Name: A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters (Video) | JoVE Journal
Uploaded: 2019-06-13T13:30:00.000+00:00
Duration: 12 min 14 s
Description: Learn a converging strategy to generate a virtually sequenced cDNA library from unreferenced Pacific oysters using RNA from local food markets. This cost-effective method enables gene cloning without conventional sequencing.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This work was supported in part by the Natural Science Foundation of China (grant numbers 31471703, A0201300537 and 31671854 to J.V. and L.L., grant number 31470435 to G.Y.), and the 100 Foreign Talents Plan (grant number JSB2014012 to J.V.).

NOTE: A schematic overview is shown in Figure 1.
1. Sample collection
<ol>
	<li>Obtain oyster specimens. Keep oysters on ice during the postharvest period, the transport and prior to laboratory use and process within 4-7 days after purchase. 
	NOTE: For this protocol, oysters were purchased from Zhong Cai Wholesale Market in Nanjing (originating from Ningde, Fujian, China and Lianyungang, Jiangsu, China), Haijie Aquatic Product Company in Qingdao (originating from Qingdao, Shandong, China), Jucheng Aquatic Product Company in Yantai (originating from Yantai, Shandong, China) and Jinxiu Aquatic Product Company in Qingdao (originating from Qingdao, Shandong, China)).</li>
</ol>
2. RNA isolation by guanidinium thiocyanate-phenol extraction
<ol>
	<li>Preparation of oyster tissue sample
	<ol>
		<li>Cut out approximately 100 mg of homogeneous soft tissue from the approximate geometric center of each oyster specimen with a sterilized scalpel, and transfer the samples into liquid nitrogen.</li>
		<li>Euthanize the remaining part of the oysters by freezing at -80 &#176;C for 1 h and discard as biological waste.</li>
		<li>Grind the flash-frozen oyster tissue into a fine powder in a mortar (200 mL) filled with 50 mL of liquid nitrogen.</li>
		<li>Weigh out 75 mg of each specimen&#8217;s frozen tissue into a sterile 1.5 mL centrifuge tube and mix with 1 mL of the guanidinium thiocyanate-phenol extraction reagent. Centrifuge the sample at 14,000 x g at 4 &#176;C for 15 min.</li>
	</ol>
	</li>
	<li>Transfer the supernatant to a new 1.5 mL centrifuge tube, add 200 &#181;L of chloroform and mix thoroughly by using a vortex mixer for 10-15 s until the mixture turns milky-white.</li>
	<li>Centrifuge at 14,000 x g at 4 &#176;C for 15 min, and transfer the upper aqueous layer carefully with a 200 &#181;L pipette without disturbing the interphase into a new 1.5 mL centrifuge tube.</li>
	<li>Add 500 &#181;L of isopropyl alcohol and mix the samples gently by inversion, then leave the samples for 20 min on ice. Centrifuge at 14,000 x g at 4 &#176;C for 8 min and remove the supernatant.</li>
	<li>Resuspend each of the pellets in 1 mL of 75% EtOH, and centrifuge at 14,000 x g at 4 &#176;C for 5 min. Remove all of the supernatant.</li>
	<li>Repeat step 2.5 once. Dry the pellets for 6 min at room temperature. Do not dry for longer; otherwise, it may be difficult to dissolve the RNA pellet in the next step.</li>
	<li>Dissolve the dried RNA pellet in 25 &#181;L of DEPC (diethylpyrocarbonate)-treated water and keep the tube on ice. Use RNA samples within 24 h.</li>
</ol>
3. cDNA library generation by reverse transcription
<ol>
	<li>For each RNA sample, prepare a reaction mixture using the a commercial reverse transcription system using a 10 &#181;L pipette: Add 4 &#181;L of MgCl2 solution, 2 &#181;L of 10x Reaction Buffer, 2 &#181;L of dNTP solution, 0.5 &#181;L of RNase inhibitor, 0.7 &#181;L of AMV Reverse Transcriptase, 0.5 &#181;L of Oligo(dT) 15 primer, 1 &#181;L of the extracted RNA sample and 9.3 &#181;L of H2O into a 300 &#181;L PCR tube.</li>
	<li>Incubate mixture in a PCR Thermocycler for 60 min at 42 &#176;C, and then increase the temperature to 95 &#176;C for 5 min.</li>
	<li>Store the generated cDNA library for up to 12 months at -20 &#176;C.</li>
</ol>
4. Mitochondrial gene amplification and purification
<ol>
	<li>Prepare PCR mixture using a 10 &#181;L pipette. Add 0.25 &#181;L (1.25 U) of high-fidelity DNA polymerase, 2 &#181;L of dNTP solution (2.5 mM of each dNTP), 0.5 &#181;L of the COX1 or ND forward primer (100 &#181;M), 0.5 &#181;L of the corresponding COX1 or ND reverse primer (100 &#181;M), 1 &#181;L of the cDNA library, 5 &#181;L of 5x buffer solution and 16 &#181;L of distilled H2O into a 300 &#181;L PCR tube.</li>
	<li>Perform the PCR amplification using the following parameters: After an initial denaturation step at 95 &#176;C (duration 5 min), 35 PCR reaction cycles consisting of an annealing step at 55 &#176;C (30 s), elongation step at 72 &#176;C (2 min), and denaturation step at 95 &#176;C (30 s), perform one finalizing elongation step for 5 min at 72 &#176;C.</li>
	<li>Use 5 &#181;L of the PCR product to verify by agarose gel electrophoresis the quality of the obtained PCR product. Observe the amplified COX1 or ND gene as a single band at either 759 or 748 base pairs, respectively.</li>
	<li>Purify the rest of the PCR product with a PCR clean-up kit.
	<ol>
		<li>Add 100 &#181;L of solution &#39;PCR-A&#39;&#160;(DNA binding buffer which contains high concentrations of chaotropic salts11) to the sample. Vortex briefly to mix the contents.</li>
		<li>Place the purification column into a 2 mL centrifuge tube. Pipette the reaction mixture of 4.4.1. into the column. Centrifuge at 14,000 x g for 1 min at room temperature.</li>
		<li>Discard the filtrate from the centrifuge tube. Return the column to the 2 mL centrifuge tube, add 700 &#181;L of solution &#39;W2&#39;&#160;into the column and centrifuge at 14,000 x g for 1 min at room temperature (&#39;W2&#39;&#160;is a washing solution which contains high concentrations of ethanol for the removal of residual chaotropic salts from the purification column).</li>
		<li>Discard the filtrate and return the column to the 2 mL centrifuge tube. Add 400 &#181;L of solution &#39;W2&#39;&#160;to the column and centrifuge at 14,000 x g for 1 min at room temperature.</li>
		<li>Pre-heat 1 mL of deionized water to 65 &#176;C in a metal block heater. Transfer the column into a new 1.5 mL centrifuge tube. Pipette 25 &#181;L of the 65 &#176;C hot pre-heated deionized water to the center of the white column membrane. Let the membrane soak for 1 min at room temperature.</li>
		<li>Centrifuge at 14,000 x g for 1 min at room temperature and discard the column.</li>
	</ol>
	</li>
	<li>Store the purified PCR product for up to 12 months at -20 &#176;C.</li>
</ol>
5. Mitochondrial gene sequencing and comparison
<ol>
	<li>Send the purified PCR samples from step 4.5 for Sanger sequencing using the relevant COX1 or ND forward primers as sequencing primers. Optionally, the COX1 or ND reverse primers can also be used for bidirectional sequencing.</li>
	<li>After retrieving the sequencing results, compare the sequences with the genome sequence of the Pacific oyster reference strain (NCBI Taxonomy ID: 29159) using the NCBI Nucleotide BLAST online tool (blast.ncbi.nlm.nih.gov) (Figure 2 and Figure 3).</li>
</ol>
6. Applying the cDNA library for cloning the genes MgUGD and MgUXS
<ol>
	<li>Amplify and purify the MgUGD and MgUXS genes using the respective forward and reverse primers of MgUGD and MgUXS by PCR following steps 4.1. to 4.4.</li>
	<li>Transfer 2 &#181;L of digestion buffer (10x concentrated) and 6 &#181;L of deionized water into a 1.5 mL centrifuge tube. Add 10 &#181;L of the purified MgUGD or MgUXS PCR products together with the restriction endonucleases Nde I and Xho I (1 &#181;L each, 20 U). Incubate at 37 &#176;C for 3 h.</li>
	<li>Prepare the predigested pET-30a vector: Transfer 500 ng of the pET-30a vector into a new 1.5 mL centrifuge tube and top up the volume to 16 &#181;L using deionized water. Add 2 &#181;L of digestion buffer (10x concentrated) together with the restriction endonucleases Nde I and Xho I (1 &#181;L each, 20 U).
	<ol>
		<li>After incubating the mixture at 37 &#176;C for 3 h, add 1 &#181;L of alkaline phosphatase (1 U) and incubate at 37 &#176;C for an additional hour. Inactivate the alkaline phosphatase by heating at 75 &#176;C for 10 min in a pre-heated metal block heater.</li>
	</ol>
	</li>
	<li>Transfer 4 &#181;L of the digested MgUGD or MgUXS DNA products into fresh 1.5 mL centrifuge tubes and add 4 &#181;L of the digested pET-30a vector. Add 1 &#181;L of Ligation Buffer (10x), 1 &#181;L of T4 ligase (3 U) and incubate the reaction mixture at 22 &#176;C for 3 h.</li>
	<li>Transform&#160; electrocompetent E. coli Mach1 Competent Cells by electroporation using the ligation products. Spread the transformed cells on LB agar plates containing 50 &#956;g/mL kanamycin. Incubate cells at 37 &#176;C for 16 h.</li>
	<li>Verify colonies for the desired insertion by Sanger sequencing using the plasmid-specific T7 promoter and terminator primers. Prepare plasmids from the validated bacterial clones.</li>
</ol>
7. Expression and activity tests of MgUGD and MgUXS
<ol>
	<li>Transform E. coli BL21 (DE3) Competent Cells &#160;with plasmids bearing the MgUGD and MgUXS genes and spread the transformed cells on LB agar plates containing 50 &#956;g/mL kanamycin. Incubate cells at 37 &#176;C for 16 h.</li>
	<li>Cultivate a single colony in 5 mL LB medium with 50 &#956;g/mL kanamycin overnight. Transfer the culture into 400 mL LB medium and continuously shake at 200 rpm at a temperature of 37 &#176;C until the optical density at a wavelength of 600 nm (OD600) reaches an absorption of approximately 0.5.
	<ol>
		<li>Reduce the incubation temperature to 20 &#176;C and add 400 &#181;L of isopropyl &#946;-D-thiogalactopyranoside (concentration 1 M). Induce the expression of the recombinant proteins for 3 h.</li>
	</ol>
	</li>
	<li>Harvest cells by centrifugation at 4,500 x g for 15 min at 4 &#176;C. Suspend pellets in 10 mL of lysis buffer (100 mM NaCl, 50 mM Tris/HCl, 1% Triton X-100, 1 mM phenylmethylsulfonyl- fluoride (PMSF), pH 8.0).</li>
	<li>Disrupt cells by sonication for 20 min (40 on/off cycles with 20 &#956;m amplitude for 15 s at 4 &#176;C). Centrifuge at 14,000 x g at 4&#176;C for 20 min and collect the supernatant for the activity test.</li>
	<li>Perform the activity assay of MgUGD by incubating 2 &#181;L of the cell lysate with 2 &#181;L of UDP-glucose (10 mM), 4 &#181;L of NAD+ (10mM), 4 &#181;L of MgCl2 (10 mM), 2 &#181;L of Tris/HCl buffer (500 mM, pH 7.5), and 6 &#181;L of deionized H2O in a new 1.5 mL centrifuge tube and incubate at 37 &#176;C for 30 min.</li>
	<li>Perform the activity assay of MgUXS by incubating 2 &#181;L of the cell lysate with 2 &#181;L of UDP-glucuronic acid (10 mM), 2 &#181;L of Tris/HCl buffer (500 mM, pH 7.5), and 14 &#181;L of deionized H2O in a new 1.5 mL centrifuge tube and incubate at 37 &#176;C for 30 min.</li>
	<li>Quench the reactions in step 7.5 and 7.6 by adding 20 &#956;L of methanol and 40 &#956;L of chloroform to each mixture. After vortexing the sample mixtures, centrifuge at 14,000 x g for 6 min at 4 &#176;C and collect the upper aqueous layer of each tube.</li>
	<li>Analyze the reaction products using MALDI-TOF mass spectrometry in negative ionization mode in the m/z range from 500-700. Mix 1 &#956;L of sample mixture with 1 &#956;L of 2,5-dihydroxybenzoic acid sample matrix (1% w/V in 50% aqueous acetonitrile). Observe the expected m/z values at 579 and 535 for UDP-glucuronic acid and UDP-xylose, respectively (Figure 4).</li>
</ol>

<ol><li>Blaxter, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+promise+of+a+DNA+taxonomy%5BTitle%5D)+AND+%22Philosophical+transactions+of+the+Royal+Society+of+London.+Series+B%2C+Biological%22%5BJournal%5D)">The promise of a DNA taxonomy.</a> Philosophical transactions of the Royal Society of London. Series B, Biological. 359 (1444), 669-679 (2004).</li>
<li>Wen, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Species+identification+of+dried+shellfish+%28oyster%2C+clam+and+mussel%29+products+sold+on+the+Chinese+market%5BTitle%5D)+AND+%22Food+Control%22%5BJournal%5D)">Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market.</a> Food Control. 90, 199-204 (2018).</li>
<li>Zhang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mitochondrial+cob+and+cox1+genes+and+editing+of+the+corresponding+mRNAs+in+Dinophysis+acuminata+from+Narragansett+Bay%2C+with+special+reference+to+the+phylogenetic+position+of+the+genus+Dinophysis%5BTitle%5D)+AND+%22Applied+and+Environmental+Microbiology%22%5BJournal%5D)">Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis.</a> Applied and Environmental Microbiology. 74 (5), 1546-1554 (2007).</li>
<li>Sell, J., Spirkovski, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mitochondrial+DNA+differentiation+between+two+forms+of+trout+Salmo+letnica%2C+endemic+to+the+Balkan+Lake+Ohrid%2C+reflects+their+reproductive+isolation%5BTitle%5D)+AND+%22Molecular+Ecology%22%5BJournal%5D)">Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation.</a> Molecular Ecology. 13, 3633-3644 (2004).</li>
<li>Karadjian, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Highly+rearranged+mitochondrial+genome+in+Nycteria+parasites+%28Haemosporidia%29+from+bats%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (35), 9834-9839 (2018).</li>
<li>Morga, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+of+genes+from+flat+oyster+Ostrea+edulis+as+suitable+housekeeping+genes+for+quantitative+real+time+PCR%5BTitle%5D)+AND+%22Fish+and+Shellfish+Immunology%22%5BJournal%5D)">Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR.</a> Fish and Shellfish Immunology. 29 (6), 937-945 (2010).</li>
<li>Delsuc, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular+systematics+of+armadillos+%28Xenarthra%2C+Dasypodidae%29%3A+contribution+of+maximum+likelihood+and+Bayesian+analyses+of+mitochondrial+and+nuclear+genes%5BTitle%5D)+AND+%22Molecular+Phylogenetics+and+Evolution%22%5BJournal%5D)">Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes.</a> Molecular Phylogenetics and Evolution. 28 (2), 261-265 (2005).</li>
<li>Wei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Discovery+and+Biochemical+Characterization+of+UDP-Glucose+Dehydrogenase+from+Akkermansia+muciniphila%5BTitle%5D)+AND+%22Protein+%26+Peptide+Letters%22%5BJournal%5D)">Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila.</a> Protein & Peptide Letters. 24 (8), 735-741 (2017).</li>
<li>Gu, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Discovery+and+Biochemical+Characterization+of+the+UDP-Xylose+Biosynthesis+Pathway+in+Sphaerobacter+thermophilus%5BTitle%5D)+AND+%22Protein+%26+Peptide+Letters%22%5BJournal%5D)">Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus.</a> Protein & Peptide Letters. 23 (12), 1103-1110 (2016).</li>
<li>Duan, X. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Functional+characterization+of+the+UDP-xylose+biosynthesis+pathway+in+Rhodothermus+marinus%5BTitle%5D)+AND+%22Applied+Microbiology+and+Biotechnology%22%5BJournal%5D)">Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus.</a> Applied Microbiology and Biotechnology. 99 (22), 9463-9472 (2015).</li>
<li>Vogelstein, B., Gillespie, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Preparative+and+analytical+purification+of+DNA+from+agarose%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Preparative and analytical purification of DNA from agarose.</a> Proceedings of the National Academy of Sciences of the United States of America. 76 (2), 615-619 (1979).</li>
<li>Song, H. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((UDP-glucose+4-epimerase+and+%CE%B2-1%2C4-galactosyltransferase+from+the+oyster+Magallana+gigas+as+valuable+biocatalysts+for+the+production+of+galactosylated+products%5BTitle%5D)+AND+%22International+Journal+of+Molecular+Sciences%22%5BJournal%5D)">UDP-glucose 4-epimerase and β-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products.</a> International Journal of Molecular Sciences. 19 (6), 1600(2018).</li>
<li>Gainey, P. A., Phelps, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Uridine+diphosphate+glucuronic+acid+production+and+utilization+in+various+tissues+actively+synthesizing+glycosaminoglycans%5BTitle%5D)+AND+%22Biochemical+Journal%22%5BJournal%5D)">Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans.</a> Biochemical Journal. 128 (2), 215-227 (1972).</li>
</ol>

The authors have nothing to disclose.

The presented protocol allows the genetic identification of unreferenced oyster specimens with similar phenotype from regional seafood markets by comparison of the COX1 and ND genes with a publicly available oyster DNA genome database. The significance of this method lies in its simplicity, as only a single PCR reaction is needed for the evaluation of the virtual cDNA library. The two conserved mitochondrial COX1 and ND genes were amplified from a cDNA library which was generated by reverse transcription of RNA extracts ...

The acquisition of living referenced biological material may be challenging due to long delivery times, entrepreneurial reasoning, or country-specific customs regulations. As an alternative, the required biological material may be also collected from phenotypically identical specimens. However, these samples may vary significantly at the level of genotype, and therefore comparisons with digitally-stored reference genomes of the same species are often rendered difficult or even futile due to incompatibility of the newly-sourced material with existing DNA amplification methods. Sequencing highly conserved genes of individual samples is a widely used and powerful tool for identifying species1, such as conserved mitochondrial genes that are frequently used as reference genes for the quality assessment of cDNA libraries2,3,4,5,6. The underlying rationale for the herein presented method is that high conservation of mitochondrial gene sequences in individual anonymous oyster samples compared to the corresponding sequences of the reference genome indicates that other genes may also show a low level of divergence, given the generally faster rate of mitochondrial DNA evolution relative to nuclear DNA7, allowing the amplification and isolation of a wide range of scientifically and industrially relevant genes by simply using publicly available sequencing data as a reference.
The overall goal of the herein described method is to present an optimized workflow for generating a virtually sequenced oyster cDNA library which can be used as template DNA for the cloning of oyster genes. In virtual sequencing, de novo genome sequencing is circumvented; instead, a known, digitally-stored reference sequence is used directly to utilize or design primers for production of cDNAs that will eventually comprise a library (or be added to a pre-existing one). The aim is to produce a convergent cDNA library, meaning that similarities between the generated cDNA sequences and the reference sequence can be ranked from low to high divergence. A key advantage of using Cytochrome C Oxidase subunit 1 (COX1) and NADH Dehydrogenase (ND) as reference genes is that even highly geographically disjunct oyster specimens can be profiled due to the high conservation of these mitochondrial genes. Having proven the approach with these well-established markers, we then demonstrate its application to two enzyme candidates which are involved in sugar nucleotide biosynthesis and may be of industrial relevance8,9,10. The biotechnological potential of the Pacific oyster is still unexplored. Thus, we believe that this converging method for preparing a virtually sequenced cDNA library will also be appropriate for non-specialist researchers who want to generate cDNA from this relevant biological material.

<table><tbody><tr><td>&lt;strong&gt;Chemicals:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>1% Triton X-100</td><td>Solarbio</td><td>9002-93-1</td><td>*Alternative distributors possible</td></tr><tr><td>2,5-Dihydroxybenzoic acid</td><td>Alfa Aesar</td><td>490-79-9</td><td>*Alternative distributors possible</td></tr><tr><td>Acetonitrile</td><td>Merck</td><td>75-05-8</td><td>*Alternative distributors possible</td></tr><tr><td>Agarose for molecular biology</td><td>Biowest Chemicals</td><td>111860</td><td>*Alternative distributors possible</td></tr><tr><td>Ampicilin</td><td>Solarbio</td><td>69-52-3</td><td>*Alternative distributors possible</td></tr><tr><td>Chloroform</td><td>Lingfeng, Shanghai</td><td>67-66-3</td><td>*Alternative distributors possible</td></tr><tr><td>DEPC water</td><td>Thermo Scientific</td><td>R0601</td><td></td></tr><tr><td>Ethanol</td><td>Jinhuada, Guangzhou</td><td>64-17-5</td><td>*Alternative distributors possible</td></tr><tr><td>Guanidinium thiocyanate-phenol reagent</td><td>Invitrogen</td><td>15596018</td><td>TRIzol reagent</td></tr><tr><td>Imidazole</td><td>Energy Chemical</td><td>288-32-4</td><td>*Alternative distributors possible</td></tr><tr><td>Isopropyl alcohol</td><td>Nanjing Chemical Reagent</td><td>67-63-0</td><td>*Alternative distributors possible</td></tr><tr><td>Isopropyl &amp;beta;-D-thiogalactopyranoside</td><td>Solarbio</td><td>367-93-1</td><td>*Alternative distributors possible</td></tr><tr><td>Kanamycin</td><td>Solarbio</td><td>25389-94-0</td><td>*Alternative distributors possible</td></tr><tr><td>LB Agar</td><td>Thermo Fisher</td><td>22700025</td><td>*Alternative distributors possible</td></tr><tr><td>LB Broth</td><td>Thermo Fisher</td><td>10855021</td><td>*Alternative distributors possible</td></tr><tr><td>Methanol</td><td>Jinhuada, Guangzhou</td><td>67-56-1</td><td>*Alternative distributors possible</td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt; hexahydrate</td><td>Xilong Huagong</td><td>7791-18-6</td><td>*Alternative distributors possible</td></tr><tr><td>NaCl</td><td>Xilong Huagong</td><td>7647-14-5</td><td>*Alternative distributors possible</td></tr><tr><td>NAD&lt;sup&gt;+&lt;/sup&gt;</td><td>Duly Biotech</td><td>53-84-9</td><td>*Alternative distributors possible</td></tr><tr><td>Phenyl-methylsulfonyl fluoride</td><td>Macklin</td><td>329-98-6</td><td>*Alternative distributors possible</td></tr><tr><td>Tris</td><td>Solarbio</td><td>77-86-1</td><td>*Alternative distributors possible</td></tr><tr><td>UDP-glucose</td><td>Wuhu Nuowei Chemicals</td><td>28053-08-9</td><td>*Alternative distributors possible</td></tr><tr><td>UDP-glucuronic acid</td><td>SIGMA</td><td>63700-19-6</td><td>*Alternative distributors possible</td></tr><tr><td>&lt;strong&gt;Tools/Instruments:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>MALDI-TOF mass spectrometer</td><td>Bruker</td><td>Autoflex</td><td>*Alternative distributors possible</td></tr><tr><td>Metal block heater</td><td>Long Yang Scientific Instruments</td><td>Thermoshaker HB20</td><td>*Alternative distributors possible</td></tr><tr><td>PCR thermocycler</td><td>Hema</td><td>9600</td><td>*Alternative distributors possible</td></tr><tr><td>&lt;strong&gt;Enzyme and Kits:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>10&amp;times;Ligation buffer</td><td>Thermo Scientific</td><td>B69</td><td>*Alternative distributors possible</td></tr><tr><td>5&amp;times;PrimeSTAR buffer</td><td>Takara</td><td>9158A</td><td></td></tr><tr><td>Alkaline phosphatase</td><td>ThermoFisher FastAP</td><td>EF0654</td><td>*Alternative distributors possible</td></tr><tr><td>COX forward primer</td><td>Genscript</td><td>ATGTCAACAAATCATTTAGACATTG</td><td></td></tr><tr><td>COX reverse primer</td><td>Genscript</td><td>ACTTGACCAAAAACATAAGACATG</td><td></td></tr><tr><td>Cutsmart Buffer</td><td>NEB</td><td>B7204S</td><td>*Alternative distributors possible</td></tr><tr><td>dNTP mix</td><td>Invitrogen</td><td>18427088</td><td></td></tr><tr><td>MgUGD forward primer</td><td>Genscript</td><td>ACATATGACCCTGTCCAAGATCTGTTGT</td><td></td></tr><tr><td>MgUGD reverse primer</td><td>Genscript</td><td>ACTCGAGACTCTGTGAGGCGGTGGAG</td><td></td></tr><tr><td>MgUXS forward primer</td><td>Genscript</td><td>CCATATGGCAGAATCCTCACAATCAC</td><td></td></tr><tr><td>MgUXS reverse primer</td><td>Genscript</td><td>ACTCGAGCACATTTTTGAATTTGCAGACGT</td><td></td></tr><tr><td>ND forward primer</td><td>Genscript</td><td>ATGAGATGGCAATTATTTTTTAAT</td><td></td></tr><tr><td>ND reverse primer</td><td>Genscript</td><td>ATGTATTTTGGAAAAATCTCCAC</td><td></td></tr><tr><td>PCR Cleanup Kit</td><td>AxyGen</td><td>AP-PCR-250</td><td>*Alternative distributors possible</td></tr><tr><td>pET-30a(+) vector</td><td>Merck Millipore</td><td>69909</td><td></td></tr></tbody></table>

a converging strategy for the generation of a virtually sequenced cdna library from unreferenced pacific oysters

A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters

The access to biological material of reference species, which were used previously in key experiments such as in the development of novel cell lines or genome sequencing projects, are often difficult to provide for further studies or third parties due to the consumptive nature of the samples. Although now widely distributed over the Pacific coasts of Asia, Australia and North America, individual Pacific oyster specimens are genetically quite diverse and are therefore not directly suitable as the starting material for gene libraries. In this article, we demonstrate the use of unreferenced Pacific oyster specimens obtained from regional seafood markets to generate cDNA libraries. These libraries were then compared to the publicly available oyster genome, and the closest related library was selected using the mitochondrial reference genes Cytochrome C Oxidase subunit I (COX1) and NADH Dehydrogenase (ND). The suitability of the generated cDNA library is also demonstrated by cloning and expression of two genes encoding the enzymes UDP-glucuronic acid dehydrogenase (UGD) and UDP-xylose synthase (UXS), which are responsible for the biosynthesis of UDP-xylose from UDP-glucose.

Figure 1 shows a schematic overview of the described preparation method of the convergent cDNA library derived from Pacific oyster individuals. Figure 2 shows the sequences of the COX1 and ND genes of a distantly related oyster specimen with high divergence from the COX1 and ND gene sequences of the reference material. Figure 3 shows the sequences of the COX1 and ND genes of a closely related oyster specimen with low divergence from...

We describe a strategy for how to use RNA samples from unreferenced Pacific oyster specimens, and evaluate the genetic material by comparison with publicly available genome data to generate a virtually sequenced cDNA library.

The access to biological material of reference species, which were used previously in key experiments such as in the development of novel cell lines or ...

a-converging-strategy-for-generation-virtually-sequenced-cdna-library

Research

JoVE Journal

Bioengineering

Construction of a fosmid library with environmental genomic DNA isolated from the vertical depth continuum of a seasonally hypoxic fjord is described. The resulting clone library is picked into 384-well plates and archived for downstream sequencing and functional screening by the application of an automated colony picking system.

Large Insert Environmental Genomic Library Production

Here we describe a method for preparation of both single read and paired end Illumina mRNA-Seq sequencing libraries for gene expression analysis based on T7 linear RNA amplification. This protocol requires only 10 nanograms of starting total RNA and generates highly consistent libraries representing whole transcripts.

Single Read and Paired End mRNA-Seq Illumina Libraries from 10 Nanograms Total RNA

We describe the preparation of barcoded DNA libraries and subsequent hybridization-based exon capture for detection of key cancer-associated mutations in clinical tumor specimens by massively parallel "next generation" sequencing. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus yielding high sensitivity for detecting low frequency mutations.

Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing

We describe a Xenopus oocyte and animal cap system for the expression cloning of genes capable of inducing a response in competent ectoderm, and discuss techniques for the subsequent analysis of such genes. This system is useful in the functional identification of a wide range of gene products.

Functional Cloning Using a Xenopus Oocyte Expression System

This protocol describes a method for mapping pre-mRNA 3' end processing sites.

3' End Sequencing Library Preparation with A-seq2

Methods for generating large-scale gRNA libraries should be simple, efficient and cost-effective. We describe a protocol for the production of gRNA libraries based on enzymatic digestion of target DNA. This method, CORALINA (comprehensive gRNA library generation through controlled nuclease activity) presents an alternative to costly custom oligonucleotide synthesis.

A Universal Protocol for Large-scale gRNA Library Production from any DNA Source

Contamination during the genomic sequencing of microscopic organisms remains a large problem. Here, we show a method to sequence the genome of a tardigrade from a single specimen with as little as 50 pg of genomic DNA without whole genome amplification to minimize the risk of contamination.

Ultralow Input Genome Sequencing Library Preparation from a Single Tardigrade Specimen

We present a simple suppressor screen protocol in fission yeast. This method is efficient, mutagen-free, and  selective  for  mutations that  often  occur at   a  single  genomic  locus.  The protocol is suitable for isolating suppressors that alleviate growth defects in liquid culture that are caused by a mutation or a drug.

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

We present a protocol for CRISPR-based modular assembly (CRISPRmass), a method for high-throughput construction of UAS-cDNA/ORF plasmid library in Drosophila using publicly available cDNA/ORF resources. CRISPRmass can be applied to editing various plasmid libraries.

CRISPR-Based Modular Assembly for High-Throughput Construction of a UAS-cDNA/ORF Plasmid Library

This article presents a protocol to perform comprehensive spatial transcriptomic profiling of host, viral, fungal, and microbiome RNA from formalin-fixed paraffin-embedded tissue sections using Stereo-seq, which enables high-resolution mapping of diverse transcriptomes while preserving tissue architecture.

Comprehensive Spatial Profiling of Species-agnostic Transcriptomes via Stereo-seq

Learn a converging strategy to generate a virtually sequenced cDNA library from unreferenced Pacific oysters using RNA from local food markets. This cost-effective method enables gene cloning without conventional sequencing.

A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters

Explore More Videos