Dette manuskriptet beskriver syntesen av en enkelt-vegg carbon nanorør (SWCNT)-konjugert MALAT1 antisense gapmer DNA oligonucleotide (SWCNT-anti-MALAT1), som viser pålitelig levering av SWCNT og den potente terapeutiske effekten av anti-MALAT1 i vitro og in vivo. Metoder brukt for syntese, modifisering, bøyning og injeksjon av SWCNT-anti-MALAT1 er beskrevet.
Enkelt-vegg carbon nanorør (SWCNT) er en ny type hydrogenion, som er brukt til å levere flere typer narkotika inn celler, for eksempel proteiner, oligonucleotides og syntetiske små molekyl narkotika. SWCNT har passelig dimensjoner, et stort overfladisk område, og kan fleksibelt binde med narkotika gjennom forskjellige modifikasjoner på overflaten; Derfor er det et ideelt system å transportere narkotika i celler. Lang noncoding RNAs (lncRNAs) er en klynge av noncoding lenger enn 200 nt, som ikke kan oversettes til protein, men spiller en viktig rolle i biologiske og patofysiologiske. Metastasering-assosiert lunge adenocarcinoma transkripsjon 1 (MALAT1) er en høyt konservert lncRNA. Det ble demonstrert at høyere MALAT1 nivåer er knyttet til dårlig prognosen for ulike kreftformer, herunder myelom (MM). Vi har avdekket at MALAT1 regulerer DNA reparasjon og celle død i MM; MALAT1 kan dermed betraktes som et terapeutisk mål for MM. Effektiv levering av den antisense oligo å hemme/knockdown MALAT1 i vivo er imidlertid fortsatt et problem. I denne studien vi endre SWCNT med PEG-2000 og bøy en anti-MALAT1 oligo den, teste levering av denne sammensatte i vitro, injisere den intravenøst i spres MM musemodell og observere en betydelig hemming av MM progresjon, som angir det SWCNT er en ideell levering transporttjeneste for anti-MALAT1 gapmer DNA.
SWCNT er en ny nanomaterial som kan levere ulike typer narkotika, som proteiner, små molekyler og atomer syren, stabilt og effektivt med ideelle toleranse og minimum toksisitet i vitro1 og i vivo2. En functionalized SWCNT har stor biocompatibility og vann løselighet, kan brukes som en transporttjeneste for mindre molekyler og kan bære dem å trenge celle membran3,4,5.
lncRNAs er en klynge av RNA (> 200 nt) som er transkribert fra genomet til mRNA men ikke kan oversettes til proteiner. Økende bevis har vist at lncRNAs delta i regulering av gene expression6 og er involvert i oppstart og progresjon av de fleste typer kreft, inkludert MM7,8,9. MALAT1 er en kjernefysisk-beriket noncoding transkripsjon 2 (NEAT2) og en høyt konservert lncRNA10. MALAT1 er først anerkjent i metastatisk ikke-småcellet lungekreft kreft (NSCLC)11, men har vært overexpressed i mange svulster5,12,13; Det er en av de mest uttrykte lncRNAs er korrelert med en dårlig prognose i MM8,14. Hvilket uttrykk MALAT1 er betydelig høyere i dødelig kurs extramedullary MM pasienter sammenlignet med de bare diagnostisert som MM15.
I en tidligere studie, har vi bekreftet at anti-MALAT1 oligos robust føre til DNA skade og apoptose i MM16 ved hjelp gapmer DNA antisense oligonucleotides rettet mot MALAT1 (anti-MALAT1) i MM celler. Gapmer DNA er sammensatt av antisense DNA og forbundet med 2-OMe-RNAs, som kunne be MALAT1 spalting av RNase H aktivitet når bundet17. I vivo levering effektiviteten av antisense oligos fortsatt begrenser klinisk bruk.
For å teste levering functionalized effekten av SWCNT for anti-MALAT1 gapmer oligos, anti-MALAT1 gapmer DNA er konjugert til DSPE-PEG2000-Amin SWCNT. SWCNT-anti-MALAT1 er deretter sprøytes intravenøst inn en MM spres musemodell; en slående hemming er observert etter fire behandlinger.
Bevis har vist at lncRNAs tar del i regulering av mange fysiologiske og patofysiologiske prosedyrer i kreft, inkludert MM7,8,9; de har potensial til å bli mål for kreftbehandling, noe som kan realiseres ved antisense oligonucleotides20,21,22. US Food and Drug Administration (FDA) har godkjent flere antisense oligonucleotide stoffer, i…
The authors have nothing to disclose.
Forfatterne takke Lerner Research Institute proteomic, genomisk, og tenkelig kjerner for deres hjelp og støtte. Finansiering: Dette arbeidet ble økonomisk støttet av NIH/NCI grant R00 CA172292 (til J.J.Z.) og oppstart midler (til J.J.Z.) og kliniske og translasjonsforskning Science samarbeid (CTSC) av Case Western Reserve University Core utnyttelse Pilot Grant (til J.J.Z.). Dette arbeidet utnyttet Leica SP8 AC confocal mikroskop som ble kjøpt med støtte fra nasjonale institutter for helse SIG grant 1S10OD019972-01.
SWCNTs | Millipore-Sigma | 704113 | |
DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
bath sonicator | VWR | 97043-992 | |
4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
Sulfo-LC-SPDP | ProteoChem | c1118 | |
DTT solution | Millipore-Sigma | 43815 | |
NAP-5 column | GE Healthcare | 17-0853-01 | |
in vivo imaging system | PerkinElmer | ||
NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
Flow cytometer | Becton Dickinso | ||
Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
RMPI-1640 medium | Invitrogen | 11875-093 | |
MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
centrifugal filter | Millipore-Sigma | UFC910008 | |
SPSS software | IBM | version 24.0 | |
D-Luciferin | Millipore-Sigma | L9504 |