HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.
The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.
Bestemme både vert og viral egenskaper som påvirker HIV-1 patogenesen og sykdomsutvikling er viktig for rasjonell vaksine design. Den cellulære immunrespons er en viktig del av det menneskelige immunrespons mot HIV-1-infeksjon. Cytotoksiske T-lymfocytter (CTL) som er nødvendig for den første kontroll av akutt viremi, og tillater verten for å etablere en stabil tilstand (settpunkt) virusmengde 1,2. Eksperimentell uttømming av disse effektor-celler resulterer i tap av viral kontroll 3,4. Til tross for dette, rømme mutasjoner oppstår i det virale genomet som grave CTL anerkjennelse av virusinfiserte celler 5-9.
Visse HLA-alleler har vært forbundet med lavere virusmengde og tregere sykdomsutvikling inkludert B * 57, B * 27 og B * 81 10-15. En del av den beskyttende fordelen av HLA klasse I allelene kan tilskrives det faktum at de målrette funksjonelt begrenset regioner av genomet som for eksempel Gagog selektere for rømnings mutasjoner som reduserer evnen av viruset til å replikere in vitro 16-21. Selv unnslippe fra det cellulære immunsystemet er fordelaktig for viruset i sammenheng med å velge HLA klasse I alleler, kan virkningen av disse mutasjonene har differensial konsekvenser for verten ved overføring til et HLA-umake individuelle 22,23. Derfor vil forstå virkningene av overfør HLA-assosierte rømnings mutasjoner på viral replikasjon kapasitet være viktig for å fremme forståelsen av tidlig stadium av HIV-1-patogenesen.
Mens mye fremgang har blitt gjort for å identifisere og karakterisere trenings defekter av individuelle rømnings mutasjoner assosiert med spesifikke HLA klasse I alleler 24-29, naturlig forekommende HIV-1-isolater har unike og komplekse fotavtrykk av HLA-assosierte polymorfismer, trolig som følge av HLA -mediert immun press forskjellige immunogenetic bakgrunn 30. I aporrige analyse, Goepfert et al. viste at en akkumulering av HLA-assosierte mutasjoner i de overførte Gag sekvenser avledet fra 88 akutt infiserte Zambierne var assosiert med en reduksjon i settpunktet virusmengde 31. Dette antydet at overføring av skadelige rømnings mutasjoner, spesielt i Gag, til HLA-umake mottakere gir en klinisk fordel, og kan skyldes attenuert virusreplikasjon. Fremover er det viktig å studere hvordan komplekse kombinasjoner av Gag polymorfismer innen naturlig forekommende isolater jobber sammen for å definere egenskapene til overført virus som replikasjonskapasitet, og hvor tidlig replikering kan i sin tur påvirke HIV-1 kliniske parametre og sent stadium patogenesen.
Brockman et al. Første gang påvist en sammenheng mellom replikasjonskapasitet av gag-pro sekvenser isolert ved kronisk stadium infeksjon og virusmengde i både subtype C og B-infeksjoner32-35. Den eksperimentelle metode presentert i disse studiene, men hensiktsmessig for behandlingen av in vitro replikasjonskapasitet av sekvenser avledet fra kronisk infiserte individer, har flere tekniske begrensninger og begrensninger som gjør studere HIV-1-replikasjonskapasitet i subtype C akutt infiserte individer vanskelig. Denne fremgangsmåte er avhengig av rekombinasjon av befolkningen basert PCR-amplifiserte sekvenser inn i subtype B NL4-3 provirus, som ble avledet delvis fra LAV, et laboratorium tilpasset virus lager 36. Virus generasjonen ble oppnådd ved co-transfeksjon av en CEM-baserte T-cellelinje 37 med PCR-amplikoner og fordøyd delta-gag-pro NL4-3 DNA. Denne metoden krever utvekst av virus over en periode på uker til måneder, potensielt forvrenger arten av den gjenvinnes virus lager i forhold til de virale quasispecies in vivo, og således endre måling av replikasjonskapasitet in vitro. Denne metoden jeger mer egnet for å studere kronisk infiserte individer, hvor den effektivt selekterer for virus med høyest replikative kapasitet, og hvor kloning rekke forskjellige virale varianter fra et stort antall av kronisk infiserte individer er ganske arbeidskrevende og derfor ikke er mulig. Imidlertid, innenfor en akutt infisert individ, er det vanligvis ett femtinitti varianter til stede, og dermed eliminere risikoen for å skråstille arten av den gjenvinnes virus lager, ved in vitro seleksjonstrykk, gir mulighet for en mer nøyaktig vurdering av in vitro replikasjonskapasitet. Dernest krever denne metoden recombining subtype C gag-pro sekvenser i en subtype B avledet ryggrad, og kunne introdusere ryggrad inkompatibilitet skjevheter i analysen. På grunn av disse begrensningene, må et stort antall sekvenser bli analysert for å overvinne eventuelle skjevheter innført.
Her beskriver vi en alternativ eksperimentell hensiktsach hensiktsmessig for å studere sekvenser avledet fra subtype C akutt infiserte individer. Vi bruker en begrensning enzym basert kloning strategi for å introdusere gag genet stammer fra akutt infeksjon tidspunkter av HIV-1 subtype C smittede personer inn i subtype C proviral ryggrad, MJ4. Bruken av MJ4 som et felles ryggraden i hvilken for å klone gener gag er avgjørende for analyse av undertype C-avledede sekvenser. MJ4 er avledet fra et primært isolat 38, og dermed ville være mindre sannsynlighet for å innføre skjevhet på grunn av subtype inkompatibilitet mellom ryggraden og gag-genet. I tillegg er den tilnærming for å bruke enzymbasert restriksjons kloning gjør det mulig for proviral konstruerer å bli transfektert direkte inn i 293T-celler, og for gjenvinning av en klonal viruslager identisk med det klonede gag sekvens.
Metoden som presenteres nedenfor er en høy gjennomstrømning metode for vurdering av replikasjonskapasitet av subtype C avledet Gag-MJ4kimære virus. Transfeksjon inn i 293T-celler er enkel og gjenvinning av virus tar bare tre dager. In vitro replikasjonskapasitet blir analysert på samme CEM-CCR5 basert T-cellelinje som er laget av Brockman et al. 37, men ved anvendelse av protokollen viktige modifikasjoner som er nødvendig for en vellykket replikering av subtype C MJ4 kimære virus. Bruken av et passende T-cellelinje i stedet for PBMC tillater et stort antall undertype C MJ4-kimære virus for å bli testet med høy analyse reproduserbarhet. Til slutt, ved å bruke en radioaktivt merket revers transkriptase assay for kvantifisering av virus i supernatanten er mer kostnadseffektivt enn å bruke kommersielt tilgjengelig P24 ELISA kit. Det gir også en høyere dynamisk område, som var viktig for å oppdage både dårlig og svært replikere virus innen samme analysen og for å avdekke små forskjeller i replikering mellom isolater.
Som konklusjon, har fremgangsmåten som presenteres her er tillatt forden inngående studie av replikasjonskapasitet av gag sekvenser avledet fra HIV-1 subtype C akutt infiserte individer fra Zambia, og som skrevet, kan også utvides til å studere andre subtype C smittet populasjoner. En høy grad av variasjon i replikering kapasiteter mellom ulike Gag isolater ble observert. I tillegg var vi i stand til å vise en statistisk sammenheng mellom replikasjonskapasitet av den overførte Gag og settpunkt virusmengde samt med CD4 + nedgang over en tre-års periode 39. Slike resultater reke viktigheten av å studere hvordan overførte virale egenskaper, for eksempel replikasjonskapasitet, samhandle med vertens immunsystem til å påvirke patogenesen under tidlig infeksjon og blir integrert for å utvikle effektive vaksine inngrep så vel som behandling.
På grunn av lengden og teknisk natur av denne protokollen, er det flere trinn som er avgjørende både for den vellykkede konstruksjon av kimære Gag-MJ4 plasmider, så vel som for kvantifisering av virusreplikasjon kapasitet. Selv om begrensning enzym basert kloning strategi for introduksjon av fremmede gag gener i MJ4 skissert i denne protokollen har mange fordeler i forhold til tidligere brukte rekombinasjon baserte metoder, kan protokollen være teknisk utfordrende hvis kritiske trinnene ikke blir fulgt n?…
The authors have nothing to disclose.
The investigators thank all the volunteers in Zambia who participated in this study and all the staff at the Zambia Emory HIV Research Project in Lusaka who made this study possible. The investigators would like to thank Jon Allen, Smita Chavan, and Mackenzie Hurlston for technical assistance and sample management. We would also like to thank Dr. Mark Brockman for his discussions and generous donation of the GXR25 cells.
This study was funded by R01 AI64060 and R37 AI51231 (EH) and the International AIDS Vaccine Initiative. This work was made possible in part by the generous support of the American people through the United States Agency for International Development (USAID). The contents are the responsibility of the study authors and do not necessarily reflect the views of USAID or the United States Government. This work also was supported, in part, by the Virology Core at the Emory Center for AIDS Research (Grant P30 AI050409). DC and JP were supported in part by Action Cycling Fellowships. This work was supported in part by the Yerkes National Primate Research Center base grant (2P51RR000165-51). This project was also funded in part by the National Center for Research Resources P51RR165 and is currently supported by the Office of Research Infrastructure Programs/OD P51OD11132.
Name of the Reagent | Company | Catalogue number | Comments |
PCR reagents | |||
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagF2: 5' GGGACATCAAGCAGCCAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagR6: 5' CTGTATCATCTGCTCCTG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
CoolRack PCR 96 XT | Biocision | BCS-529 | |
CoolRack M15 | Biocision | BCS-125 | |
Nuclease free water | Fisher | SH30538FS | Manufactured by Hyclone |
QIAamp Viral RNA Mini Kit | Qiagen | 52906 | |
Simport PCR 8 Strip Tubes, Blue (Flat Cap) | Daigger | EF3647BX | |
SuperScript III one-step RT-PCR system | Life Technologies/Invitrogen | 12574035 | |
Phusion Hot-start II DNA polymerase | Fisher | F-549L | |
PCR Nucleotide Mix | Roche | 4638956001 | |
Agarose, high gel strength | Fisher | 50-213-128 | |
TAE 10X | Life Technologies/Invitrogen | AM9869 | |
Promega 1kb DNA ladder | Fisher | PRG5711 | Manufactured by Promega |
Sybr Safe DNA Gel Stain, 10000x | Life Technologies/Invitrogen | S33102 | |
Wizard SV Gel and PCR Clean-Up System | Promega | A9282 | |
Razor blades, single-edged | Fisher | 12-640 | Manufactured by Surgical Design |
Thermocycler, PTC-200 | MJ Research | ||
Microbiology & Cloning reagents | |||
LB Agar, Miller | Fisher | BP1425-2 | |
LB Broth, Lennox | Fisher | BP1427-2 | |
Sterile 100mm x 15mm polystyrene petri dishes | Fisher | 08-757-12 | |
Ampicillin sodium salt | Sigma-Aldrich | A9518-5G | |
Falcon 14ml Polypropylene round-bottom tubes | BD Biosciences | 352059 | |
NgoMIV restriction endonuclease | New England BioLabs | R0564L | |
BclI restriction endonuclease | New England BioLabs | R0160L | |
HpaI restriction endonuclease | New England BioLabs | R0105L | |
T4 DNA Ligase, 5U/μL | Roche | 10799009001 | |
JM109 competent cells, >10^8 cfu/μg | Promega | L2001 | |
PureYield plasmid miniprep system | Promega | A1222 | |
Safe Imager 2.0 Blue Light Transilluminator | Invitrogen | G6600 | |
Microfuge 18 centrifuge | Beckman Coulter | 367160 | |
Cell culture reagents | |||
Amphyl cleaner/disinfectant | Fisher | 22-030-394 | |
Fugene HD, 1 mL | VWR | PAE2311 | Manufactured by Promega |
Hexadimethrine bromide (Polybrene) | Sigma-Aldrich | H9268-5G | |
Costar Plates, 6-well, flat | Fisher | 07-200-83 | Manufactured by Corning Life |
Costar Plates, 24-well, flat | Fisher | 07-200-84 | Manufactured by Corning Life |
Costar Plates, 96-well, round | Fisher | 07-200-95 | Manufactured by Corning Life |
Flasks, Corning filter top/canted neck, 75 cm^2 | Fisher | 10-126-37 | |
Flasks, Corning filter top/canted neck, 150 cm^2 | Fisher | 10-126-34 | Manufactured by Corning Life |
Conical Tubes, 50ml, blue cap | Fisher | 14-432-22 | Manufactured by BD Biosciences |
Conical Tubes, 15ml, blue cap | Fisher | 14-959-70C | Manufactured by BD Biosciences |
Trypsin-EDTA | Fisher | MT25052CI | Manufactured by Mediatech |
RPMI, 500 ml | Life Technologies/Invitrogen | 11875-119 | |
DMEM, 500 ml | Life Technologies/Invitrogen | 11965-118 | |
Penicillin/Streptomycin/Glutamine, 100X | Life Technologies/Invitrogen | 10378-016 | |
PBS with magnesium and calcium, 500ml | Life Technologies/Invitrogen | 14040-133 | |
PBS without magnesium and calcium | Life Technologies/Invitrogen | 20012-050 | |
Sarstedt tubes, assorted colors | Sarstedt | 72.694.996 | |
Reservoir Trays for Multichannel, 55ml | Fisher | 13-681-501 | |
DEAE-Dextran | Fisher | NC9691007 | |
Corning 96 well clear V bottom tissue culture treated microplate | Fisher | 07-200-96 | Manufactured by Corning Life |
HEPES, 1M Buffer Solution | Life Technologies/Invitrogen | 15630-080 | |
FBS, Defined, 500 ml | Fisher | SH30070 03 | |
X-gal | VWR | PAV3941 | Manufactured by Promega |
Glutaraldehyde, Grade II, 25% in H2O | Sigma-Aldrich | G6257-100ML | |
1M Magnesium chloride solution | Sigma-Aldrich | M1028-100ML | |
Formaldehyde solution, for molecular biology, 36.5% | Sigma-Aldrich | F8775-500ML | |
Potassium hexacyanoferrate(II) trihydrate | Sigma-Aldrich | P9387-100G | |
Potassium hexacyanoferrate(III) | Sigma-Aldrich | P8131-100G | |
Allegra X15-R centrifuge | Beckman Coulter | 392932 | |
TC10 automated cell counter | Bio-Rad | 1450001 | |
VistaVision inverted microscope | VWR | ||
Reverse-Transcriptase Quantification Assay reagents | |||
dTTP, [α-33P]- 3000Ci/mmol, 10mCi/ml, 1 mCi | Perkin-Elmer | NEG605H001MC | |
1M Tris-Cl, pH 8.0 | Life Technologies/Invitrogen | 15568025 | Must be adjusted to pH 7.8 with KOH |
2M potassium chloride (KCl) | Life Technologies/Invitrogen | AM9640G | Adjust to 1M solution |
0.5M EDTA | Life Technologies/Invitrogen | 15575-020 | |
Nonidet P40 | Roche | 11333941103 | |
Polyadenylic acid (Poly rA) potassium salt | Midland Reagent Co. | P-3001 | |
Oligo d(T) primer | Life Technologies/Invitrogen | 18418-012 | |
Dithiothreitol (DTT) | Sigma-Aldrich | 43815-1G | |
SR, Super Resolution Phosphor Screen, Small | Perkin-Elmer | 7001485 | |
Corning Costar Thermowell 96 well plate model (M) Polycarbonate | Fisher | 07-200-245 | Manufactured by Corning Life |
Corning 96 Well Microplate Aluminum Sealing Tape, Nonsterile | Fisher | 07-200-684 | Manufactured by Corning Life |
DE-81 anion exchange paper | Whatman | 3658-915 | |
Trisodium citrate dihydrate | Sigma-Aldrich | S1804-1KG | |
Sodium Chloride | Fisher | S671-3 | |
Autoradiography cassette | Fisher | FB-CA-810 | |
Cyclone storage phoshpor screen | Packard |