Represión del crecimiento de la célula del mieloma múltiple en Vivo de nanotubos de carbono de pared simple (SWCNT)-entregado Oligos antisentido MALAT1
Summary
Este manuscrito describe la síntesis de un nanotubo de carbono de pared simple (SWCNT)-conjugado MALAT1 gapmer antisentido DNA oligonucleotide (SWCNT-anti-MALAT1), que demuestra la entrega confiable de la SWCNT y el potente efecto terapéutico de anti-MALAT1 in vitro e in vivo. Métodos utilizados para la síntesis, modificación, verbal, y la inyección de SWCNT-anti-MALAT1 se describen.
Abstract
Los nanotubos de carbono de pared simple (SWCNT) es un nuevo tipo de nanopartícula, que se ha utilizado para ofrecer a varios tipos de drogas en las células, como las proteínas, oligonucleótidos y drogas sintéticas de molécula pequeña. El SWCNT tiene dimensiones personalizables, una gran área superficial y flexible puede enlazar con las drogas a través de diferentes modificaciones en su superficie; por lo tanto, es un sistema ideal para el transporte de drogas en las células. Larga noncoding RNAs (lncRNAs) son un grupo de RNA codifica más de 200 nt, que no puede ser traducido a proteína, pero juega un papel importante en procesos biológicos y fisiopatológicos. Adenocarcinoma pulmón metástasis asociadas 1 (MALAT1) es un lncRNA altamente conservado. Se demostró que niveles más altos de MALAT1 están relacionados con el pronóstico de varios tipos de cáncer, como mieloma múltiple (MM). Hemos revelado que MALAT1 regula ADN reparación y muerte celular en MM; así, MALAT1 puede considerarse como una diana terapéutica para m. Sin embargo, la entrega eficiente de oligo antisentido para inhibir/caída MALAT1 en vivo sigue siendo un problema. En este estudio, nos modificar SWCNT con PEG-2000 conjugar un oligo de anti-MALAT1 a él, prueba de la entrega de este compuesto en vitro, inyectar por vía intravenosa en un modelo de ratón MM diseminado y observar una inhibición significativa de la progresión de MM, que indica SWCNT es una entrega ideal para anti-MALAT1 gapmer ADN.
Introduction
El SWCNT es un nuevo nanomaterial que puede ofrecer a varios tipos de drogas, como las proteínas, moléculas pequeñas y los ácidos nucleicos, estable y eficiente con tolerabilidad ideal y mínima toxicidad en la1 de la vitro y en vivo2. Un SWCNT funcionalizado tiene gran solubilidad en agua y biocompatibilidad, puede utilizarse como un servicio de transporte para moléculas más pequeñas y llevarlas para penetrar la membrana de la célula3,4,5.
lncRNAs son un grupo de RNA (> 200 nt) que se transcriben a mRNA de genoma, pero no puede ser traducido a proteínas. Cada vez más pruebas ha demostrado que lncRNAs participar en la regulación de la expresión de genes6 y participan en la iniciación y progresión de la mayoría de los tipos de cáncer, incluyendo MM7,8,9. MALAT1 es una transcripción codifica nuclear enriquecido 2 (NEAT2) y un altamente conservado lncRNA10. MALAT1 es reconocido inicialmente en metastásico de pulmón de células no pequeñas (CPCNP) el cáncer11, pero ha sido sobre expresa en numerosos tumores5,12,13; es uno de los lncRNAs más altamente expresada y se correlaciona con un pronóstico pobre en MM8,14. El nivel de expresión de MALAT1 es significativamente mayor en pacientes con MM extramedular curso fatal en comparación con aquellos diagnosticados sólo como MM15.
En un estudio previo, hemos confirmado que oligos de anti-MALAT1 robusta conducen a daños en el ADN y la apoptosis en MM16 mediante el uso de oligonucleótidos de antisentido del ADN de gapmer a MALAT1 (anti-MALAT1) en células de MM. La DNA gapmer es compuesta de ADN antisentido y unida por 2′-OMe-RNAs, que podrían sugerirán el escote de la MALAT1 por la Rnasa H actividad una vez atado17. La eficiencia de la entrega en vivo de oligos antisentido todavía limita su uso clínico.
Para probar la entrega efecto de SWCNT para oligos de gapmer anti-MALAT1, el gapmer anti-MALAT1 ADN se conjuga a DSPE-PEG2000-amina funcionalizados SWCNT. SWCNT-anti-MALAT1 luego se inyecta por vía intravenosa en un modelo de ratón diseminada MM; se observa una inhibición notable después de cuatro tratamientos.
Protocol
Representative Results
Discussion
La evidencia ha mostrado que lncRNAs participar en la regulación de numerosos procedimientos fisiológicos y patofisiológicos de cánceres, incluyendo el m7,8,9; tienen el potencial de ser objeto de tratamiento del cáncer, que puede ser realizado por oligonucleótidos antisentido20,21,22. La U.S. Food y Drug Administration (FDA) ha a…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Los autores agradecen el Instituto de Investigación Lerner proteómicos, genómicos y núcleos de proyección de imagen para su ayuda y apoyo. Financiación: Este trabajo fue apoyado financieramente por la subvención del NIH/NCI R00 CA172292 (a J.J.Z.) y fondos de puesta en marcha (a J.J.Z.) y la clínica y traslacional ciencia colaborativa (CTSC) de caso Western Reserve University base utilización piloto (a J.J.Z.). Este trabajo utilizó el microscopio confocal Leica SP8 que fue comprado con fondos de los institutos nacionales de salud SIG grant 1S10OD019972-01.
Materials
| SWCNTs | Millipore-Sigma | 704113 | |
| DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
| bath sonicator | VWR | 97043-992 | |
| 4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
| UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
| Sulfo-LC-SPDP | ProteoChem | c1118 | |
| DTT solution | Millipore-Sigma | 43815 | |
| NAP-5 column | GE Healthcare | 17-0853-01 | |
| in vivo imaging system | PerkinElmer | ||
| NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
| Flow cytometer | Becton Dickinso | ||
| Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
| Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
| RMPI-1640 medium | Invitrogen | 11875-093 | |
| MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
| MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
| GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
| GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
| Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
| RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
| anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
| Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
| accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
| centrifugal filter | Millipore-Sigma | UFC910008 | |
| SPSS software | IBM | version 24.0 | |
| D-Luciferin | Millipore-Sigma | L9504 |
References
- Jiang, X., et al. RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis. Nanoscale. 5 (16), 7256-7264 (2013).
- Murakami, T., et al. Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy. Nanomedicine (Lond). 3 (4), 453-463 (2008).
- Kam, N. W., Dai, H. Carbon nanotubes as intracellular protein transporters: generality and biological functionality. Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).
- Kam, N. W., Liu, Z., Dai, H. Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing. Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).
- Kam, N. W., Liu, Z., Dai, H. Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway. Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).
- Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. Emerging concepts of epigenetic dysregulation in hematological malignancies. Nature Immunology. 17 (9), 1016-1024 (2016).
- Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. The bright side of dark matter: lncRNAs in cancer. Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).
- Ronchetti, D., et al. Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma. Oncotarget. 7 (12), 14814-14830 (2016).
- Wong, K. Y., et al. Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma. Molecular Cancer. 14, 175 (2015).
- Schmidt, L. H., et al. The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth. Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).
- Ji, P., et al. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22 (39), 8031-8041 (2003).
- Luo, J. H., et al. Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology. 44 (4), 1012-1024 (2006).
- Guffanti, A., et al. A transcriptional sketch of a primary human breast cancer by 454 deep sequencing. BMC Genomics. 10, 163 (2009).
- Cho, S. F., et al. MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression. BMC Cancer. 14, 809 (2014).
- Handa, H., et al. Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma. British Journal of Haematology. 179 (3), 449-460 (2017).
- Hu, Y., et al. Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma. Leukemia. , (2018).
- Lennox, K. A., Behlke, M. A. Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides. Nucleic Acids Research. 44 (2), 863-877 (2016).
- Kam, N. W., O’Connell, M., Wisdom, J. A., Dai, H. Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction. Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).
- Zeineldin, R., Al-Haik, M., Hudson, L. G. Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells. Nano Letters. 9 (2), 751-757 (2009).
- Amodio, N., D’Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation. Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).
- Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. MicroRNA theragnostics for the clinical management of multiple myeloma. Leukemia. 28 (4), 732-738 (2014).
- Amodio, N., et al. Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity. Leukemia. , (2018).
- Highleyman, L. FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration. BETA. 5, (1998).
- Smith, R. J., Hiatt, W. R. Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder. JAMA Internal Medicine. 173 (16), 1491-1492 (2013).
- Aartsma-Rus, A. FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides. Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).
- Nelson, S. F., Miceli, M. C. FDA Approval of Eteplirsen for Muscular Dystrophy. The Journal of the American Medical Association. 317 (14), 1480 (2017).
- Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery. American Chemical Society Nano. 1 (1), 50-56 (2007).
- Ali-Boucetta, H., et al. Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics. Chemical communications (Cambridge). (4), 459-461 (2008).
- Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. Biomedical applications of functionalised carbon nanotubes. Chemical communications. (5), 571-577 (2005).
- Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods. International Journal of Nanomedicine. 6, 737-746 (2011).
- Padilla-Parra, S., et al. Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes. Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).
- Wu, H., Zhu, L., Torchilin, V. P. pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery. Biomaterials. 34 (4), 1213-1222 (2013).
- Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages. Chembiochem. 6 (4), 718-725 (2005).
- Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA. Biomaterials. 32 (15), 3875-3882 (2011).
- Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT). Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).
- Lelimousin, M., Sansom, M. S. Membrane perturbation by carbon nanotube insertion: pathways to internalization. Small. 9 (21), 3639-3646 (2013).
- Thomas, M., Enciso, M., Hilder, T. A. Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers. J Phys Chem B. 119 (15), 4929-4936 (2015).
- Jin, H., Heller, D. A., Strano, M. S. Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells. Nano Letters. 8 (6), 1577-1585 (2008).
- Jin, H., Heller, D. A., Sharma, R., Strano, M. S. Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles. American Chemical Society Nano. 3 (1), 149-158 (2009).
- Ruggiero, A., et al. Paradoxical glomerular filtration of carbon nanotubes. Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).
