Modeling Mitochondrial Disease Using Brain Organoids: A Focus on Mitochondrial Encephalomyopathy, Lactic Acidosis, and Stroke-like Episodes

Summary

Brain organoids serve as a valuable model for Mitochondrial Encephalomyopathy, Lactic Acidosis, and Stroke-like episodes (MELAS) studies, offering insights into their underlying pathophysiology and providing a platform for drug screening. Organoids derived from cell lines with varying levels of heteroplasmy of disease-causing genes exhibit significant phenotypic differences.

Abstract

Mitochondrial Encephalomyopathy, Lactic Acidosis, and Stroke-like episodes (MELAS) are mitochondrial disorders most commonly caused by a m.3243A>G variant in mitochondrial tRNA^Leu. To investigate the pathophysiology of MELAS, we generated brain organoids from multiple induced pluripotent stem cell (iPSC) lines derived from a patient with MELAS carrying the m.3243A>G variant. These lines share an identical nuclear genetic background but differ in their heteroplasmy levels involving the m.3243A>G variant. We observed significant differences in organoid size, morphology, and neural induction efficiency, which correlated with the degree of heteroplasmy. Dissociated neurons from the organoids were transferred into a 2D-culture system, which is convenient and suitable for high-throughput drug screening. The organoids also exhibited significant differences in the formation of neural networks, depending on heteroplasmy levels. Our results suggest that patient-derived iPSC-based organoid models represent a useful platform for studying MELAS mechanisms and for drug screening. This video presents comprehensive and user-friendly methods, including protocols for generating organoids and evaluating phenotypes.

Introduction

Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) are mitochondrial diseases that are characterized by neurological dysfunction, stroke-like episodes, and various systemic symptoms. The most common cause is a m.3243A>G variant in the mitochondrial leucine tRNA gene, MT-TL1¹. This variant is believed to impair taurine modification at the anticodon, thereby reducing leucine translation efficiency and contributing to mitochondrial dysfunction in MELAS^2,3,4. Notably, improvements in symptoms have been reported following high-dose taurine administration^5,6. However, the presence of non-responders suggests that additional, as yet unidentified, pathophysiological mechanisms may contribute to disease in individuals harboring the m.3243A>G variant.

To elucidate disease mechanisms caused by genetic variants, it is ideal to use experimental models in which all variables are identical except for the causative variant, enabling accurate phenotypic comparisons. Genome-edited cell lines and animal models with corrected variants are often used as controls for nuclear gene disorders. However, repair of mtDNA variants remains technically challenging, even with advanced genome editing technologies⁷. Therefore, the establishment of experimental models with identical nuclear backgrounds remains challenging. To address this issue, we utilized two induced pluripotent stem cell (iPSC) lines derived from the same patient with MELAS that differ only in their heteroplasmy levels (i.e., the proportion of mitochondrial DNA carrying the MT-TL1 m.3243A>G variant⁸), and generated brain organoids as a disease model. Although heteroplasmy levels can fluctuate during cell passaging or differentiation, potentially influencing phenotypes and causing batch-to-batch variability in experimental outcomes, patient-derived cells carrying mitochondrial gene variants remain valuable for investigating disease pathogenesis.

In this study, we generated brain organoids from iPSCs derived from a patient with MELAS and investigated their pathophysiology to better understand disease mechanisms. Using two iPSC lines with high and low heteroplasmy levels, we observed significant differences in neural induction efficiency, which correlated with the degree of heteroplasmy. Our findings suggest that patient-derived iPSC-based brain organoids provide a valuable platform for elucidating the mechanisms underlying MELAS and for facilitating drug screening.

Protocol

The two iPSC lines (2-6 and 2-8) were derived from the same MELAS patient's fibroblasts using well-established methods⁸. They differ only in their heteroplasmy levels. The 414C2 iPSC line established from a healthy individual was used as a control. The protocol used in this study followed the guidelines of the Ethics Committee of Kitasato University School of Medicine (#G22-02).

1. Cell culture

1. Thawing frozen cell stocks
   1. Prepare 6-well plates by coating with laminin according to the manufacturer's instructions.
   2. Warm the culture medium for feeder-free iPSCs containing 10 µM ROCK inhibitor to 37 °C.
   3. Retrieve the frozen iPSC vial from the liquid nitrogen (LqN₂) tank and rapidly thaw in a 37 °C water bath.
   4. Transfer the thawed suspension into 10 mL of prewarmed medium. Centrifuge at 120 × g for 5 min at room temperature (22 °C).
   5. Carefully remove the supernatant and gently resuspend the pellet by tapping the tube. Add fresh medium and seed cells into 6-well plates precoated with laminin. Incubate at 37 °C in a humidified incubator with 5% CO₂.
2. Medium change
   1. Replace the medium (without ROCK inhibitor) every 1-2 days.

2. Generation of cerebral organoids

1. Initiation of differentiation (Day 0)
   1. Remove medium from iPSC (~70-80% confluent) culture plates. Wash cells with PBS.
   2. Add enzyme solution and incubate at 37 °C for 5 min.
   3. Add medium to stop the reaction. Transfer cells into a 15 mL tube. Centrifuge at 190 × g for 5 min at room temperature (22 °C).
   4. Resuspend the pellet in 1 mL of differentiation medium containing 30 µM ROCK inhibitor, 5 µM SB431542, and 2.5 µM IWP-2.
      NOTE: The basic medium is the same as that used in step 1.1.2.
   5. Count the cells. Seed 3 × 10³ cells in 100 µL per well in U-shaped, 96-well, low-attachment plates. Incubate for 6 days at 37 °C, 5% CO₂.
2. Medium change (Day 6)
   1. Transfer organoids (from step 2.1.5) from a 96-well plate to a 10 cm dish using a wide-bore pipette. Add 50 µL of medium (DMEM/F12 with 1% N2, 1% glutamine substitute 1% NEAA, 2.5 µM IWP-2, 5 µg/mL heparan sulfate, and 1% PS) to each well of a new 96-well plate.
      NOTE: Use wide-bore pipettes throughout the experiments when transferring organoids to avoid disrupting their 3D-structure. Additionally, 8-channel pipettes are helpful for performing experiments quickly and accurately.
   2. Collect organoids into 2 mL tubes. Carefully remove the medium so as not to aspirate the organoids and add 1.5 mL of DMEM/F12. Repeat 3x to wash the organoids.
   3. Remove medium and add 500 µL of fresh medium to tubes with organoids. Transfer all organoids to a 10 cm dish, then add 5 mL of medium to make it easier to pick up each organoid.
   4. Pick up a single organoid using a micropipette adjusted to 50 µL and transfer it to one well of 96-well plate. Repeat until all of the organoids are transferred to the 96-well plate (final volume 100 µL). Incubate for 3 days at 37 °C, 5% CO₂.
3. Medium change (Day 9)
   1. (Optional) Transfer organoids to a 10 cm dish when using 8-channel pipettes. Skip step 2.3.1 when using single-channel micropipettes and proceed to step 2.3.2.
   2. Collect organoids into 2 mL tubes. Wash 3x with DMEM/F12 as step 2.2.2.
   3. Resuspend in differentiation medium (1:1 DMEM/F12 and neurobasal) containing 1% N2, 2% B27 without vitamin A, 100 µM 2-mercaptoethanol (ME), 2.5 µg/mL insulin, 1% glutamine substitute, 0.5% NEAA, and 1% basement membrane extract.
      NOTE: Prepare small aliquots of basement membrane extract for single use and store at -20 °C until needed. Thaw the extract at 4 °C without allowing it to exceed 8 °C, then mix it into cold medium and warm the medium at room temperature for approximately 30 min.
   4. Transfer ~10 organoids per well into a 6-well plate. Adjust final volume of medium for 1 well to 2 mL. Culture statically for 6 days at 37 °C, 5% CO₂.
4. Medium change (Day 15)
   1. Collect organoids into 15 mL tubes. Leave the tube undisturbed until all organoids have settled. Remove supernatant and add fresh differentiation medium (same as step 2.3.3 but with B27 + vitamin A).
      NOTE: Usually, organoids settle at the bottom of the tube without centrifugation. However, small organoids derived from patient iPSCs may not sink efficiently. In that case, centrifuge the tubes at 120 × g for 3 min at room temperature to collect the organoids.
   2. Transfer ~10 organoids per well into a 6-well plate. Culture statically for 15 days at 37 °C, 5% CO₂.
   3. Replace medium every 5-7 days until Day 30.

3. Dissociation of cerebral organoids for 2D culture (Day 30)

1. Coating plates with poly-L-ornithine (PO)
   1. Prepare PO stock solution by dissolving 10 mg of PO in 66.7 mL of H₂O and make small aliquots for single use. Store them at -20 °C until use.
   2. Dilute the PO stock solution 1:5 with H₂O and coat culture plates with the diluted solution. Incubate overnight at 37 °C.
2. Laminin coating
   1. Remove PO and wash wells 3 x 5 min with PBS.
   2. Add laminin (1:1,000 in PBS) and incubate at 37 °C for 3 h or overnight.
      NOTE: Stock solution of laminin is 1 mg/mL. Prepare small aliquots and store at -80 °C until needed.
3. Dissociation into single neurons
   1. Thaw the dissociation solution at 4 °C for 1 h before use.
   2. Transfer organoids into a 15 mL tube and leave the tube undisturbed until all organoids have settled. Remove supernatant and add 5mL of PBS to rinse organoids.
   3. After removing PBS, add 1 mL of enzyme solution and pipette gently 1–2x. Incubate at 37 °C for 5 min; pipette several times. If necessary, incubate for an additional 2–3 min. Pipette again to complete dissociation.
   4. Centrifuge at 200 × g for 5 min. Remove supernatant, add 1 mL of dispersion solution, and pipette.
   5. Layer isolation solution beneath and centrifuge at 200 × g for 5 min.
   6. Add 1 mL of neuronal medium (neurobasal with 1% B27, 0.25% glutamine substitute, 1% PS) and mix. Pass suspension through a 70 µm strainer into a 50 mL tube.
   7. Count the cells. Seed cells at 1 × 10⁵ cells/cm² on PO/laminin-coated plates. Replace medium every 4-7 days until Day 60.

4. Harvesting cells and organoids for cellular and molecular analysis

1. Organoid fixation for immunofluorescence (Day 30)
   1. Harvest organoids (step 2.4.3) into microtubes.
   2. Remove medium carefully not to aspirate organoids, and add 1 mL of PBS to rinse organoids.
   3. Remove PBS carefully not to aspirate organoids, and add 4% paraformaldehyde (PFA) to fix for 30 min at room temperature.
   4. Wash 3x with PBS.
   5. Store at 4 °C until use.
2. Organoid collection for RT-qPCR (Day 30)
   1. Transfer organoids (step 2.4.3) into microtubes. Wash with PBS as described in step 4.1.2.
   2. Add lysis buffer and snap-freeze in liquid nitrogen (LqN₂). Store at −80 °C until use.
3. Cell fixation for immunofluorescence (Day 60)
   1. Remove culture medium and add PBS to wash cells.
   2. Fix in 4% PFA for 15 min at room temperature.
   3. Remove PFA and add PBS to wash cells. Repeat this step 3x.
   4. Store at 4 °C until use.

5. RT-qPCR

1. Extract total RNA from organoids according to the kit manufacturer's instructions.
2. Synthesize cDNA from 1 µg of total RNA prepared in Step 5.1 according to the kit manufacturer's instructions in a total reaction volume of 20 µL.
3. Perform quantitative PCR using the following primers: FOXG1_forward: CGCCAGATTTCCATGTGTGC; FOXG1_reverse: GTTCTCAAGGTCTGCGTCCA; ACTB_forward: TGAAGTGTGACGTGGACATC; ACTB_reverse: GGAGGAGCAATGATCTTGAT. Set up the final concentration for each reaction as follows: 1x fluorescent master mix, 0.25 µM forward primer, 0.25 µM reverse primer. Total reaction volume is 15 µL, including 0.2 µL of cDNA from Step 5.2. Use the following PCR conditions: initial denaturation at 95 °C for 1 min; 40 cycles of 95 °C for 15 s and 60 °C for 30 s.
4. Normalize FOXG1 expression to ACTB as the internal control.

6. Immunofluorescence staining

1. Incubate organoids (Day 30) in 10% sucrose for 1 h at 4 °C, then 30% sucrose for ≥3 h at 4 °C.
2. Mount organoids in embedding medium and prepare cryosection (10 µm) using cryostat. Store sections on slide glasses at −20 °C until use.
3. Remove embedding medium by PBS wash (2 x 5 min).
4. Permeabilize in 0.3% PBST for 10 min. Wash with PBS.
5. Block in 10% normal goat serum in 0.1% PBST for 1 h. Incubate overnight at 4 °C with primary antibodies: anti-FOXG1 (1:200), anti-TUBB3 (1:500-1:1,000). Wash 3x with PBS.
6. Incubate with secondary antibody (1:500) + Hoechst 33258 (1:500) for 1 h. Wash 3x with PBS.
7. Mount and observe under a confocal microscope.

7. Heteroplasmy analysis

1. Harvest iPSCs using cell scrapers and transfer to microtubes. Add 0.5 mL of PBS and centrifuge at 100 × g for 5 min. Remove supernatant and proceed to Step 7.2.
2. Extract total DNA according to the kit manufacturer's instructions.
3. Set up the final concentration for each PCR reaction: 1x fluorescent master mix, 0.25 µM forward primer, 0.25 µM reverse primer. Total reaction volume is 15 µL, including 50 ng of total DNA from Step 7.2. Use the following PCR conditions: initial denaturation at 95 °C for 1 min; 40 cycles of 95 °C for 15 s and 60 °C for 30 s. Primer sequences are as follows: MELASwt_foward: gtttgttaagatggcagagc; MELASwt_reverse: ggaattgaacctctgactgtaaagttt; MELASmut_foward: gtttgttaagatggcagg; MELASmut_reverse: ggaattgaacctctgactgtaaagttt; FBXO15_ foward: gccaggaggtcttcgctgta; FBXO15_ reverse: aatgcacggctagggtcaaa.
4. Use threshold cycle values to calculate mitochondrial DNA copy number (mutant vs wild-type).
5. Normalize to FBXO15 nuclear gene copy number.

8. Evaluation of organoid size and shape

1. Capture images of organoids using microscope with TIFF format.
2. Measure size and circularity using open-source image analysis software. Open the TIFF files saved in Step 8.1 by clicking File | Open and selecting the file. Choose Freehand selections and trace the organoid. Then Click Analyze | Measure. The values for Area and Circularity in the results were used for the analysis in Step 8.3.
3. Analyze the data by performing a t-test to evaluate whether there are significant differences compared with the control lines using statistical software.

Results

We generated brain organoids and conducted 2D neuronal cultures using a relatively simple protocol with minor modifications based on Nakamura et al.⁹ (Figure 1). In the previous protocol, V-shaped 96-well plates were used, whereas in this study, we used U-shaped 96-well low-attachment plates to allow the cells to naturally aggregate at the center of each well. Using the healthy control iPSC line 414C2, we successfully induced brain organoids containing FOXG1-positive ...

Discussion

Organoids induced from human embryonic stem cells (ESCs)/iPSCs represent promising disease models for rare intractable diseases, whereas the generation of brain organoids typically requires extended culture periods lasting several months¹⁰ and the use of expensive equipment, such as an engineered container that continuously stirs the culture medium and maintains stable conditions for long-term 3D cell culture. In this study, we established brain organoids within a short timeframe using standard ce...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
10 cm cell culture dish	corning	353003
6 well plate ultra low attachment surface	corning	3471
70 μm cell strainer	corning	352350
Accutase	nacalai tesque	12679-54	enzymes used to dissociate iPSCs
B27 supplement	Thermofischer scientific	17504001
B27 supplement minus vitamin A	Thermofischer scientific	12587010
β-mercaptoethanol (2-ME)	sigma	M3148	Discard according to the institution's rules.
Cell Culture 6 well multi plate	corning	353046
cell saver tip	BMBio ECO	BMT-200W	wide-bore pipett tip
cell scrapers	SUMITOMO BAKELITECO., LTD.	MS-93100
Confocal microscope	Zeiss	LSM710
Cryostat	Leica	CM3050
Culture Mouse Laminin 1	R&D	3400-010-02	used for coating plates for 2D cultures of dissociated neurons
DMEM/F12	FUJIFILM Wako Pure Chermical Co.	042-30795
Fluorescence Mounting Medium	DAKO	S302380-2	mounting medium
FOXG1 antibody	abcam	ab196868
Glutamax	Thermofischer scientific	35050061
Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor Plus 488	Thermofischer scientific	A32723
Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor Plus 555	Thermofischer scientific	A32732
Heparan Sulfate (HS)	sigma	H7640
High capacity RNA-to-cDNA Kit	Thermofischer scientific	4387406	used to synthesize cDNA from RNA
Hoechst 33258	Thermofischer scientific	H3569
ImageJ		version 1.52a	used to measure size and circularity of organoids
iMatrix-511 silk	Takara Bio Inc.	892021	coating for plates for iPSC culture
insulin	FUJIFILM Wako Pure Chermical Co.	090-06481
IWP2	Tocris Bioscience	3533
Keyence BZ-X810	Keyence	BZ-X810	used to capture images for Figure 3A
LSM710	Carl Zeiss AG		confocal microscope
LSM980	Carl Zeiss AG		confocal microscope
LUNA Universal qPCR Master Mix	New England Biolabs	M3003
Matrigel	Corning	354277
N2 supplement	Thermofischer scientific	17502001
Neurobasal medium	Thermofischer scientific	21103049
Neuron Dissociation Solution	FUJIFILM Wako Pure Chermical Co.	291-78001
non-essential amino acids (NEAA)	nacalai tesque	06344-56
Normal Goat Serum	Jackson ImmunoResearch Inc.	005000121
Nunclon Sphera 96-Well, Nunclon Sphera-Treated, U-Shaped-Bottom Microplate	Thermofischer scientific	174929
paraformaldehyde (PFA)	nacalai tesque	09154-85	Discard according to the institution's rules.
PBS	nacalai tesque	14249-24
PBS	nacalai tesque	27575-31
penicillin/streptomycin (PS)	nacalai tesque	26253-84
Poly-L-ornithine (PO)	sigma	P3655
Polyoxyethylene(10) Octylphenyl Ether (Triton)	FUJIFILM Wako Pure Chermical Co.	168-11805
PRISM	GraphPad	version 9.5.0
QIAamp DNA Mini Kit	QIAGEN	51304	used to extract total DNA
RNeasy Mini Kit	QIAGEN	74104	used to extract total RNA
SB-431542	Cayman Chemical	13031
slide glasses	MATSUNAMI	CRE-05
StemFit AK02N	Takara Bio Inc.	AK02N	medium used for the culture of undiffereintiated iPSCs and from differentiation Day 0 to Day 6
Sucrose	FUJIFILM Wako Pure Chermical Co.	196-00015
Tissue-Tek O.C.T. Compound	Sakura Finetek Japan Co.,Ltd.	4583	Cryopreservation medium
TUBB3 antibody	Promega	G712A
Y27632	FUJIFILM Wako Pure Chermical Co.	030-24021	ROCK inhibitor
ZEN	Carl Zeiss AG	2.3SP1(black edition)	software to analyze the images taken  with confocal microscope (LSM710)
ZEN	Carl Zeiss AG	2.6 (blue edition)	software to analyze the images taken  with confocal microscope (LSM980)