The Journal of Visualized Experiments (JoVE) is a peer reviewed, PubMed-indexed video journal. Our mission is to increase the productivity of scientific research.
1School of Life Sciences, University of Warwick, 2Warwick Systems Biology, University of Warwick
Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).
After initiation of the leaf primordium, biomass accumulation is controlled mainly by cell proliferation and expansion in the leaves1. However, the Arabidopsis leaf is a complex organ made up of many different cell types and several structures. At the same time, the growing leaf contains cells at different stages of development, with the cells furthest from the petiole being the first to stop expanding and undergo senescence1. Different cells within the leaf are therefore dividing, elongating or differentiating; active, stressed or dead; and/or responding to stimuli in sub-sets of their cellular type at any one time. This makes genomic study of the leaf challenging: for example when analyzing expression data from whole leaves, signals from genetic networks operating in distinct cellular response zones or cell types will be confounded, resulting in an inaccurate profile being generated.
To address this, several methods have been described which enable studies of cell specific gene expression. These include laser-capture microdissection (LCM)2 or GFP expressing plants used for protoplast generation and subsequent fluorescence activated cell sorting (FACS)3,4, the recently described INTACT system for nuclear precipitation5 and immunoprecipitation of polysomes6.
FACS has been successfully used for a number of studies, including showing that the cell identity and distance from the root tip had a significant effect on the expression profiles of a large number of genes3,7. FACS of GFP lines have also been used to demonstrate cell-specific transcriptional regulation during root nitrogen responses and lateral root development8, salt stress9 auxin distribution in the root10 and to create a gene expression map of the Arabidopsis shoot apical meristem11. Although FACS has previously been used to sort Arabidopsis leaf derived protoplasts based on autofluorescence12,13, so far the use of FACS on Arabidopsis lines expressing GFP in the leaves has been very limited4. In the following protocol we describe a method for obtaining Arabidopsis leaf protoplasts that are compatible with FACS while minimizing the impact of the protoplast generation regime. We demonstrate the method using the KC464 Arabidopsis line, which express GFP in the adaxial epidermis14, the KC274 line, which express GFP in the vascular tissue14 and the TP382 Arabidopsis line, which express a double GFP construct linked to a nuclear localization signal in the guard cells (data not shown; Figure 2). We are currently using this method to study both cell-type specific expression during development and stress, as well as heterogeneous cell populations at various stages of senescence.
1. Protoplast Generation
2. FACS of Leaf Protoplasts
3. Representative Results
This protocol describes a method for obtaining protoplasts from Arabidopsis leaves, which are used for fluorescence activated cell sorting (Figure 1). Protoplast generation in the presence of RNase and transcriptional inhibitors prevents the cells from mounting a transcriptional response. This does have the consequence of giving rise to many dead and dying protoplasts, which have a significant level of autofluorescence. When sorting the protoplasts prepared with this method it is therefore very common to see several distinct populations in graphs of the 580 nm vs. 530 nm fluorescence used for the sorting. Examples of this, together with the sorting gates used in this protocol are shown in Figure 3.
Protoplasts can be sorted into 8 volumes of solution A and collected for visualization to verify the enrichment. Figure 2G shows an example of this using the TP382 line, which expresses GFP in the guard cells.
Examples of yields obtained using this method, both before and after amplification, are shown in Table 1. The amounts obtained are sufficient for amplification using the Ovation Pico WTA System (500 pg-50 ng) and therefore subsequent analysis by either qPCR (Figure 4), next generation sequencing or microarray.

Figure 1. Overall workflow for the experiment. 1) Harvest leaves of interest from a GFP expressing Arabidopsis line. 2) Quickly cut into ~1 mm wide strips and immediately transfer these into protoplasting solution and vacuum infiltrate. 3) Incubate for 3-4 hr. 4) Gently filtrate protoplast solution through a 70 μm sieve, transfer to round bottom tubes and pellet protoplasts by centrifugation. 5) Immediately before sorting, resuspend protoplasts and transfer to a sorting tube through a 50 μm filter. 6) Sort GFP positive and GFP negative viable protoplasts. 7) Protoplasts can now be analyzed either visually or using techniques such as qPCR, next generation sequencing or microarray.

Figure 2. The KC464, KC274 and TP382 lines used in this study. A) Transverse section of a KC464 leaf showing GFP expression in the adaxial epidermis. B) Protoplasts derived from KC464 leaves. C) Transverse section of a KC274 leaf showing GFP expression in the vasculature. D) Protoplasts derived from KC274 leaves. E) TP382 leaf showing GFP expression in the guard cells. F) Protoplasts derived from TP382 leaves. G) Example of the enrichment obtained by FACS of GFP expressing guard cells in the complex background of leaf cells, showing GFP containing protoplasts from the high 530/low 580 population of protoplasts derived from TP382 leaves. A-F: Confocal microscope images; G: Fluorescence microscope image. Scale bars within images are 50 μm.

Figure 3. Typical FACS acquisition dot plots of the output from the 580/30 nm (orange) vs. 530/40 nm (green) bandpass filters (BD Influx cell sorter). The sorting gates shown are those typically used during sorting. A) Dot plot of Col-4 leaf derived protoplasts, protoplasted in the absence of inhibitors, showing a single low 530/low 580 population. B) Dot plot from wt Col-4 leaf derived protoplasts, protoplasted in the presence of inhibitors, showing a shift in the 580 fluorescence due to stress and coloring by the inhibitors. C-E) Dot plots from leaf derived protoplasts from the KC74, KC464 and TP382 lines, respectively, protoplasted in the presence of inhibitors, showing the GFP containing populations in the high 530/low 580 populations. The percentages of the events in the GFP (high 530/low 580) populations are given. Click here to view larger figure.

Figure 4. GFP expression in the representative gated population fractions as shown in Figure 3. Two biological replicates were obtained for each fraction type, amplified using the Ovation Pico WTA System and qPCR using GFP-specific primers (Table 2) was then performed. Values shown are the highest (red), lowest (green) and average relative values. The high 580 population was in this case split in two, low 530/low 580 and high 530/low 580, for which a single biological replicate was used so only the single value is shown. ACT2 (At3g18780) was used as a standard for all samples. Leaf: Whole leaf. Unsorted: Unsorted protoplasts. GFP1: high 530/low 580 and Rest1: low 530/low 580, GFP2: high 530/high 580 and Rest2: low 530/high 580, as described in Figure 3 and the insert. The results are a verification of optical assessments of GFP cell content in the sorted fractions (e.g. Figure 2G). Click here to view larger figure.
| Sample | No. of leaves | No. of cells | RNA yield (ng) |
RNA yield (amplified; ng) |
| Whole leaf A Whole leaf B |
1 1 |
- - |
8001 10525 |
4623*** 4572*** |
| Unsorted protoplasts A Unsorted protoplasts B |
5 5 |
- - |
2433 2625 |
1152*** 3321*** |
| GFP1 A Rest1 A |
15 | 6039 (0.39%*) 55389 (6.40%*) |
-** -** |
861 489 |
| GFP1 B Rest1 B |
15 | 10783 (0.63%*) 57040 (7.49%*) |
-** -** |
537 420 |
| GFP2 Rest2 |
15 | 18337 (1.49%*) 62405 (73.49%*) |
-** -** |
360 411 |
Table 1. Samples collected using FACS and analysed with qPCR to determine which fraction contained live GFP-expressing protoplasts. Also included in this table is the total RNA yield in ng before and after amplification with the Ovation Pico WTA System (NuGen). GFP1, GFP2, Rest1 and Rest2 fractions are as shown in the insert in Figure 4. *The percentage of cells of the total cell sort run is given in parentheses beside the number of cells in the fraction. These percentages are not correlated to each other for each sample as the FACS sort runs for 'Rest' fractions were stopped earlier than for GFP fractions due to the much greater number of Rest cells collected. **50 ng used as input for amplification reactions, as per manufacturer's protocol.
| Primer | Sequence |
| mGFP5-ER.fw | GCCTGAGGGATACGTGCAGGAGA |
| mGFP5-ER.rv | TGGCGGGTCTTGAAGTTGGCT |
| ACT2.fw | GCCATCCAAGCTGTTCTCTC |
| ACT2.rv | GCCATCCAAGCTGTTCTCTC |
Table 2. qPCR primers.
We have described a method that allows the use of Arabidopsis plants expressing GFP in the leaves for protoplast generation and subsequent cell sorting using FACS. This method yields sufficient amounts of RNA to be used for amplification and therefore subsequent analysis by either qPCR or microarray. The fractions sorted are highly enriched for GFP-containing cells, as demonstrated by qPCR (Figure 2).
To achieve high yields of live protoplasts it is critical to work rapidly during the initial steps of the procedure, until the leaf strips have been vacuum infiltrated with the inhibitor-containing protoplast solution. In addition, when generating 1 mm leaf strips it is very important to slice or cut the leaves rather than 'chop' or mash them, as this leads to excessive damage and thus a lower protoplast yield.
A critical difference between the method described here and other published methods is the use of RNase inhibitors and transcriptional inhibitors. Most methods are developed for Arabidopsis roots, from which protoplasts can be generated more easily. However, when working with leaves, excepting mesophyll, it is necessary to increase the protoplast generation time. Therefore it is important to include these inhibitors to protect against changes in gene expression as a result of the protoplast generation treatment itself (data not shown). However, the presence of the inhibitors leads to an inability to mount a transcription response, either by switching genes on or off, which is likely to make the protoplasts more vulnerable as this leads to a loss of plasticity with which to counter the stresses of the protoplasting procedure.
We have used the method described here successfully with a number of GFP- expressing Arabidopsis lines. Importantly, we have used this method with GFP lines expressing GFP either strongly in the nucleus, or much more weakly in a non-localized/diffuse cytosolic manner, as is the case with the KC464 and KC274 lines used here. Both types of lines are compatible with the method and yield highly enriched fractions of GFP-expressing protoplasts (Figure 2 and 3). The method could be easily adapted to other fluorophores, although the fluorophore must be selected for fluorescence that is significantly different from the autofluorescence of dead/dying cells in order to preserve the ability to select live cells.
No conflicts of interest declared.
Work in the Buchanan-Wollaston lab on cell-type and developmental stage specific profiling is supported by the AGRON-OMICS project (grant # LSHG-CT-2006-037704) in the 6th Framework Progamme of the European Commission. Work in the Gifford lab on cell-type specific profiling is supported by a BBSRC New Investigator grant (BB/H019502/1).
The KC274 and KC464 Arabidopsis lines were obtained from A.A.R. Webb (University of Cambridge).
| Name | Company | Catalog Number | Comments |
| Cellulase R-10 | Melford | C8001 | |
| Cellulase RS | Melford | C8003 | |
| Macerozyme R-10 | Melford | M8002 | |
| BSA | Sigma-Aldrich | A3912 | |
| ProtectRNA | Sigma-Aldrich | R7397 | |
| Actinomycin D | Sigma-Aldrich | A1410 | |
| 70 μm cell strainer | Fisher | FB35181 | |
| 50 μm filcon cup-type filters | BD Biosciences | 340630 |