डीएनए Origami से एक जैव संवेदनशील रोबोट डिजाइनिंग

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

डीएनए origami डीएनए अणु की आत्म विधानसभा प्रोग्रामिंग द्वारा सटीक वस्तुओं nanoscale fabricating के लिए एक शक्तिशाली तरीका है. यहाँ, हम डीएनए origami जैविक संकेतों संवेदन और आकार बाद में एक वांछित प्रभाव को रिले, स्थानांतरण से जवाब देने में सक्षम एक रोबोट रोबोट डिजाइन करने के लिए उपयोग किया जा सकता है वर्णन कैसे.

Cite this Article

Copy Citation | Download Citations

Ben-Ishay, E., Abu-Horowitz, A., Bachelet, I. Designing a Bio-responsive Robot from DNA Origami. J. Vis. Exp. (77), e50268, doi:10.3791/50268 (2013).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Protocol

हम इस पत्र में डिजाइन करेंगे रोबोट एक चुना लक्ष्य कोशिका की सतह पर रिसेप्टर्स करने के लिए बाध्य करने के लिए एक मालवाहक सी उपलब्ध बनाने के द्वारा एक प्रोटीन पी का जवाब. रोबोट चित्र 1 में दिखाया गया है सी एक रिसेप्टर अवरुद्ध दवा हो सकता है,. अपने कार्य को नष्ट नहीं करता कि उपलब्ध होना चाहिए एक वृद्धि कारक आदि, और रासायनिक एक डीएनए oligonucleotide करने के लिए इसे जोड़ने के लिए एक तरीका है. रोबोट दो राज्यों की है. दो बाहरी 'होंठ' पर निष्क्रिय, डीएनए फाटकों संकरित रहे हैं, रोबोट इसे सुरक्षित तनहा है के भीतर किसी भी माल भरा हुआ है कि इस तरह के बंद रहता सुनिश्चित कर रही है. प्रोटीन पी की उपस्थिति में, रोबोट कार्गो खुला और पर्दाफाश करने के लिए अनुमति देने के लिए कई तंत्रों में से एक (नीचे) पर चर्चा के द्वारा या तो खुले फाटक. संरचना डिजाइनिंग, फाटकों यह ऐसा करने में सक्षम है जब रोबोट बंद राज्य में खुद पर बंद करने के लिए काफी लचीला हो गया है, और खुले राज्य के लिए वसंत उस पर विचार करें. एक डीएनए का व्यवहार मॉडलिंग संरचना को एकीकृत thermodynamic और यांत्रिक घटकों मुश्किल है, और वास्तविक वस्तु कुछ सुधार चलने की आवश्यकता हो सकती है. फिर भी, हम यहाँ पर बनाया जा सकता है जो एक सामान्य काम कर मॉडल का उपयोग करते हुए डिजाइन की प्रक्रिया पर ध्यान केंद्रित.

नोट

डीएनए origami डिजाइन और तह की प्रक्रिया का एक अधिक व्यापक समझ के लिए, हम अत्यधिक अमूर्त डिजाइन अंतरफलक में डीएनए का प्रतिनिधित्व और कैसे यह एक की वास्तविक आणविक संरचना से संबंधित है जो बताते हैं कि डगलस और उनके सहयोगियों ने 19 से मूल caDNAno पेपर पढ़ने की सिफारिश 3 डी डीएनए आकार. यह पत्र एक बहुत स्पष्ट तरीके से caDNAno प्रतिनिधित्व और इंटरफेस का वर्णन दो वीडियो ट्यूटोरियल के साथ है. इसके अतिरिक्त, हम Dietz और कई महत्वपूर्ण पहलुओं और Cando विश्लेषण उपकरण 21 सहित तह प्रक्रिया की विस्तृत प्रोटोकॉल का वर्णन सहयोगियों से अधिक हाल ही में अखबार पढ़ने की सलाह देते हैं.

tle "> 1. caDNAno 2.0 और Autodesk माया 2012 डाउनलोड और स्थापित करें

नोट: Autodesk सॉफ्टवेयर छात्रों और शैक्षणिक उपयोग के लिए स्वतंत्र है. नीचे दिए गए निर्देशों पर Autodesk एक अकादमिक खाते की स्थापना शामिल है.

  1. पर एक शैक्षिक खाता बनाएँ http://students.autodesk.com/ . खाता सेटअप ई - मेल प्राप्त करने के बाद, सक्रियण लिंक पर क्लिक करें और वांछित के रूप में अपनी वरीयताओं में भरें.
  2. डाउनलोड केंद्र से माया 2012 के मुक्त संस्करण डाउनलोड करें.
  3. आपके कंप्यूटर पर माया 2012 को स्थापित करें.
  4. CaDNAno 2.0 स्थापित करने से पहले एक बार माया चलाएँ.
  5. से caDNAno 2.0 के नवीनतम संस्करण को डाउनलोड और स्थापित http://cadnano.org/ .
  6. माया 2012 रन. एक caDNAno आइकन ग्राफिकल यूजर इंटरफेस के ऊपरी दाएँ कोने में दिखाई देनी चाहिए. CaDNAno में जाने के लिए आइकन पर क्लिक करें.

2. Outlवांछित आकार और पाड़ किनारा पथ ine

  1. : माया के भीतर caDNAno के डिजाइन इंटरफेस 3 पैनल (चित्रा 2) भी शामिल है
    1. शीर्ष पैनल: आकार शुरू में उल्लिखित है जहां जाली देखने के लिए,. इस पैनल में डबल हेलिक्स स्तर के कार्यों के लिए सक्षम बनाता है और आकार के एक वर्ग दृष्टिकोण प्रदान करता है.
    2. नीचे पैनल: संपादन पैनल, एकल आधार स्तर के कार्यों को सक्षम करने.
    3. राइट पैनल: आकार की एक माया जनित वास्तविक समय 3 डी मॉडल
  2. "मधुकोश" आइकन पर क्लिक करें. शीर्ष पैनल में जाली पर zooming और बाहर माउस द्वारा किया जा सकता है, क्रमशः नीचे स्क्रॉल और.
    caDNAno दो संभव डिजाइन lattices, छत्ते और वर्ग सक्षम बनाता है, वर्ग जाली आम तौर पर के रूप में अच्छी तरह से 22 इस्तेमाल किया जा सकता है, हालांकि इस पत्र में हम, छत्ते लेआउट का उपयोग करेगा.
  3. बाईं पैनल पर वांछित आकार की धारा ड्राइंग द्वारा शुरू करो.
    प्रत्येक चक्र एक डबल डीएनए हेलिक्स का प्रतिनिधित्व करता है. चर्चा करने के लिएआकृति का निर्माण जो हेलिक्स oose, बस अपने केंद्र (चित्रा 3) पर छोड़ दिया क्लिक करें. पूरे आकार उल्लिखित है जब तक हेलिक्स द्वारा हेलिक्स जारी. वैकल्पिक रूप से, आकार बाईं माउस बटन दबाने और लगातार आकार की रूपरेखा बनाकर तैयार किया जा सकता है. कोई कार्रवाई संपादन मेनू पर क्लिक करके नष्ट कर दिया और "रद्द करें", या कीबोर्ड शॉर्टकट Ctrl + जेड (पीसी) या सीएमडी + Z (मैक) द्वारा. किया जा सकता है
    इस बिंदु पर, चयनित हेलिक्स पीला दिखाई देगा. इसी समय, नीचे पैनल इन हेलिक्स के शामिल आकार के एक पक्ष को देखने, प्रदर्शित करेगा. नीचे के पैनल में नंबर हेलिक्स शीर्ष में नंबरिंग के अनुरूप है.
  4. नीचे पैनल निरीक्षण. पंक्तियों डबल हेलिक्स की दो किस्में हैं, एक आधार (चित्रा 4) का प्रतिनिधित्व प्रत्येक वर्ग के साथ: प्रत्येक हेलिक्स चौकों की दो पंक्तियों का प्रतिनिधित्व करती है.
    संपादन कार्रवाई एक हेलिक्स साथ जगह ले जहां नारंगी ऊर्ध्वाधर बार निर्धारित करता है. ग्रिड के साथ आधार स्थिति के रूप में प्रकट होता हैनारंगी पट्टी के ऊपर एक संख्या. हेलिक्स ढांचे के डिफ़ॉल्ट लंबाई 42 ठिकानों है. लंबाई संपादन पैनल के शीर्ष दाएं कोने में ग्रे तीर माउस की एक क्लिक और विस्तार लम्बाई (डीएनए हेलिक्स के दो पूर्ण मुड़ता के अनुरूप जो 21 के गुणकों में चयन करके बढ़ाया जा सकता है, जिसमें एक बारी 10.5 तक फैला कुर्सियां) (चित्रा 4). ग्रिड चुना तीर की दिशा का विस्तार होगा.
  5. आकार भर में वास्तविक पाड़ किनारा मार्ग की साजिश करने के लिए, माउस बटन प्रेस पहली हेलिक्स से शुरू करते हैं और वे शुरू में खंड 2.3 में चयन किया गया था उसी के आदेश के बाद सभी हेलिक्स से लगातार चलते हैं. ध्यान दें कि:
    1. हेलिक्स इस समय नारंगी रंग बदल जाएगा चयन किया.
    2. नीचे के पैनल में, पाड़ किनारा टुकड़े स्वचालित रूप से चयनित हेलिक्स में तैयार हो जाएगा.
    3. सही पैनल वास्तविक समय में बनाया जा रहा है आकार के 3 डी मॉडल दिखाएगा. इस के अंत मेंप्रक्रिया, पाड़ किनारा मार्ग का एक मसौदा स्वतः नीचे पैनल (चित्रा 5) में तैयार हो जाएगा.
  6. पाड़ पथ के सभी बाएँ तरफ के किनारों के आसपास एक आयत ड्रा. ताकि चयनित किनारों लाल (चित्रा 6) दिखाई देंगे.
  7. ग्रिड के बाईं ओर करने के लिए एक समूह के रूप में चयनित किनारों को खींचकर पाड़ पथ बढ़ाएँ. पथ ठीक बढ़ाया है जब तक सही किनारों के लिए इस प्रक्रिया को दोहराएं. पाड़ विस्तार भी सही पैनल (चित्रा 7) में 3 डी आकार फैली ध्यान दें.
  8. बाकी से अलग कर रहे हैं कि पाड़ पथ हिस्सों का पता लगाएँ, और उन्हें कनेक्ट. हमारे आकार में, उदाहरण के लिए, हेलिक्स 0-9 एक अलग हिस्सा है. हेलिक्स 9 जरूरतों हेलिक्स 12 से जुड़े होने की (हेलिक्स 9 और 10 आकार [शीर्ष पैनल] इसलिए वे नहीं जोड़ा जा सकता में आसन्न नहीं कर रहे हैं उस पर ध्यान दें).
  9. जुड़े होने की किस्में पर ज़ूम, और का उपयोग कर "चुनें" उपकरण एक पर किसी भी बिंदु पर क्लिक करेंकिस्में. एक नीले पाड़ टुकड़ा के साथ किसी भी बिंदु पर क्लिक करने पर, 'पुल' माउस क्रॉसओवर अनुमति दी जाती है जहां पदों denoting, हेलिक्स के बीच दिखाई देते हैं. इन स्थितियों में, आसन्न हेलिक्स में कुर्सियां ​​किस्में डीएनए विरूपण या घुमा बिना हेलिक्स से हेलिक्स को पार करने की अनुमति देता है, सीधे एक दूसरे का सामना. प्रत्येक पुल आइकन के बगल में प्रदर्शित संख्या यह करने के लिए विदेशी होगा हेलिक्स की संख्या (चित्रा 8) इंगित करता है.
  10. क्रॉसओवर बनाने के लिए, पसंद के पुल आइकन पर क्लिक करें छोड़ दिया है. एक पाड़ विदेशी (9 चित्रा) पाड़ हेलिक्स से हेलिक्स को इस बिंदु पर पार करती है, जिसका अर्थ है उत्पन्न हो जाएगा. इस प्रक्रिया को दोहराएं पाड़ बहती सभी हेलिक्स और पूरे आकार तक फैला है कि एक बंद लूप बनाता है, आकार के बाकी हिस्सों से अलग कर रहे हैं कि कोई क्षेत्रों छोड़ने तक.
    क्रॉसओवर सॉफ्टवेयर में एक दूरी अवधि के लिए दिखाई है, जबकि वास्तविकता में वे किसी भी डीएनए आधार शामिल नहीं है कि ध्यान दें. शारीरिक रूप से, विदेशी"पुल" एक साथ सटे हेलिक्स से दो कुर्सियां ​​कि लिंक डीएनए रीढ़ की केवल एक फॉस्फेट इकाई होता है.
  11. अगले चरण पर जाने से पहले, पूरे पाड़ निरंतर है, और इसके बारे में कोई हिस्सा दूसरों से अलग है सुनिश्चित करें.

3. खुलने तंत्र अक्ष परिभाषित करें

वर्णित रोबोट अपने पेलोड को बेनकाब करने के लिए एक परिभाषित जैविक इनपुट के जवाब में खुलता है. खोलने (, हेलिक्स 0-29 एक आधा श्रृंगार 30-61 दूसरी छमाही श्रृंगार हेलिक्स) दो हिस्सों के साथ, एक खोल की तरह ढंग से जगह लेता है दो कुल्हाड़ियों के आसपास घूमने. कुल्हाड़ियों उन हिस्सों के बीच केवल क्रॉसओवर हैं और ग्रिड के बाएँ किनारे के लिए केवल में या पास तैनात कर रहे हैं जो हेलिक्स 29-30 और 61-0, बीच क्रॉसओवर से बनते हैं. ठीक किनारे गेट किस्में (नीचे) पर चर्चा में शामिल होंगे.

  1. हेलिक्स 29-30 के बीच मौजूदा विदेशी मिटा. विदेशी मिटाने के लिए, या तो किनारा में "घुटने" बिंदु क्लिक करें.इस अंतरराष्ट्रीय हुआ करता था जहां दोनों किस्में में एक निक छोड़ देता है. सीवन nicks के लिए, SHIFT दबाएँ और प्रत्येक निक क्लिक करें.
  2. के रूप में बंद के रूप में संभव ग्रिड (10 चित्रा) के बाएँ किनारे के लिए हेलिक्स 29-30 के बीच एक नई अंतरराष्ट्रीय बनाएँ.
  3. के रूप में बंद के रूप में संभव ग्रिड के बाएँ किनारे के लिए हेलिक्स 61 और 0 के बीच एक नई अंतरराष्ट्रीय बनाएँ.

4. पेलोड अनुलग्नक साइटें परिभाषित करें

हम पाड़ किनारा मार्ग की साजिश रचने समाप्त करने के बाद, हम पेलोड लगाव (लोडिंग) साइटों को परिभाषित करने की जरूरत है. लोड हो रहा है साइटों एकल असहाय 'शाखाओं' के रूप में उनके हेलिक्स के बाहर का विस्तार तथ्य यह है कि प्रधान किस्में में हैं. यह हेलिक्स साथ इस शाखाओं में यह वांछित दिशा में फैली हुई है सुनिश्चित करने के लिए होता है, जहां बहुत ठीक से परिभाषित करने के लिए इसलिए महत्वपूर्ण है. हम मनमाने ढंग से प्रधान एक्सटेंशन को परिभाषित करते हैं, लोडिंग साइटों के बजाय आंतरिक पक्ष की रोबोट के बाहरी किनारे पर हो सकता है.

टीएक प्रधान ही, हम मुख्य शरीर से प्रधान की शाखाओं में दिशात्मक के लिए गाइड के रूप में कार्य करता है जो एक अतिरिक्त हेलिक्स, साजिश एक विशेष दिशा में फैली हुई है यकीन है कि ओ. वांछित लोडिंग साइट प्रधान विस्तार के बाद, गाइड हेलिक्स निकाल दिया जाता है.

  1. हमें रोबोट की आंतरिक पक्ष की ओर का सामना करना पड़ 4 लोड साइटों को परिभाषित करते हैं. लोड साइटों हेलिक्स 3, 27, 34, और 58 के बाहर शाखा जाएगा. प्रत्येक साइट के लिए, शीर्ष पैनल में आंतरिक पक्ष (चित्रा 11) का सामना कर रहा है कि इन हेलिक्स को तुरंत आसन्न हेलिक्स क्लिक करें. यह नीचे के पैनल में ग्रिड को हेलिक्स बढ़ जाएगा. अभी तक इन हेलिक्स दूसरी क्लिक न करें.

5. स्टेपल्स जोड़ें और संपादित करें

  1. "AutoStaple" पर क्लिक करें. सॉफ्टवेयर स्वचालित रूप से विभिन्न रंगों में प्रधान दृश्यों (चित्रा 12) बढ़ जाएगा. स्टेपल सही पैनल में 3 डी आकार को जोड़ दिया गया है कि ध्यान दें. स्टेपल रंग नीचे और सही पैनल के लिए संगत कर रहे हैं. Additi मेंपर, एक प्रधान को इंगित करता है जो इंटरफेस, के निचले बाएं कोने पर एक सूचक है.
    नोट: स्टेपल, बहुत छोटा है या परिपत्र बहुत लंबा नहीं हो सकता. स्टेपल के अधिकांश यहाँ उत्पन्न इन मानदंडों को पूरा नहीं करते हैं, और संपादित करने के लिए है. उन्हें संपादन में पहला कदम (अगले कदम देखें) स्वचालित है.
  2. "AutoBreak" पर क्लिक करें. एक संवाद बॉक्स इस कार्रवाई के लिए उपयोगकर्ता द्वारा निर्धारित मापदंडों के लिए पूछ रहे हैं, चित्रा (13) खुल जाएगा:
    1. लक्ष्य लम्बाई (बीपी): प्रधान की अनुमानित लंबाई यदि संभव हो तो
    2. न्यूनतम लम्बाई (बीपी): न्यूनतम लंबाई एक प्रधान के लिए अनुमति
    3. अधिकतम लंबाई (बीपी): अधिकतम लंबाई एक प्रधान के लिए अनुमति
    4. एक प्रधान अपनी बढ़त और एक विदेशी के बीच या दो क्रॉसओवर के बीच पार कर सकते आधार जोड़े की न्यूनतम संख्या: xover (बीपी) को जिले के न्यूनतम.
      डिफ़ॉल्ट पैरामीटर का प्रयोग करें, ठीक क्लिक करें. सॉफ्टवेयर (चित्रा 1 अपनी क्षमता का सबसे अच्छा करने के लिए इन मापदंडों के अनुसार स्टेपल टूट जाएगा4).
  3. इन हेलिक्स खोलने के लिए रोबोट को अलग और सक्षम करने के लिए सक्षम करने के लिए, हेलिक्स 29-30 और 61-0 के बीच सभी प्रधान क्रॉसओवर मिटा. प्रधान क्रॉसओवर मिटा भी कम या इस कार्रवाई का एक परिणाम के रूप में तर्कहीन हो जाते हैं कि सही स्टेपल करने के लिए कुछ मैनुअल संपादन की आवश्यकता होगी. ठीक ऐसा करने के लिए, निम्न अनुभाग में दिए गए निर्देशों का पालन करें.
    बरकरार वर्गों 3.2 और 3.3 में बनाया पाड़ क्रॉसओवर छोड़ने के लिए सुनिश्चित करें.
  4. उदाहरण के लिए, हेलिक्स 29 और 30 (चित्रा 15) के बीच बाएं से पहले प्रधान विदेशी (सियान और काले स्टेपल) पर विचार करें. यह लाल दिखाई देता है तो हटाएँ (चित्रा 16) मार तो, हर घुटने बिंदु या पुल पर क्लिक करके इस विदेशी के पुलों के दोनों मिटा.
  5. उन दोनों के बीच SHIFT दबाकर और निक क्लिक करके हेलिक्स 29 सीवन दो स्टेपल. इसी तरह, सीवन एक भी प्रधान (चित्रा 17) को किनारा 30 पर तीन स्टेपल. स्टेपल्स कर सकते हैंमैन्युअल रूप से एक किनारे पर क्लिक करने और यह रूप में वांछित खींचकर बढ़ाया या छोटा हो. किसी भी प्रधान परिपत्र फेरना नहीं ख्याल रखना. चित्रा 18 प्रधान क्रॉसओवर की पूरी संपादन के बाद हेलिक्स 29-30 के बीच के अंतर को दर्शाता है. हेलिक्स 0 और 61 के लिए इस प्रक्रिया को दोहराएं, और स्वयं एक हेलिक्स में सभी स्टेपल संपादित करें.
  6. वे आगे संपादन की आवश्यकता होती है, जिसका अर्थ है एक मोटी रेखा से तैयार कर रहे हैं कि स्टेपल लगाएँ. हर एक की जांच करने और आवश्यक के रूप में सही. उदाहरण के लिए, बहुत कम कर रहे हैं कि स्टेपल मिट (चित्रा 19) या यदि संभव हो तो बढ़ाया जा सकता है.

6. लोड हो रहा साइटें और गेट्स बनाएँ

  1. शीर्ष पैनल में लदान साइट हेलिक्स दूसरा क्लिक करें, और एक किनारे पर क्लिक करने और यह रूप में (चित्रा 20) वांछित खींचकर नीचे के पैनल में जिसके परिणामस्वरूप पाड़ किनारा टुकड़े का विस्तार.
  2. मैन्युअल टी के साथ इच्छित स्थान पर नारंगी खड़ी पट्टी रखकर इन पाड़ टुकड़े को स्टेपल जोड़वह पाड़, पाली पकड़ और क्लिक करके, बाईं पैनल पर गाइड हेलिक्स में जा रहे हैं. यह प्रत्येक हेलिक्स में एक प्रधान अग्रदूत (चित्रा 21) बढ़ जाएगा.
  3. क्लिक करके और खींच कर पूरी लंबाई के रूप में अच्छी तरह से करने के लिए प्रधान व्यापारियों बढ़ाएँ.
  4. गाइड किनारा (उदाहरण के लिए, हेलिक्स 62) और चेसिस (उदाहरण के लिए, हेलिक्स 3) के बीच की अंतरराष्ट्रीय पदों denoting, लाल पुल माउस लगाएँ.
  5. एक विदेशी परिचय और पुल आइकन (चित्रा 22) क्लिक करने के लिए सबसे सुविधाजनक स्थान चुनें. एक सुविधाजनक स्थान चेसिस में मौजूदा स्टेपल की न्यूनतम संपादन की आवश्यकता है.
  6. गाइड हेलिक्स में (हेलिक्स 62), लोड साइट का हिस्सा नहीं है कि प्रधान हिस्सा हटाने के लिए, और वांछित लंबाई में भाग लेने वाले हिस्से को छोटा. इच्छित लंबाई माल के विभिन्न प्रकार के लदान के लिए विशिष्टता, और बाध्यकारी शक्ति दोनों प्रदान करना चाहिए. आमतौर पर, एक 18 मेर पूंछ ठीक किया जाना चाहिए. प्रधान नाटकीय रहता है सुनिश्चित करेंजब तक यह एक पतली रेखा से wn, अन्यथा इसे संपादित.
  7. हवाई जहाज़ के पहिये में आवश्यक के रूप में बदल स्टेपल संपादित करें.
  8. गाइड (हेलिक्स 62) केवल प्रधान विस्तार छोड़ने मिटा.
  9. दोहराएँ सभी लोडिंग साइटों (चित्रा 23) के लिए 6.4-6.8 कदम.

7. गेट किस्में डिजाइनिंग

गेट किस्में हेलिक्स 29-30 और 61-0 से जोड़ने, कुल्हाड़ियों के लिए छोड़कर, केवल किस्में हैं. कुल्हाड़ियों के विपरीत, गेट किस्में क्रॉसओवर नहीं हैं. बल्कि, वे चुनाव के जैविक इनपुट के लिए संवेदक के रूप में कार्य करता है कि एक डबल असहाय खंड के लिए फार्म का संकरण. गेट duplexes विस्थापित हो जाने के बाद, पूरे रोबोट entropically कुल्हाड़ियों और खुले चारों ओर घूमना कर सकते हैं.

  1. गेट किस्में के लिए उचित पदों पर लगाएँ. ये हेलिक्स 29, 30, 61, और 0 पर स्टेपल किया जाएगा.
  2. उदाहरण के लिए, 29-30 गेट क्षेत्र की जांच. हेलिक्स पर 29 और 30 flanking सुविधाजनक प्रधान किस्में कर रहे हैंगेट किस्में के रूप में इस्तेमाल किया जा सकता है जो ग्रिड के दाईं ओर,. वे विपरीत दिशाओं का सामना ध्यान दें.
  3. आकृति के बाहर यह विस्तार करने के लिए संभावित गेट किस्में में से एक के किनारे पर क्लिक करें. किनारे एक पाड़ विदेशी अधिक झूठ है, तो इसका चयन केवल "stap" (लेस) अंतरफलक के शीर्ष दाईं ओर "चयन" उपकरण पट्टी में "scaf" (गुना) बंद क्लिक करके चयन कर रहे हैं सुनिश्चित करने के द्वारा सरल किया जा सकता है .
  4. गेट किस्में लिए फार्म दोनों स्टेपल बढ़ाएँ. इस विस्तार यह (चित्रा 24) की आवश्यकता है अगर स्टेपल संपादित करें. हेलिक्स 0 और 61 के गेट किस्में के लिए इस दोहराएँ.
    सेंसर डीएनए (जैसे aptamer) अनुक्रम पूरा होने के कदम पर गेट किनारा दृश्यों बदल देगा क्योंकि अब के लिए, वास्तविक लंबाई, कोई फर्क नहीं पड़ता कि ध्यान दें.

8. पाड़ अनुक्रम चुनें

  1. "Seq" उपकरण पर क्लिक करें. पाड़ किनारा पर कहीं भी रखें और क्लिक करें. एक संवाद बॉक्स के लिए हमें पूछ खुलेगापाड़ डीएनए स्रोत (चित्रा 25) का चयन करें.
  2. स्रोत डीएनए का चयन बहुत रोबोट आकार पर निर्भर करता है. उदाहरण के लिए, M13mp18 ssDNA (p7249), और उसके विस्तारित डेरिवेटिव (p7308 आदि) आम तौर पर पाड़ किनारा ~ 7 केबी लंबे समय है जब फिट, बड़े डीएनए origami आकार के लिए पसंद किया गया है जो. डिजाइन आकार के पाड़ चुना स्रोत की तुलना में काफी कम है, किसी भी प्रधान को संकरित नहीं है कि अतिरिक्त पाड़ किनारा तह आकार से फैला हुआ ssDNA के एक पाश पैदा करेगा. यह आमतौर पर अपेक्षाकृत कम छोरों के लिए छोटी सी समस्या बन गया है, जबकि बहु केबी लंबे छोरों काफी रोबोट की तह और समारोह के साथ हस्तक्षेप कर सकता है. इसलिए आकार पाड़ लंबाई करने के लिए चुना स्रोत फिट करने के लिए यह महत्वपूर्ण है.

उदाहरण के लिए, अगर पाड़ किनारा संवाद बॉक्स में पूर्व निर्धारित स्रोतों की तुलना में काफी कम है जो ~ 1600 अड्डों लंबा है एक छोटे आकार, गुना करने की जरूरत है, एक कस्टम अनुक्रम कर सकते हैंपाड़ के रूप में इस्तेमाल किया. कई स्रोतों पर विचार किया जा सकता है. उदाहरण के लिए, M13mp18 वांछित लंबाई का एक टुकड़ा है कि उत्पादन एक विशिष्ट प्रतिबंध एंजाइम के साथ पचा जा सकता है. इस तरह के एक स्रोत डिजाइनिंग NebCutter (पर किया जा सकता http://tools.neb.com/NEBcutter2/ M13mp18 अनुक्रम चिपकाकर) NebCutter इनपुट विंडो, और मानचित्रण प्रतिबंध साइटों में. एक अन्य विकल्प के न्यू इंग्लैंड Biolabs से उपलब्ध ऐसे phiX174 विरिअन ssDNA HaeIII पचाने के रूप में पूर्व पच ssDNA, उपयोग करने के लिए है.

  1. संवाद बॉक्स में, "M13mp18" पर क्लिक करें. चुने हुए डीएनए अनुक्रम पाड़ और नीचे के पैनल में प्रधान किस्में जोड़ दिया गया है कि ध्यान दें.

9. एक्सपोएक स्प्रेडशीट के रूप में आर टी स्टेपल अनुक्रम

  1. शीर्ष उपकरण पट्टी पर "निर्यात" क्लिक करें, और प्रधान सूची के लिए एक गंतव्य फ़ाइल नाम चुनें. "सहेजें" पर क्लिक करें.
  2. गंतव्य. Csv फ़ाइल का पता लगाएँ और इसे खुला.
  3. स्प्रेडशीट एक डीएनए संश्लेषण कंपनी है के रूप में भेजा जा सकता है जो प्रधान सूची से पता चलता है. पहले दो स्तंभों के आधार स्थिति दर्शाने कोष्ठक के अंदर हेलिक्स संख्या और संख्या denoting कोष्ठक बाहर संख्या के साथ शुरू और अंत निर्देशांक प्रदर्शित.

10. गेट और लोड दृश्यों निरुपित

  1. प्रधान सूची में, कुछ दृश्यों शुरू या प्रश्न चिह्न के एक स्ट्रिंग के साथ समाप्त देखेंगे कि "??". ये प्रश्न चिह्न नहीं पाड़ कतरा इन विशिष्ट प्रधान क्षेत्रों के साथ hybridizes के बाद, वे पूरक दृश्यों नहीं सौंपा जा सकता है कि निरूपित. ये वास्तव में गेट किस्में और लदान साइटों के लिए हम तैयार विस्तार कर रहे हैं, और इसलिए ये अब मैन्युअल सौंपा जा करने की जरूरत है. गेट:
    1. फाटक रोबोट सक्रिय अवस्था में निष्क्रिय से स्विच और उसके पेलोड का खुलासा होगा जिस पर जैविक इनपुट की प्रकृति का निर्धारण. प्रत्येक एकल dsDNA गेट एक जैविक इनपुट (या अधिक) के जवाब सांकेतिक शब्दों में बदलना कर सकते हैं, रोबोट सक्रियण के लिए आवश्यक आदानों की एक प्रोफाइल में परिभाषित किया जा सकता है.
      हमें रोबोट सक्रियण ट्रिगर जैविक क्यू संक्रामक बैक्टीरिया की उपस्थिति का संकेत मिलता है जो एक प्रतिबंध एंजाइम है कि इस उदाहरण के लिए मान लेते हैं.
    2. सबसे पहले गेट ssDNA किस्में उनके हेलिक्स के बाहर शाखाओं में बंटी के तुरंत बाद संकरण नहीं है पर विचार करें. गेट डिजाइनिंग अन्यथा तह दौरान संकरण में बाधा हो सकती है. इसलिए, प्रत्येक शाखा एक स्पेसर स्ट्रिंग के साथ शुरू करना चाहिए. इस क्रम में लचीलापन प्रदान करता है के रूप में हम आम तौर पर, स्पेसर तार के रूप में पाली टी का उपयोग करें.
    3. हम भी गेट संकरण क्षेत्र की लंबाई लक्ष्य प्रतिबंध बैठते हैं, जिसमें 20 ठिकानों है कि ग्रहणइसके बीच में ए.
    4. इसलिए गेट इस तरह लग सकता है:
      [हेलिक्स 29]-5'-..... TTTTTTTGTGAGTTxxxxxxGCTAGAG -3 '
      [हेलिक्स 30]-3'-..... TTTTTTTCACTCAAxxxxxxCGATCTC -5 '
      "....." पाड़ कतरा साथ hybridizes कि प्रधान क्षेत्र निरूपित, इसलिए यह पहले से ही एक दृश्य है और बदला नहीं जाना चाहिए.
      यादृच्छिक द्वैध "GTGAGTT" और इसके पूरक प्रतिबंध साइट आंशिक रूप से खुला नहीं है यह सुनिश्चित करता है, और एंजाइम द्वारा प्रभावी पाचन सुनिश्चित करने के लिए कुछ अतिरिक्त कुर्सियां ​​प्रदान करता है.
      "एक्स" प्रतिबंध साइट अर्थ.
      यादृच्छिक द्वैध "GCTAGAG" और इसके पूरक कुशलता से काम करने के लिए एंजाइम के लिए कुछ अतिरिक्त कुर्सियां ​​प्रदान करते हैं, लेकिन यह भी सुनिश्चित करें कि गेट कतरा अच्छा रोबोट बंद सुनिश्चित करने के लिए पर्याप्त रूप से लंबा है बनाता है.
      एक लक्ष्य के रूप में एक प्रतिबंध साइट चुनने से पहले, पूरे रोबोट संरचना, लदान साइटों और फाटक ही के अन्य भाग से नहीं पचा रहे हैं सुनिश्चित करेंचुनाव के एंजाइम. इस परीक्षा में NEBCutter 0 कटर सूची (पूरे दृश्य काट नहीं है जो एन्जाइम) एक enterobacterial संक्रामक की उपस्थिति का संकेत मिलता है कि एक संभावित एंजाइम के रूप Enterobacter Pantoea agglomerans से अलग कर डाला EagI,,.
    5. गेट अब यह (पीले रंग के निशान EagI प्रतिबंध साइट) की तरह दिखता है:
      [हेलिक्स 29]-5'-..... TTTTTTTGTGAGTTCGGCCGGCTAGAG -3 '
      [हेलिक्स 30]-3'-..... TTTTTTTCACTCAAGCCGGCCGATCTC -5 '
      इस डिजाइन मानता है कि नोट है कि पाचन के बाद, अनुक्रम "GTGAGTTCGG" (टी मीटर = 32 डिग्री सेल्सियस) रोबोट अब बंद पकड़ करने के लिए पर्याप्त रूप से लंबे समय तक या thermodynamically स्थिर नहीं है. इस धारणा की संभावना सबसे अधिक प्रयोगात्मक सत्यापित करने की आवश्यकता होगी.
    6. दूसरे गेट रोबोट केवल एक एंजाइम का जवाब होगा, या किसी अन्य साइट के साथ बनाया जा सकता है, रोबोट की बढ़ती विशिष्टता है, जो मामले में एक ही हो सकता है. अधिक प्रतिबंध साइटों में, एक ही किनारा पर जोड़ा जा सकता है रोबोट की जटिलता और विशिष्टता बढ़ती है.
  2. लोड हो रहा है साइटों:
    1. लोड साइट एक सार्वभौमिक अनुक्रम हो सकता है. वैकल्पिक रूप से, लोडिंग साइटों प्रतिरूपकता कमी लेकिन कार्गो अभिविन्यास और अनुपात (कार्गो के विभिन्न प्रकारों के लिए) पर नियंत्रण में सुधार होगा जो अद्वितीय दृश्यों, के आधार पर किया जा सकता है.
    2. प्रधान दिशा के अनुसार, रासायनिक समूह सही अंत (5 'या 3') पर मुहिम शुरू की है सुनिश्चित करें कि प्रोटीन, nanoparticle है, आदि: अंत में, लोडिंग साइट oligonucleotides के लिए उन्हें किसी भी पेलोड के साथ एकत्रित करने के लिए सक्षम करने के लिए एक रासायनिक कार्यात्मक समूह में शामिल होना चाहिए .

11. Cando में परिणाम अनुकरण

  1. काम एक. Json फ़ाइल के रूप में सहेजा है, के बाद यह विश्लेषण के लिए Cando पर अपलोड किया जा सकता है. Cando समाधान 21 में अपनी कठोरता और स्थिरता का अनुमान कर सकते हैं कि डीएनए संरचना की एक परिमित तत्व आधारित अनुकरण है.
  2. करने के लिए जाओami.org / "लक्ष्य =" _blank "> http://cando-dna-origami.org/
  3. "विश्लेषण के लिए एक caDNAno फ़ाइल भेजें" और सभी आवश्यक जानकारी भरने पर क्लिक करें.
  4. Cando में विश्लेषण आमतौर पर 15-20 मिनट तक लग जाते हैं. अंत में, एक ई - मेल संदेश हमें विश्लेषण सिमुलेशन परिणाम (चित्रा 26) डाउनलोड करने के लिए एक लिंक प्रदान करने, पूरा हो गया है पता है.

12. आदेश डीएनए और मोड़ो रोबोट

एक बार डिजाइन की प्रक्रिया पूरी हो चुकी है और Cando विश्लेषण उत्पाद का संतोषजनक भविष्यवाणी, 9-10 आदेश दिया जा सकता वर्गों में उत्पन्न प्रधान किनारा सूची से पता चलता है. आमतौर पर, प्रधान किस्में विशेष शुद्धि की आवश्यकता नहीं है, लेकिन यह इस तरह के फाटक या लोडिंग साइटों के रूप में विशेष प्रयोजन किस्में HPLC द्वारा शुद्ध किया जा सिफारिश की है.

या तो परमाणु शक्ति से जोड़ संरचना के दृश्य सहित उत्पाद के कदम निम्नलिखित डीएनए आदेश, अर्थात् तह, शोधन और मूल्यांकन,माइक्रोस्कोपी (AFM) या संचरण इलेक्ट्रॉन माइक्रोस्कोपी (मंदिर) इस पत्र के दायरे से बाहर हैं, और पिछली रिपोर्टों 17,18,20,21 में पाया जा सकता है. यहां बनाया गया रोबोट का एक मंदिर छवि एक उदाहरण (चित्रा 27) के रूप में लाया जाता है. नमूना तैयार करने और धुंधला हो जाना बिल्कुल के रूप में कहीं 21 में वर्णित किया गया.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

आंकड़े 1-25 डिजाइन की प्रक्रिया कदम दर कदम दिखा caDNAno 2.0 इंटरफेस के स्क्रीनशॉट रहे हैं. आकार के पार अनुभाग पहली पाड़ किनारा टुकड़े और पूरे पाड़ पथ (चित्रा 7) के पूरा होने से स्वत: इसके अलावा, इसके बाद चित्रा (3) को रेखांकित किया गया था. स्टेपल किस्में स्वतः, चित्रा (12) जोड़ा गया उपयोगकर्ता द्वारा निर्धारित मानकों (चित्रा 14) के अनुसार टूटा, और डिवाइस के वांछित समारोह (आंकड़े 15-18) के लिए स्टेपल अनुकूल करने के लिए मैन्युअल रूप से संपादित. आंकड़े 23-24 लदान का वर्णन कैसे कर रहे हैं साइट और गेट किस्में जोड़ और संपादित कर रहे हैं. अंत में, चित्रा 27 यहाँ बनाया गया मॉडल का एक मंदिर छवि को दर्शाता है.

"/>
चित्रा 1. CaDNAno 2.0 द्वारा डिजाइन और Autodesk माया 2012 तक उत्पन्न समाप्त रोबोट का एक 3 डी मॉडल,.

चित्रा 2
चित्रा 2. CaDNAno 2.0/Autodesk माया 2012 डिजाइन इंटरफेस का एक दृश्य. शीर्ष पैनल: प्रारंभिक आकार की रूपरेखा के लिए जाली पैनल. नीचे पैनल: संपादन पैनल. राइट पैनल:. 3 डी मॉडल जनरेटर (अनुभाग 2.1 देखें) बड़ा आंकड़ा देखने के लिए यहां क्लिक करें .

चित्रा 3
चित्रा 3. शीर्ष देहात पर आकार की धारा आरेखणनेल (अनुभाग 2.3 देखें).

चित्रा 4
चित्रा 4. CaDNAno 2.0 के नीचे (संपादन) पैनल. साथ ग्रिड संपादन कार्रवाई घटित होगा जहां नारंगी ऊर्ध्वाधर बार निर्धारित करता है. ऊपर दाहिने तरफ ग्रे तीर (अनुभाग 2.4 देखें) दोनों ओर के लिए ग्रिड का विस्तार करने के लिए उपयोग किया जाता है.

चित्रा 5
चित्रा 5. शीर्ष पैनल में प्रारंभिक रूपरेखा (2.5 अनुभाग देखें) के बाद पाड़ कतरा का एक मसौदा तैयार किया. बड़ा आंकड़ा देखने के लिए यहां क्लिक करें .

ogether.within पृष्ठ = "हमेशा"> चित्रा 6
चित्रा 6. सभी पाड़ किनारा मार्ग के किनारों का चयन करना और (अनुभाग 2.7 देखें) वांछित लंबाई के मार्ग का विस्तार.

7 चित्रा
चित्रा 7. संपादन कार्रवाई के साथ वास्तविक समय में कैसे 3 डी मॉडल परिवर्तन का प्रदर्शन नीचे और सही पैनल के एक आम दृश्य. बड़ा आंकड़ा देखने के लिए यहां क्लिक करें .

8/50268fig8highres.jpg "/>
चित्रा 8. हेलिक्स के बीच नीले पुल चिह्न (लाल चिह्न के प्रधान क्रॉसओवर का उल्लेख है और अभी तक नहीं दिखाए जाते हैं, अनुभाग 2.9 देखें) पाड़ क्रॉसओवर अनुमति दी जाती है जहां पदों निरूपित.

9 चित्रा
चित्रा 9. नया चबूतरा का निर्माण (खंड 2.10 देखें) चुनाव के पुल माउस क्लिक करके crossovers.

चित्रा 10
चित्रा 10. हेलिक्स 29 और 30 (अनुभाग 3.2 देखें) के बीच एक धुरी (एक विदेशी ग्रिड के बाईं ओर करने के लिए संभव के रूप में एक बंद) बनाना.


चित्रा 11. (अनुभाग 4.1 देखें) लोड हो रहा है साइटों की शाखाओं में बंटी है कि गाइड हेलिक्स जोड़ना.

चित्रा 12
12 चित्रा. "AutoStaple" कार्रवाई के बाद खाका. नीचे के पैनल और सही पैनल में प्रधान रंग संगत कर रहे हैं (खंड 5.1 देखें). बड़ा आंकड़ा देखने के लिए यहां क्लिक करें .

चित्रा 13
13 चित्रा. "AutoBreak" संवाद बॉक्स में जो उपयोगकर्ता (अनुभाग 5.2 देखें) AutoBreak मानकों को परिभाषित कर सकते हैं.

चित्रा 14
चित्रा 14. "AutoBreak" कार्रवाई के बाद खाका (अनुभाग 5.2 देखें). बड़ा आंकड़ा देखने के लिए यहां क्लिक करें .

चित्रा 15
चित्रा 15 स्टेपल मैं के मैनुअल संपादन:. हेलिक्स 29 और 30 से पार करने और नष्ट कर दिया जाना चाहिए कि स्टेपल लगाने.

5in "के लिए: src =" / files/ftp_upload/50268/50268fig16highres.jpg "/>
चित्रा 16 स्टेपल द्वितीय के मैनुअल संपादन:. स्थित स्टेपल के बीच पुल को हटाने.

चित्रा 17
चित्रा 17 स्टेपल III के मैनुअल संपादन:. खंडित स्टेपल साथ सीम खरोंच (अनुभाग 5.5 देखें).

चित्रा 18
चित्रा 18. हेलिक्स 29-30 कोई क्रॉसओवर दिखा बीच पूरे अंतराल (अनुभाग 5.5 देखें) दो लिंक. बड़ा आंकड़ा देखने के लिए यहां क्लिक करें .

= "Jove_content" के लिए: रखने together.within पृष्ठ = "हमेशा"> चित्रा 19
चित्रा 19. मोटी रेखा (वे भी लंबे समय या परिपत्र, या तो बहुत कम हैं denoting, अनुभाग 5.6 देखें) में तैयार स्टेपल के मैनुअल संपादन.

चित्रा 20
चित्रा 20. साइट शाखाओं में बंटी (अनुभाग 6.1 देखें) लोड करने के लिए गाइड हेलिक्स जोड़ना. बड़ा आंकड़ा देखने के लिए यहां क्लिक करें .

1highres.jpg "/>
चित्रा 21. गाइड हेलिक्स को प्रधान किस्में के मैनुअल इसके अलावा, ताकि शाखाओं अंक (अनुभाग 6.2 देखें) स्थित किया जा सकता है. बड़ा आंकड़ा देखने के लिए यहां क्लिक करें .

चित्रा 22
चित्रा 22. (चेसिस स्टेपल की न्यूनतम संपादन की आवश्यकता है कि एक, खंड 6.5 देखें) एक सुविधाजनक स्थान में रोबोट चेसिस पाड़ को एक लोडिंग साइट विदेशी परिचय.

चित्रा 23
वें के रूप में देखा चित्रा 23. लदान साइट स्टेपल के देखें(खंड 6.9 देखें) जरूरी नहीं रह रहे हैं जो गाइड हेलिक्स, हटाने के बाद ई नीचे पैनल.

चित्रा 24
चित्रा 24. हेलिक्स 29 और 30 से, गेट किस्में के रूप में इस्तेमाल किया जा करने के लिए जा रहे हैं जो दो स्टेपल विस्तार. दो किस्में गेट द्वैध (अनुभाग 7.4 देखें) के गठन के लिए अनिवार्य है जो विपरीत दिशाओं का सामना ध्यान दें. बड़ा आंकड़ा देखने के लिए यहां क्लिक करें .

चित्रा 25
चित्रा 25. पाड़ अनुक्रम अलावा ("Seq" टूल) संवादपूर्व निर्धारित scaffolds के एक या तो चुनने के लिए, या (खंड 8.1 देखें) एक कस्टम अनुक्रम डालने के लिए अनुमति बॉक्स,.

चित्रा 26
डिजाइन के Cando विश्लेषण का आंकड़ा 26. परिणाम यहाँ वर्णित है. अनुकरण अनुरोध जानकारी प्रदान करने वाले विभिन्न फ़ाइलों से युक्त. ज़िप संग्रह उत्पन्न करता है. यहाँ RMSF (रूट वर्ग अस्थिरता मतलब) फ़ाइलें (. Png) रंग "HeatMap4RMSF.txt" नाम के साथ फ़ाइल में विस्तृत कुंजी के अनुसार, 3 दृश्य कोण से डिजाइन की एक मॉडल दिखा, चित्रित कर रहे हैं. इस मामले में, कम से कम RMSF (bluest) 1.03 एनएम है, और 95% RMSF (redest) 3.19 एनएम है. मॉडल भर में रंग की ढाल 'सामने, जिससे रोबोट के polarity (' सामने 'में फाटक,' वापस 'में अक्ष) और हेलिक्स 29-30 और 61-0 के साथ नहीं जोड़ने के स्टेपल कर रहे हैं कि इस तथ्य से निकला 'वापस' की ओर से भी अधिक उतार चढ़ाव के लिए 'पक्ष.

चित्रा 27
चित्रा 27. इस लेख में बनाया गया रोबोट का मंदिर छवि. नमूना तैयार करने और धुंधला हो जाना बिल्कुल के रूप में कहीं 21 में वर्णित किया गया.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

डीएनए origami हमें nanoscale पर मनमाना सुविधाओं के साथ सही ढंग से परिभाषित वस्तुओं के निर्माण के लिए सक्षम बनाता है. एक महत्वपूर्ण अगले कदम इन डिजाइनों में समारोह का एकीकरण किया जाएगा. कई अनुप्रयोगों और चुनौतियों इस तकनीक के साथ संबोधित किया जा सकता है, जबकि इन डीएनए की एक प्राकृतिक वातावरण का प्रतिनिधित्व के रूप में, डीएनए origami से चिकित्सकीय और वैज्ञानिक रोबोट fabricating में एक विशेष रुचि है, वहाँ है. डीएनए पहले से ही एक आनुवंशिक जानकारी भंडारण माध्यम के रूप में कोशिकाओं में आणविक मशीनरी के साथ इंटरफेस. दिलचस्प है, एक nanorobot या किसी अन्य मशीन में जोड़ डीएनए अभी भी outputs के एक दृश्य के हिस्से के रूप में, nanorobot के विखंडित बाद एक वांछित प्रोटीन की अभिव्यक्ति के लिए relayed जा सकता है जो एक निर्माण सामग्री, होने के अलावा आनुवंशिक जानकारी के रूप में काम कर सकते हैं.

इस पत्र में चर्चा उदाहरण में, हम रोबोट संचालित करने के लिए एक प्रतिबंध एंजाइम का उपयोग करें. डीएनए रोबोट जिम्मेदारी सकता है जिसके द्वारा हालांकि, अतिरिक्त तंत्रजानकारी के लिए घ निम्नलिखित शामिल हैं.

आण्विक मान्यता: हम हाल ही लक्ष्य कोशिकाओं 20 पर सतह पर प्रोटीन अणुओं की पहचान डीएनए कि रोबोट के लिए भी aptamer आधारित द्वार प्रदर्शन किया. Aptamers कंपनियों से आउटसोर्स, या aptamer डेटाबेस (से इस्तेमाल ऐसी SELEX के रूप में 23 तरीकों का उपयोग इन विट्रो में चुना जा सकता है http://aptamer.icmb.utexas.edu/ ). Aptamers कार्यरत रहे हैं, यह एक साथ गेट रूपों जो aptamer, के लिए पूरक किनारा, aptamer के ligand और पूरक किनारा के विस्थापन के बंधन की सुविधा होगी जो बेमेल, शामिल करने के लिए तैयार किया जा सकता है पर विचार करने के लिए महत्वपूर्ण है. अनुमति देने के तंत्र यह अज्ञात है, एक aptamer आधारित गेट की संवेदनशीलता और विशिष्टता या तो एक बहुत कड़े लेकिन अक्षम गेट, या एक तेजी से प्राप्त करने के लिए, दो किस्में के बीच बेमेल का% बढ़ाने या कम से देखते जा सकता हैलेकिन टपकाया गयी.

Enzymatic दरार: इस के लिए, फाटकों वे उस एंजाइम की सब्सट्रेट होते हैं कि इस तरह डिजाइन किया जाना चाहिए. उदाहरण के लिए, एक प्रोटीज के एक छोटे पेप्टाइड सब्सट्रेट दोनों पक्षों से रोबोट एंजाइम के अभाव में बंद रखेंगे जो फाटक, के लिए सीमित किया जा सकता है.

रिमोट कंट्रोल: डीएनए मशीनों को लागू नहीं किया गया है कि एक संभावित दृष्टिकोण dsDNA पिघलने 24 प्रेरित करने के लिए एक उच्च आवृत्ति विद्युत चुम्बकीय क्षेत्र में एक सोने nanocrystal एंटीना का उपयोग कर रहा है. यह जैव उत्तरदायी लोगों के अलावा एक उपयोगकर्ता के संचालित स्विच प्रदान कर सकता है. डीएनए origami रोबोट डिजाइन और बनाने के लिए अपेक्षाकृत सरल हैं, वे एक चिकित्सकीय मंच के रूप में कई तकनीकी चुनौतियों मुद्रा. यह न्युक्लिअसिज़ द्वारा दरार को अत्यधिक संवेदनशील है के रूप में डीएनए दवा वितरण के लिए एक आदर्श सामग्री नहीं है. इसके अलावा, यह एक प्रतिरक्षा प्रतिक्रिया तेज़ हो सकती है. एक जीव में डीएनए origami वस्तुओं के व्यवहार का गहन अध्ययन n हैअपने भाग्य को परिभाषित और वे ऊतकों में कुल नहीं करते या मेजबान जीनोम में एकीकृत सुनिश्चित करने के लिए eeded.

संक्षेप में, हम caDNAno, डिजाइन डीएनए origami आकार के लिए एक सरल, मजबूत सीएडी उपकरण के उपयोग को प्रस्तुत किया. हम इस तरह के चिकित्सा विज्ञान, ऊर्जा, metamaterials है, और शिक्षा जैसे क्षेत्रों में, डीएनए origami में आवेदन संचालित अनुसंधान देखने के शुरू करने की उम्मीद है. इन सभी स्थानों में, caDNAno समाधान को साकार करने पर एक महत्वपूर्ण प्रभाव हो जाने की उम्मीद है. भविष्य में, यह है कि वे सभी संगत कर रहे हैं क्योंकि किसी भी उपयोगकर्ता द्वारा (या कर सकते हैं जो भागों) प्रतिस्थापित किया जा सकता है जो एक औद्योगिक और डिजाइन मानक, हो सकता है.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgments

लेखकों अत्यंत मूल्यवान विचार विमर्श और सलाह है, और उपयोगी विचार विमर्श और काम के लिए Bachelet प्रयोगशाला के सभी सदस्यों के लिए एस डगलस धन्यवाद देता हूँ. इस काम के बार इलान विश्वविद्यालय में नैनो और उन्नत सामग्री की लाइफ साइंसेज और संस्थान के संकाय से अनुदान द्वारा समर्थित है.

Materials

Name Company Catalog Number Comments
Autodesk Maya 2012 Autodesk A student/academic account needs to be created first (see platform-specific instructions in http://cadnano.org)
caDNAno 2.0 (software) (Open source) Software for the design of DNA origami structures http://cadnano.org
Cando (webpage) (Open source) Webpage running a simulator of DNA origami shapes http://cando-dna-origami.org

DOWNLOAD MATERIALS LIST

References

  1. Watson, J. D., Crick, F. H. Genetical implications of the structure of deoxyribonucleic acid. Nature. 171, 964-967 (1953).
  2. Adleman, L. M. Molecular computation of solutions to combinatorial problems. Science. 266, 1021-1024 (1994).
  3. Qian, L., Winfree, E., Bruck, J. Neural network computation with DNA strand displacement cascades. Nature. 475, 368-372 (2011).
  4. Ellington, A. D., Szostak, J. W. In vitro selection of RNA molecules that bind specific ligands. Nature. 346, 818-822 (1990).
  5. Tang, Z., Parekh, P., Turner, P., Moyer, R. W., Tan, W. Generating aptamers for recognition of virus-infected cells. Clin. Chem. 55, 813-822 (2009).
  6. Baskerville, S., Bartel, D. P. A ribozyme that ligates RNA to protein. Proc. Natl. Acad. Sci. U.S.A. 99, 9154-9159 (2002).
  7. Bartel, D. P., Szostak, J. W. Isolation of new ribozymes from a large pool of random sequences [see comment]. Science. 261, 1411-1418 (1993).
  8. Benenson, Y., Gil, B., Ben-Dor, U., Adar, R., Shapiro, E. An autonomous molecular computer for logical control of gene expression. Nature. 429, 423-429 (2004).
  9. Xie, Z., Wroblewska, L., Prochazka, L., Weiss, R., Benenson, Y. Multi-input RNAi-based logic circuit for identification of specific cancer cells. Science. 333, 1307-1311 (2011).
  10. Rothemund, P. W., Papadakis, N., Winfree, E. Algorithmic self-assembly of DNA Sierpinski triangles. PLoS Biol. 2, e424 (2004).
  11. Chen, J. H., Seeman, N. C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 350, 631-633 (1991).
  12. He, Y., et al. Hierarchical self-assembly of DNA into symmetric supramolecular polyhedra. Nature. 452, 198-201 (2008).
  13. Seeman, N. C. Nucleic acid junctions and lattices. J. Theor. Biol. 99, 237-247 (1982).
  14. Wei, B., Dai, M., Yin, P. Complex shapes self-assembled from single-stranded DNA tiles. Nature. 485, 623-626 (2012).
  15. Yin, P., et al. Programming DNA tube circumferences. Science. 321, 824-826 (2008).
  16. Rothemund, P. W. Folding DNA to create nanoscale shapes and patterns. Nature. 440, 297-302 (2006).
  17. Dietz, H., Douglas, S. M., Shih, W. M. Folding DNA into twisted and curved nanoscale shapes. Science. 325, 725-730 (2009).
  18. Douglas, S. M., et al. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature. 459, 414-418 (2009).
  19. Douglas, S. M., et al. Rapid prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, 5001-5006 (2009).
  20. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science. 335, 831-834 (2012).
  21. Castro, C. E., et al. A primer to scaffolded DNA origami. Nature Methods. 8, 221-229 (1038).
  22. Ke, Y., et al. Multilayer DNA origami packed on a square lattice. Journal of the American Chemical Society. 131, 15903-15908 (2009).
  23. Mallikaratchy, P. Using aptamers evolved from cell-SELEX to engineer a molecular delivery platform. Chem. Commun. (Camb). 3056-3058 (2009).
  24. Hamad-Schifferli, K., Schwartz, J. J., Santos, A. T., Zhang, S., Jacobson, J. M. Remote electronic control of DNA hybridization through inductive coupling to an attached metal nanocrystal antenna. Nature. 415, 152-155 (2002).

Comments

2 Comments

  1. am a member of jove, so please allow me to watch this article(designing of bio-responsive robot from DNA origami)

    Reply
    Posted by: sushma m.
    January 13, 2014 - 1:10 AM
  2. Where can we find the .json Cadnano file for this robot?

    Reply
    Posted by: sam b.
    March 25, 2015 - 5:28 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics