kända nukleotid bias av ”Ligase C”; se till exempel Ding et al. 30). dock ”Ligase C”-medierad intermolekylära nering var ofullständiga, rendering systemets T4 DNA-ligase överlägsna valet.

Flera kvalitetskontroll steg över loppet av protokollet och införlivandet av positiva och negativa kontroller möjliggör upptäckt av potentiella problem innan assay fortsättning och ge vägledning för felsökning ansträngningar. De qPCR kvantifieringar i steg 2.2.2 och 2.3.12 säkerställa att kvantiteten av det ingående materialet är tillräcklig. Typiska cDNA kopia nummer i intervallet 200 µL eluering (från steg 2.1) från omkring 10.000 till 300.000 per µL. Steget hybrid capture kan resultera i vissa förlust av övergripande HIV-1 cDNA kvantitet men bör resultera i en stark berikning av specifika HIV-1 cDNA över cellulär DNA, vilket kan avgöras genom att använda lämpliga grundfärger för att kvantifiera genomiskt DNA före och efter anrikning av qPCR eller genom mätning av totala DNA-koncentration. Återvunna HIV-1 cDNA efter hybrid capture steg bör vara minst 10% av indata. Låg som utgångsmaterial kan annars förklara en framgångsrik oligonukleotiden positiv kontroll (se punkt 3.3.2) men endast begränsat läsningar som uppnåtts i proven. Låg Läs siffror övergripande kan också förklaras av överskattning av bibliotek koncentrationen på grund av förekomsten av irrelevanta DNA arter utan MiSeq adaptrar. Detta skulle resultera i kluster med låg densitet och kan förbättras genom att bestämma koncentrationen av HIV-1 sekvenser i biblioteket av qPCR utöver det totala beloppet som DNA av fluorometric analyser. Mycket känsliga pågrund av metoden, bör särskild försiktighet iakttas för att ens lågaktivt kontaminering, både från andra prover (särskilt från hög koncentration kontroll oligonukleotiden bestånden) as well as från laboratorieutrustning. Arbetar i en UV-sterilisering PCR-arbetsstation är fördelaktigt i detta avseende. Den automatiserade gelelektrofores av slutliga biblioteket (steg 6.1.2) är en ytterligare åtgärd för kvalitetskontroll. Nukleinsyra storleksintervallet vanligtvis observeras är mellan 150 till 500 nt. Primers som kan upptäckas i kontrollen efter PCR och innan rening (se anmärkning i steg 5.2) ska nu vara frånvarande. I representativa resultat, prov intensitet kurvan har en topp runt 160-170 nt och en andra skarpare topp omkring 320 till 350 nt. Detta avspeglar sannolikt ofta sett högre överflödet i både relativt kort (1 till 20 nt infoga längd) omvänd avskrifter och fullängds stark-stop (180 – 182 nt infoga längd) (figur 3b).

Medan presenteras protokoll och valda grundfärger är specifika för tidig HIV-1 omvänd Transkription konstruktioner, är metoden allmänt tillämpliga på någon studie som syftar till att fastställa öppna 3'-termini av DNA. De viktigaste ändringarna som krävs i andra sammanhang blir metoden för hybrid capture och primer designstrategi. Till exempel om målet är anpassas till sena HIV-1 avskrifter, ett större antal olika erövrare biotinylerade oligonukleotider glödgning över längden av cDNA vore tillrådligt och kommer sannolikt att minska förlusten i hybrid capture steg. Som nämnts i inledningen, är det viktigt att överväga begränsningar när du utformar spänna över vilka 3'-termini är att upptäcka för att undvika olika källor av partiskhet. Först, det kan finnas en bias i PCR-reaktioner om mallarna med adaptern är av kraftigt varierande längd. Andra, sekvensering plattformen används här (t.ex. MiSeq) har en rekommenderad infoga längdintervall för optimal klustring och betydligt kortare och längre produkter inte kan sekvenseras med samma effektivitet. Delvis, detta kan åtgärdas computationally, vilket gjordes genom att beräkna en korrektionsfaktor för linjär längd bias (se figur 4, nedre diagrammet). Emellertid, om regionen där 3'-termini mappning önskas är lång (> 1000 nt), är det mer lämpligt att dela reaktioner med ligated avskrifter och använda flera uppströms grundfärger för att bedöma 3'-termini i sektioner.

Analys programmet skrevs internt för det specifika syftet att analysera de båda sista nukleotid av HIV-1 sekvens intill sekvensen fast adaptern samt bas variationen i alla baser för att identifiera alla mutationer. De enskilda stegen omfatta följande: först sekvenserna som adaptern trimmas med fastx-0.0.13 toolkit; sedan tas några sekvenser som är duplicerade (dvs identiska sekvenser inklusive streckkoden) bort. Alla återstående unika läsningar justeras sedan sekvensen HIV-1 med Bowtie (http://bowtie-bio.sourceforge.net/index.shtml) med en maximal felmatchning vid tre baser. Sekvensen mallen består av de första 635 nt av HIV-1 cDNA (NL4.3-stam), som innehåller sekvensen - sss och den första strand transfer produkten upp till polypurine spåret (U5-R-U3-PPT, se figur 1). Därmed, är den medföljande programvaran och mallar endast direkt lämplig om metoden som används för samma program (identifiering av tidiga omvänd avskrifter av de HIV-1NL4.3). Justeringar får göras för andra mål sekvenser. Positionerna för 3'-termini för varje Läs bestämdes av positionen i anpassningen. Bas samtal för varje position registreras och mutation priser beräknas från den totala täckningen för varje base, som varierar, som läser är av olika längder och långa skär inte helt täckas av 125-base sekvensering i Read2.

Avslutningsvis anser vi att den beskrivna metoden vara ett värdefullt verktyg för många typer av studier. Uppenbara applikationer inkluderar undersökningar av mekanismerna bakom omvänd Transkription hämning genom antiretrovirala läkemedel eller cellulära begränsning faktorer. Endast relativt små justeringar bör dock nödvändigt att anpassa systemet till 3'-termini kartläggning inom andra enkelsträngat DNA viral intermediärer, som är närvarande, till exempel i parvovirus replikering. Dessutom kan principen om metoden, särskilt dess optimerade ligering steg, ge en central del av biblioteket förberedelse design för karakterisering av alla 3'-DNA tillägg, inklusive elongationer katalyseras av cellulära dubbelsträngat DNA polymeraser.

Disclosures

Författarna förklarar att de har något att avslöja.

Acknowledgments

Författarna bekräftar stödet från medlemmar av Malim laboratorium, Luis Apolonia, Jernej Ule och Rebecca Oakey. Författarna tackar Matt Arno vid King's College London genomisk centrum och Debbie Hughes vid University College London (UCL), Institutet för neurologi nästa generations sekvensering anläggning, för hjälp med MiSeq sekvensering körs. Arbetet stöddes av den brittiska Medicinska forskningsrådet (G1000196 och MR/M001199/1 till M.M.), Wellcome Trust (106223/Z/14/Z till M.M.), Europeiska kommissionens sjunde ramprogram (FP7/2007-2013) enligt bidragsavtalet ingen. PIIF-GA-2012-329679 (till DP) och till hälsodepartementet via ett nationellt institut för hälsa forskning omfattande Biomedical Research Center award till Guy's and St. Thomas' NHS Foundation Trust i samarbete med King's College London och kungens College Hospital NHS Foundation Trust.

Materials

Name Company Catalog Number Comments
293T cells ATCC CRL-3216
Dulbecco's Modified Eagle's Medium Gibco 31966-021
Penicillin/Streptomycin Gibco 15150-122
Fetal Bovine Serum Gibco 10270-106
HeraCell Vios 250i CO2 Incubator Thermo Scientific 51030966
Laminar flow hood - CAS BioMAT2 Wolflabs CAS001-C2R-1800
10mm TC-treated culture dish Corning 430167
TrypLE™ Express (1x), Stable Trypsin Replacement Enzyme Gibco 12605-010
OptiMEM® (Minimal Essential Medium) Gibco 31985-047
HIV-1 NL4-3 Infectious Molecular Clone (pNL4-3) NIH Aids reagent program 114
Polyethylenimine (PEI) - MW:25000 PolySciences Inc 23966-2 dissolved at 1mg/ml and adjusted to pH7
RQ1- Rnase free Dnase Promega M6101
Filter 0.22 μm Triple Red Limited FPE404025
15 mL polypropylene tubes Corning CLS430791
Sucrose Calbiochem 573113
Phosphate Buffered Saline (1x) Gibco 14190-094
Ultracentrifuge tubes Beckman Coulter 344060
Ultracentrifuge Sorval WX Ultra Series Th-641 Rotor
Alliance HIV-1 p24 antigen ELISA kit Perkin Elmer NEK050001KT
CEM-SS cells NIH Aids reagent program 776
Roswell Park Memorial Institute Medium Gibco 31870-025
CoStar® TC treated multiple well plates Corning CLS3513-50EA
Benchtop centrifuge: Heraus™ Multifuge™ X3 FR Thermo Scientific 75004536
TX-1000 Swinging Bucket Rotor Thermo Scientific 75003017
Microcentrifuge: 5424R Eppendorf 5404000060
Total DNA extraction kit (DNeasy Blood and Tissue kit) Qiagen 69504
Nuclease free H2O Ambion AM9937
Cutsmart buffer New England Biolabs (part of DpnI enzyme) R0176S
DpnI restriction enzyme New England Biolabs R0176S
Oligonucleotides for qPCR MWG Eurofins N/A HPSF purification
TaqMan PCR Universal Mastermix Thermo 4304437
LoBind Eppendorf® tubes Eppendorf 30108078
Axygen™ aerosol filter pipette tips, 1000 μL Fisher Scientific TF-000-R-S
Axygen™ aerosol filter pipette tips, 200 μL Fisher Scientific TF-200-R-S
Axygen™ aerosol filter pipette tips, 20 μL Fisher Scientific TF-20-R-S
Axygen™ aerosol filter pipette tips, 10 μL Fisher Scientific TF-10-R-S
PCR clean hood LabCaire Model PCR-62
DynaMag™2-magnet Thermo 12321D
Streptavidin MagneSphere® paramagnetic particles Promega Z5481
Casein Thermo Scientific 37582
End over end rotator, Revolver™ 360° Labnet H5600
Tris-Base Fisher Scientific BP152-5
Hydrochloric Acid Sigma H1758-100ML
EDTA disodium salt dihydrate Electran (VWR) 443885J
Sodium Chloride Sigma S3014
Dri-Block® Analog Block Heater Techne UY-36620-13
PCR tubes and domed caps Thermo Scientific AB0266
PCR machine Eppendorf Mastercycler® series
T4 DNA ligase New England Biolabs M0202M
40% Polyethylene glycol solution (PEG) in H2O, MW: 8000 Sigma P1458-25ML
Betaine solution, 5M Sigma B0300-1VL
Gel loading buffer II (formamide buffer) Thermo Scientific AM8546G
Precast 6% TBE urea gels Invitrogen EC6865BOX
Mini cell electrophoresis system Invitrogen, Novex XCell SureLock™
Tris/Borate/EDTA solution (10x) Fisher Scientific 10031223
Needle 21 G x1 1/2 VWR 613-2022
SYBR Gold nucleic acid stain (10000x) Life Technologies S11494
Dark Reader DR46B transilluminator Fisher Scientific NC9800797
Ammonium acetate Merck 101116
SDS solution 20% (w/v) Biorad 161-0418
Centrifuge tube filter Appleton Woods BC591
Filter Glass Fibre Gf/D 10mm Whatman (VWR) 512-0427
polyadenylic acid (polyA) RNA Sigma 10108626001
Glycogen, molecular biology grade Thermo Scientific R0561
Isopropanol (2-propanol) Fisher Scientific 15809665
Ethanol, molecular biology grade Fisher Scientific 10041814
Accuprime™ Supermix I (DNA polymerase premix) Life Technologies 12342-010
NEBNext® Multiplex Oligo for Illumina (Index Primer Set 1 and 2) New England Biolabs E7335S; E7500S
Tapestation D1000 Screentape High sensitivity Agilent Technologies 5067- 5584
Tapestation D1000 Reagents Agilent Technologies 5067- 5585
2200 Tapestation - automated gel electrophoresis system Agilent Technologies G2965AA
Agencourt® AMPure® beads XP Beckman Coulter A63880
Qubit™ dsDNA HS Assay Kit Invitrogen Q32851
Qubit™ 2.0 Fluorometer Invitrogen Q32866
Topo™ TA cloning Kit Invitrogen 450071
Sequencing platform: MiSeq System Illumina
Experiment Manager (Sample sheet software) Illumina Note: Use TruSeq LT as a template
Miseq™ Reagent kit V3 (150 cycle) Illumina MS-102-3001
Sequencing hub: Basespace Illumina https://basespace.illumina.com
Ligase A: Thermostable 5’ App DNA/RNA ligase NEB M0319S Not used in this protocol, but tested in optimization process with results described in the discussion.
Ligase B: T4 RNA ligase 1 NEB M0204 Not used in this protocol, but tested in optimization process with results described in the discussion.
Ligase C: CircLigase Epicentre CL4111K Not used in this protocol, but tested in optimization process with results described in the discussion.

DOWNLOAD MATERIALS LIST

References

  1. Herschhorn, A., Hizi, A. Retroviral reverse transcriptases. Cellular and Molecular Life Sciences. 67, (16), 2717-2747 (2010).
  2. Hu, W. S., Hughes, S. H. HIV-1 reverse transcription. Cold Spring Harbor Perspectives in Medicine. 2, (10), (2012).
  3. Levin, J. G., Mitra, M., Mascarenhas, A., Musier-Forsyth, K. Role of HIV-1 nucleocapsid protein in HIV-1 reverse transcription. RNA Biology. 7, (6), 754-774 (2010).
  4. Menendez-Arias, L., Sebastian-Martin, A., Alvarez, M. Viral reverse transcriptases. Virus Research. (2016).
  5. Telesnitsky, A., Goff, S. P. Retroviruses. Coffin, J. M., Hughes, S. H., Varmus, H. E. (1997).
  6. Pollpeter, D., et al. Deep sequencing of HIV-1 reverse transcripts reveals the multifaceted antiviral functions of APOBEC3G. Nature Microbiology. 3, (2), 220-233 (2018).
  7. Frohman, M. A., Dush, M. K., Martin, G. R. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proceedings of the National Academy of Sciences of the United States of America. 85, (23), 8998-9002 (1988).
  8. Liu, X., Gorovsky, M. A. Mapping the 5' and 3' ends of Tetrahymena thermophila mRNAs using RNA ligase mediated amplification of cDNA ends (RLM-RACE). Nucleic Acids Research. 21, (21), 4954-4960 (1993).
  9. Ince, I. A., Ozcan, K., Vlak, J. M., van Oers, M. M. Temporal classification and mapping of non-polyadenylated transcripts of an invertebrate iridovirus. Journal of General Virology. 94, Pt 1 187-192 (2013).
  10. Hafner, M., et al. RNA-ligase-dependent biases in miRNA representation in deep-sequenced small RNA cDNA libraries. RNA. 17, (9), 1697-1712 (2011).
  11. Kwok, C. K., Ding, Y., Sherlock, M. E., Assmann, S. M., Bevilacqua, P. C. A hybridization-based approach for quantitative and low-bias single-stranded DNA ligation. Analytical Biochemistry. 435, (2), 181-186 (2013).
  12. Abram, M. E., Tsiang, M., White, K. L., Callebaut, C., Miller, M. D. A cell-based strategy to assess intrinsic inhibition efficiencies of HIV-1 reverse transcriptase inhibitors. Antimicrobial Agents and Chemotherapy. 59, (2), 838-848 (2015).
  13. Bishop, K. N., Verma, M., Kim, E. Y., Wolinsky, S. M., Malim, M. H. APOBEC3G inhibits elongation of HIV-1 reverse transcripts. PLoS Pathogens. 4, (12), 1000231 (2008).
  14. Zack, J. A., Haislip, A. M., Krogstad, P., Chen, I. S. Incompletely reverse-transcribed human immunodeficiency virus type 1 genomes in quiescent cells can function as intermediates in the retroviral life cycle. Journal of Virology. 66, (3), 1717-1725 (1992).
  15. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of Virology. 59, (2), 284-291 (1986).
  16. Shah, V. B., Aiken, C. In vitro uncoating of HIV-1 cores. Journal of Visualized Experiments. (57), (2011).
  17. JoVE Science Education Database. Science Education Database: Basic Methods in Cellular and Molecular Biology: Passaging Cells. Journal of Visualized Experiments. (2018).
  18. JoVE Science Education Database. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology: Using a Hemocytometer to Count Cells. Journal of Visualized Experiments. (2018).
  19. Zhou, M. Y., Gomez-Sanchez, C. E. Universal TA cloning. Current Issues in Molecular Biology. 2, (1), 1-7 (2000).
  20. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  21. Mangeat, B., et al. Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts. Nature. 424, (6944), 99-103 (2003).
  22. Gillick, K., et al. Suppression of HIV-1 infection by APOBEC3 proteins in primary human CD4(+) T cells is associated with inhibition of processive reverse transcription as well as excessive cytidine deamination. Journal of Virology. 87, (3), 1508-1517 (2013).
  23. Harris, R. S., et al. DNA deamination mediates innate immunity to retroviral infection. Cell. 113, (6), 803-809 (2003).
  24. Zhang, H., et al. The cytidine deaminase CEM15 induces hypermutation in newly synthesized HIV-1 DNA. Nature. 424, (6944), 94-98 (2003).
  25. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  26. Troutt, A. B., McHeyzer-Williams, M. G., Pulendran, B., Nossal, G. J. Ligation-anchored PCR: a simple amplification technique with single-sided specificity. Proceedings of the National Academy of Sciences of the United States of America. 89, (20), 9823-9825 (1992).
  27. Zhelkovsky, A. M., McReynolds, L. A. Structure-function analysis of Methanobacterium thermoautotrophicum RNA ligase - engineering a thermostable ATP independent enzyme. BMC Molecular Biology. 13, (24), (2012).
  28. Li, T. W., Weeks, K. M. Structure-independent and quantitative ligation of single-stranded DNA. Analytical Biochemistry. 349, (2), 242-246 (2006).
  29. Gansauge, M. T., et al. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase. Nucleic Acids Research. 45, (10), 79 (2017).
  30. Ding, Y., Kwok, C. K., Tang, Y., Bevilacqua, P. C., Assmann, S. M. Genome-wide profiling of in vivo RNA structure at single-nucleotide resolution using structure-seq. Nature Protocols. 10, (7), 1050-1066 (2015).
Avgörande 3'-Termini och sekvenser av begynnande enkelsträngat virala DNA-molekyler under HIV-1 omvänd Transkription i infekterade celler
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pollpeter, D., Sobala, A., Malim, M. H. Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells. J. Vis. Exp. (143), e58715, doi:10.3791/58715 (2019).More

Pollpeter, D., Sobala, A., Malim, M. H. Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells. J. Vis. Exp. (143), e58715, doi:10.3791/58715 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter