Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

המצאה של אלקטרוכימי-DNA Biosensors לגילוי Reagentless של חומצות, חלבונים ומולקולות קטנות גרעין

doi: 10.3791/2922 Published: June 1, 2011

Summary

"ה-DNA" חיישנים, reagentless, biosensors אלקטרוכימיים כי ביצועים טובים גם כאשר תיגר ישירות בדם מטריצות מורכבות אחרות, הותאמו זיהוי של מגוון רחב של חומצת גרעין חלבון, ו analytes מולקולה קטנה. כאן אנו מציגים הליך כללי עבור ייצור ושימוש של חיישנים כאלה.

Abstract

כמו ברפואה נהוגה כיום, רופאים לשלוח דגימות למעבדה מרכזית לבדיקה ולכן צריך לחכות שעות או ימים כדי לקבל את התוצאות. חולים רבים ייטב ידי, בדיקות מהיר ליד המיטה. לשם כך במעבדה שלנו ואחרים פיתחו פלטפורמה צדדי, biosensor reagentless התומך כמותי, זיהוי reagentless, אלקטרוכימיים של חומצות גרעין (DNA, RNA), חלבונים (כולל נוגדנים) לבין מולקולות קטנות analytes ישירות בדגימות קליניות וסביבתיות לא מעובדים. בסרטון הזה, אנחנו מדגימים את ההכנה והשימוש biosensors כמה זה בכיתה "E-DNA". בפרט, אנו לפברק ולהפגין חיישנים לגילוי של רצף ה-DNA היעד תערובת תגובת שרשרת פולימרז, נוגדן ל-HIV ספציפיים הקוקאין הסם. הליך הכנת דורש רק שלוש שעות של הידיים על המאמץ ואחריו הדגירה לילה, והשימוש בהם מצריך רק מספר דקות.

Protocol

1. קביעת שלב

  1. רכש את ה-DNA רלוונטיים, בדיקה שינוי כימי של חברת סינתזה אישית oligonucleotide כגון Biosearch טכנולוגיות (Novato, CA) או מידלנד מוסמך (מידלנד, טקסס). החללית הוא שונה במהלך הסינתזה על ידי תוספת של תיאול C6 בסוף 3'-שלה כחול חמזור פעילה מתילן בסוף 5'-שלה.
  2. ממיסים את ה-DNA בדיקה שנאגרו פוספט pH 7.4 כדי מלוחים בריכוז של 200 מיקרומטר ולאמת שלו על ידי מדידת ריכוז ספיגת שלה ב 260 ננומטר באמצעות ספקטרופוטומטר. בשל מחצית מתילן כחול על החללית DNA הפתרון צריך גוון כחול גלוי.
  3. להכין טרי 1 מ"ל של תמיסה של 10 mM טריס (2-carboxyethyl) phosphine TCEP במים מזוקקים deionized (DI-מים). מניסיוננו, פתרונות אלה TCEP יישארו טריים למשך שבוע כאשר מאוחסנים בחושך ב 4 ° C.
  4. כדי להפחית את כל איגרות החוב דיסולפיד שעשוי להיות נוכח פתרון ה-DNA בדיקה, לשלב 1 μL של פתרון ה-DNA בדיקה מניות עם μL 2 של הפתרון TCEP ומערבבים בעדינות עם טפטפת. דגירה את התערובת למשך שעה אחת במיכל, כהה בקירור. הפתרון כחול בתחילה צריך להיות ברור כמו TCEP הפיך מפחית את מתילן כחול. אם הפתרון אינו ברור, לחזור על התהליך באמצעות פתרון TCEP טריים או, אולי, בטמפרטורת החדר.
  5. לאחר שעה לדלל את ה-DNA מופחת בדיקה עם פתרון מ"ל 1 של חיץ, זה יהיה לדלל אותו ריכוז של 200nM. בהמשך, תוכלו דגירה קבוצה של אלקטרודות דיסק זהב 200 חלקים μL של פתרון זה בדיקה מדולל.
  6. טרי להכין לפחות 2 מ"ל של 2mm mercaptohexanol ב פוספט שנאגרו מלוחים.

2. חיישן הכנה

  1. מערבבים אבקת 0.05 מיקרון אלומינה עם מים על בד ליטוש עדין. פולין קבוצה של אלקטרודות זהב דיסק (CH מכשירים, אוסטין, טקסס) על ידי לחיצה על משטח זהב בחוזקה לתוך הבד רטוב, ומרגש אותם הספרה שמונה דפוס כשלוש דקות לכל אלקטרודה.
  2. יש לשטוף את האלקטרודות מלוטש עם DI-מים לטבול אותם לתוך צינורות Eppendorf מלאים זהה. Sonicate במשך חמש דקות כדי להסיר כל אבקת אלומינה שיורית.
  3. הנח את האלקטרודות לתוך פתרון 0.5 חומצה גופרתית M, לצרף אותם potentiostat יחד עם מונה פלטינה וכסף / אלקטרודה כסף התייחסות כלוריד, ולהפעיל סדרה של voltammograms לחמצן, להקטין את electrochemically נקי השטח שלהם. בעקבות זאת לבצע ניקוי second אלקטרוכימיים בתמיסה של 0.01 M KCl חומצה גופרתית M 0.1. הפרטים קנס של הליכים אלה ניקוי ניתן למצוא במאמר שלנו הטבע הפרוטוקולים 1, וכן להשלים את הווידאו הזה.
  4. סדר סט של 2 צינורות מ"ל Eppendorf במעמד ולמלא כל אחד עם 200 μL של פתרון ה-DNA בדיקה. ריכוז ה-DNA בדיקה בפתרון זה יגדיר את הצפיפות שבה DNAs בדיקה לארוז על משטח החיישן. ביצועי חיישן תלויה מאוד על צפיפות בדיקה, עם צפיפות האופטימלי משתנה מארכיטקטורה one חיישן הבא. ריכוז החללית בשימוש בשלב זה צריך אפוא להיות מותאם לכל סוג חדש של חיישן 2. עבור ארכיטקטורות בדיקה לנו נחקר עד כה, ה-DNA ריכוזי בדיקה אנו מעסיקים בטווח זה צעד מן nM 15-2 מיקרומטר, עם 200 ננומטר להיות ערך טיפוסי.
  5. יש לשטוף את האלקטרודות דיסק זהב עם DI-מים, ואז לטבול אותם הפתרון DNA רלוונטיים בדיקה בצינור Eppendorf במשך שעה אחת. בשלב זה, את ה-DNA בדיקה יצרף פני האלקטרודה זהב דרך היווצרות של monolayer תיאול-on-זהב עצמית התאספו.
  6. לשטוף עם מים את האלקטרודות-DI, לטבול אותם 2mm mercaptohexanol בצינור Eppendorf ולאחסן אותם במקום חשוך למשך 3 שעות הלילה בטמפרטורת החדר כדי להבטיח היווצרות מלאה של monolayer התאספו עצמית. שלב זה כולל את mercaptohexanol כחלק monolayer מעורבת כדי להבטיח את היווצרות monolayer יציב. כדי למנוע אידוי מומלץ לאטום את האלקטרודה לתוך הצינור Eppendorf עם parafilm. חיישנים ניתן לאחסן את הפתרון הזה במשך כמה ימים אם יש צורך.
  7. כאשר אתה מוכן להשתמש בחיישן, לשטוף אותו עם DI-מים ואז להשרות אותו חיץ לפחות עשר דקות. חיישנים שמטרתן זיהוי הנוגדן חייב גם להיות שקוע בפתרון של 100 ננומטר של גדיל את ההכרה הרלוונטיים לפני השימוש, ואחריו מהיר מאוד לשטוף עם חיץ.

3. בדיקת חיישן לזיהוי DNA

  1. בפרוטוקול זה, גדיל 17 בדיקה נוקלאוטיד מודבקת אלקטרודות זהב. יש כתב כחול מתילן חמזור בסוף 3'שלה (איור 1). כאשר מולקולה בדיקה מכליא עם גדיל ללכוד, הנוכחי דרך המעגל חיישן פוחתת.
  2. לשטוף חיישן טרי עם DI-מים לטבול אותו ריקמדגם חסר היעד על מנת להקליט את אות הרקע שהיא מייצרת. חבר את חיישן להוביל את האלקטרודה העבודה של potentiostat. המקום מונה פלטינה אלקטרודה כסף / כסף כלורי הפניה אלקטרודה לתוך התמיסה.
  3. הפעל מדידה גל ריבועי בין 0 ל -0.6 V עם אמפליטודה של mV 25 וגודל הצעד של 1mV. תדירות אופטימלית גל מרובע יהיה תלוי בפרטים של ארכיטקטורת בדיקה 2,3; עבור ארכיטקטורות בדיקה השתמשנו בערכים אופטימליים הם בדרך כלל בטווח של 60 עד 600 הרץ. אתה צריך לראות לשיא מעוגלות בכ -0.35 V, פוטנציאל חיזור כחול מתילן (פוטנציאל שיא עשויים להשתנות מעט בהתאם pH המדויק של פתרון המבחן שלך). גובה מתחילת המחקר הנוכחי לשיא זו היא מידתית להעביר את יעילות אלקטרון בין הכחול מתילן ואת האלקטרודה זהב (Figure2). שמור המדידה ברקע.
  4. הזז את האלקטרודות לפתרון המכיל את מולקולת ה-DNA היעד של עניין, לאזן (5 עד 120 דקות בהתאם למבנה גודל, ריכוז target4, 5) וכן לאסוף voltammagram הגל השני מרובע. גובה השיא ב -0.35 V ישתנה מן המדידה, הרקע הראשוני. גודל השינוי הזה קשור ריכוז אנליטי. זה נתוני התפוקה העיקרית של חיישן זה (איור 3).
  5. מדידת שינוי אות יחסית, הירידה באחוז או הגדלת האות ביחס לשיא את הרקע, היא לעיתים קרובות יותר לשחזור מדידת שינוי מוחלט הנוכחית, כמו זו מתקנת עבור וריאציות באזור את פני השטח של האלקטרודה. כדי לעשות זאת, ההבדל בין זרם שיא השיא הנוכחי רקע מחולקים על ידי שיא הרקע הנוכחי.

4. חיישן התחדשות

  1. לאחר המדידות שלך מלא, הזז את החיישן לתוך מיכל מלא במים DI-30 עבור s, או להשפריץ את זה עם זרם קבוע של מים DI-30 s. חזור על פעולה זו עוד פעמיים עם מים deionized טריים. הערה: analytes כמה הם עמידים בפני גישה זו; להם לנסות אגרסיבי שטיפה ב hydrochloride 6 guanidine M או אתנול 70%.
  2. שים את חיישן בחזרה פתרון שבו יבוצעו מדידות. תוך דקה, את גובה שיא צריך לחזור לערכו המקורי. ראוי לציין כי חיישנים אלה מפגינים לעתים קרובות שינוי אות מעט גדול יותר במהלך המבחן הראשון שלהם מחזור התחדשות, והתוצאות עקביות מאוד במהלך המחזורים שלאחר מכן 6.

5. בדיקת חיישן לזיהוי נוגדנים

  1. בפרוטוקול זה, בדיקה DNA מתילן כחול ו-תיאול שונה בשימוש חיישנים אלה משמש גדיל "עוגן" 7. היא מחוברת ישירות האלקטרודה זהב. זו הכלאה ואז עם השנייה, גדיל הדנ"א "הכרה" כי כבר מצומדות קוולנטית אל האנטיגן הרלוונטי (איור 4). היו לנו מזל עם בתים סינתזה מסחריים, כגון Biosearch טכנולוגיות Panagene, לסינתזה של DNA-אנטיגן מפלצות הצורך. צעד הכלאה מתבצעת על ידי העברת חיישן מראש מפוברק לתוך צינור Eppendorf המכיל 100 ננומטר של גדיל הדנ"א הרלוונטי הכרה PBS שעה 1.
  2. מניחים את החיישן בפתרון ריק הרלוונטיים. צרף את זה כדי להוביל את האלקטרודה העבודה של potentiostat ובמקום מונה פלטינה אלקטרודה וכסף / אלקטרודה כסף התייחסות כלוריד לתוך התמיסה.
  3. בצע voltammetry גל ריבועי כמתואר לעיל. עבור ארכיטקטורת בדיקה מסוימת השתמשנו כאן את התדר האופטימלי גל מרובע הוא 60 הרץ. אתה צריך לראות לשיא מעוגלות סביב -0.35 V. שמור המדידה ברקע.
  4. מעבירים את האלקטרודות לפתרון אנליטי המכיל את היעד, דגירה של 5 דקות עד 60, וכן לאסוף voltammagram הגל השני מרובע. אם היעד הוא נוגדן להציג את השיא ב -0.35 V תפחת. גודל השינוי הזה קשור ריכוז נוגדן.

6. בדיקת חיישן לזיהוי מולקולה קטנה

  1. במקרה זה, המולקולה החללית על פני החיישן הוא aptamer, ה-DNA או RNA מולקולה כי נבחרה במבחנה לקשור אנליטי מולקולרית ספציפית, כי השינויים במבנה שלה (קפלים) על כבילת אנליטי היעד שלה 8,9 ( איור 5). כאן אנחנו מעסיקים קוקאין מחייב, aptamer דנ"א שפותח על ידי המעבדה 10,11 Stojanovic.
  2. לשטוף חיישן טרי עם DI-מים לטבול אותו מדגם ריק חסר היעד על מנת להקליט את אות הרקע שהיא מייצרת. חבר את חיישן להוביל את האלקטרודה העבודה של potentiostat. המקום מונה פלטינה התייחסות כסף / כסף כלורי לתוך התמיסה.
  3. בצע voltammetry גל ריבועי כמתואר לעיל. עבור ארכיטקטורת בדיקה מסוימת השתמשנו כאן את התדר האופטימלי גל מרובע הוא 200Hz (אבל 60 הרץ גם עובד). אתה צריך לראות לשיא מעוגלות סביב -0.35 V. שמור המדידה ברקע.
  4. מעבירים את האלקטרודות לפתרון אנליטי המכיל את היעד, דגירה של 5 דקות ~, ולאסוף voltammagram הגל השני מרובע. גובה השיא ב -0.35 V ישתנה. גודל השינוי הזה קשור ריכוז אנליטי היעד. אם אתה לא יכול לקבל מדגם קוקאין, פרוקאין, השימוש אשר אינה מוסדרת, יכול לשמש כתחליף.

7. נציג תוצאות:

כאשר נעשה שימוש כדי לזהות DNA באמצעות ארכיטקטורה הראשונה, האות צריך ירידה של לפחות 60% כאשר equilibrated למטרה 200 ננומטר. לאחר שלוש שטיפות קצרה במים deionized, האות צריך לחזור קרוב מאוד (בטווח% 0.1-5) לערכו המקורי. חיישנים לגילוי נוגדנים צריך לעבור ירידה אות של 40% ל -80. Aptamer מבוססי חיישנים לגילוי של קוקאין התערוכה עלייה אות של עד 200% בהתאם כיסוי תדירות פני השטח שבו הם פועלים. עבור החיישן קוקאין, כיסוי השטח נמוכה היא הטובה ביותר 3.

איור 1
באיור 1. איתור של ה-DNA עם biosensor DNA אלקטרוכימיים.

איור 2
2. איור צילום מסך המציג את האות המיוצר על ידי biosensor E-DNA במהלך voltammetry גל מרובע.

איור 3
3. איור צילום מסך המציג את האותות המיוצרים על ידי biosensor E-DNA במהלך voltammetry גל מרובע, לפני ואחרי הכלאה עם אנליטי.

איור 4
איור 4. איתור של נוגדנים עם biosensor פיגום.

איור 5
איור 5. איתור של קוקאין או פרוקאין עם biosensor אלקטרוכימי aptamer.

אישית אוליגו רצף תגובות
לינארי בדיקה DNA (LP17) 5'-HS-(CH2) 6 TGGATCGGCGTTTTATT-(CH2) 7-NH-MB-3 " HPLC מטוהרים, ניתן להזמין עם אס
אנליטי יעד DNA AATAAAACGCCGATCCA ללא שינוי
הכרה סטרנד 5'-Antigen-TEG-CAGTGGCGTTTTATTCTTGTTACTG-3 "
הפיגום עוגן 5'-HS-(CH 2) 6 GCAGTAACAAGAATAAAACGC CACTGC-(CH 2) 7 MB HPLC מטוהרים, ניתן להזמין עם אס
A4 קוקאין aptamer 5'-HS-AGACAAGGAAAATCCTTCAATGAAGTGGGTCG-MethyleneBlue-3 " HPLC מטוהרים, ניתן להזמין עם אס

טבלה 1. בדיקה ו-DNA רצפים היעד.

Discussion

הערה חשובה היא שאף אחד הניסויים שתוארו לעיל יפעל כראוי אלא אם כן את האלקטרודות נוקו כראוי. הנה מדריך הנוהל שלנו ניקוי אלקטרוכימי. כאשר עובדים עם potentiostats CH מכשירים, גמר את השלבים לניקוי באמצעות סט של שלוש תוכניות מאקרו.

שלב אפס (E-נקי O)
לטבול את האלקטרודות 0.5MH 2 SO 4 ולחבר אותם אלקטרודות העבודה של potentiostat. כמו כן לצרף לטבול התייחסות Ag / AgCl ו לדלפק אלקטרודה פלטינה. התחל עם צעד חמצון (2 V עבור 5 ים) ולאחר מכן צעד הפחתה (0.35 V עבור 10 ות).

שלב ראשון (E-נקי 1)
ליזום חמצון סריקות הפחתה בתנאים חומציים זהה (0.5MH 2 SO 4) 0.35-1.5 V (20 סריקות בקצב סריקה של 4 V / s ו מרווח דגימה של 0.01 V, ואחריהם ארבעה סריקות בקצב סריקה של 0.1 V / s ו מרווח מדגם V 0.01).

שלב שני (E-נקי 2)
ניהול קבוצה נוספת של חמצון אלקטרוכימיים וסריקות הפחתה בתנאים חומציים (0.01 מ 'KCl/0.1 MH 2 SO 4) כיסוי four טווחי פוטנציאל שונים (ביצע כל בקצב סריקה של 0.1 V s 1 ו מרווח דגימה של 0.01 V עבור 10 מקטעים ): (i) טווח הפוטנציאל בין 0.2 ל V 0.75 (ii) טווח הפוטנציאל 0.2-1.0 V (iii) טווח הפוטנציאל של 0.2 עד 1.25 V; (iv) טווח הפוטנציאל 0.2-1.5 V.

סוגים רבים של אלקטרודות זהב ניתן להשתמש כדי לנהל ניסויים אלו. בנוסף אלקטרודות דיסק זהב כמו המועסקים כאן, יש לנו הצלחה עם משטחים זהב microfabricated, חוטי זהב, זהב על מעגלים מודפסים.

יחד עם חיישנים המתואר במאמר זה, רבים אחרים biosensor אלקטרוכימיים ארכיטקטורות DNA דווחו. זה כולל חיישנים עם pseudoknot 12, גדיל משולש 13, 14 כריך, כריך סופר 15, או 16 טריפלקס אדריכלות.

בעתיד, אנו צופים כי חיישנים אלה ישמשו נקודת אבחון טיפול רפואי. הם השתלבו בהצלחה לתוך מכשירים microfluidic מספר 17,18, ומציעים יתרונות רבים על פני מערכות זיהוי אופטי אנליטי. בפרט, חיישנים אלה יכולים לתפקד עכור, סמיך מאוד אופטית אוטומטית פלורסנט דגימות.

Disclosures

אין מה לגלות.

Acknowledgments

עבודה זו מומנה על ידי מענק (OPP1015402) של ביל ומלינדה גייטס באמצעות יוזמת חקירות אתגרים גרנד, ועל ידי ה-NIH באמצעות מענקים GM062958-01 ו 2R01EB002046. עבודה זו בוצעה כחלק בחסות מחלקת האנרגיה של ארה"ב על ידי המעבדה הלאומית לורנס ליברמור תחת חוזה DE-AC52-07NA27344.

Materials

Name Company Catalog Number Comments
Gold Disk Electrodes CH Instruments, Inc. CHI101 Can be re-used
Synthetic Probe DNA Biosearch Technologies Custom
Synthetic Target DNA Sigma-Aldrich Custom
Mercaptohexanol Sigma-Aldrich 725226-1G Store in cool dark place
Platinum Electrode BASi MW-1032 Can be re-used
Ag/AgCl Reference BASi MF-2052 Can be re-used
Polishing Cloth Buehler 40-7212
Alumina Polish Buehler 40-6325-016
Phosphate buffered saline Buffer, pH 7.4 Sigma-Aldrich P7059-1L
CH Instruments 605A CH Instruments, Inc. 605A Use any potentiostat
Newborn Calf Serum Sigma-Aldrich N4637-500ML Stored frozen
NanoDrop Fisher Scientific ND-2000 Use any UV-Vis
PCR Mix Bio-Rad 170-8862 Stored frozen
Cocaine Sigma-Aldrich C5776 DEA License Required
Procaine Sigma-Aldrich P9879 Substitute for Cocaine
Anti-Flag Antibody Sigma-Aldrich F1804-1mg

DOWNLOAD MATERIALS LIST

References

  1. Xiao, Y., Lai, R. Y., Plaxco, K. W. Preparation of electrode-immobilized, redox-modified oligonucleotides for electrochemical DNA and aptamer-based sensing. Nat. Protocols. 2, 2875-2880 (2007).
  2. Ricci, F., Lai, R. Y., Heeger, A. J., Plaxco, K. W., Sumner, J. J. Effect of Molecular Crowding on the Response of an Electrochemical DNA Sensor. Langmuir. 23, 6827-6834 (2007).
  3. White, R. J., Phares, N., Lubin, A. A., Xiao, Y., Plaxco, K. W. Optimization of Electrochemical Aptamer-Based Sensors via Optimization of Probe Packing Density and Surface Chemistry. Langmuir. 24, 10513-10518 (2008).
  4. Lubin, A. A., Vander Stoep Hunt, B., White, R. J., Plaxco, K. W. Effects of Probe Length, Probe Geometry, and Redox-Tag Placement on the Performance of the Electrochemical E-DNA Sensor. Analytical Chemistry. 81, 2150-2158 (2009).
  5. Lubin, A. A., Plaxco, K. W. Folding-Based Electrochemical Biosensors: The Case for Responsive Nucleic Acid Architectures. Accounts of Chemical Research. 43, 496-505 (2010).
  6. Lubin, A. A., Lai, R. Y., Baker, B. R., Heeger, A. J., Plaxco, K. W. Sequence-Specific, Electronic Detection of Oligonucleotides in Blood, Soil, and Foodstuffs with the Reagentless, Reusable E-DNA Sensor. Analytical Chemistry. 78, 5671-5677 (2006).
  7. Cash, K. J., Ricci, F., Plaxco, K. W. An Electrochemical Sensor for the Detection of Protein?Small Molecule Interactions Directly in Serum and Other Complex Matrices. Journal of the American Chemical Society. 131, 6955-6957 (2009).
  8. Baker, B. R. An Electronic, Aptamer-Based Small-Molecule Sensor for the Rapid, Label-Free Detection of Cocaine in Adulterated Samples and Biological Fluids. Journal of the American Chemical Society. 128, 3138-3139 (2006).
  9. Ferapontova, E. E., Olsen, E. M., Gothelf, K. V. An RNA Aptamer-Based Electrochemical Biosensor for Detection of Theophylline in Serum. Journal of the American Chemical Society. 130, 4256-4258 (2008).
  10. Stojanovic, M. N., Landry, D. W. Aptamer-Based Colorimetric Probe for Cocaine. Journal of the American Chemical Society. 124, 9678-9679 (2002).
  11. Stojanovic, M. N., Prada, P. de, Landry, D. W. Aptamer-Based Folding Fluorescent Sensor for Cocaine. Journal of the American Chemical Society. 123, 4928-4931 (2001).
  12. Cash, K. J., Heeger, A. J., Plaxco, K. W., Xiao, Y. Optimization of a Reusable, DNA Pseudoknot-Based Electrochemical Sensor for Sequence-Specific DNA Detection in Blood Serum. Analytical Chemistry. 81, 656-661 (2009).
  13. Xiao, Y. An Electrochemical Sensor for Single Nucleotide Polymorphism Detection in Serum Based on a Triple-Stem DNA Probe. Journal of the American Chemical Society. 131, 15311-15316 (2009).
  14. Zuo, X., Xiao, Y., Plaxco, K. W. High Specificity, Electrochemical Sandwich Assays Based on Single Aptamer Sequences and Suitable for the Direct Detection of Small-Molecule Targets in Blood and Other Complex Matrices. Journal of the American Chemical Society. 131, 6944-6945 (2009).
  15. Xia, F. An Electrochemical Supersandwich Assay for Sensitive and Selective DNA Detection in Complex Matrices. Journal of the American Chemical Society. 132, 14346-14348 (2010).
  16. Patterson, A. Using Triplex-Forming Oligonucleotide Probes for the Reagentless, Electrochemical Detection of Double-Stranded DNA. Analytical Chemistry. 82, 9109-9115 (2010).
  17. Ferguson, B. S. Integrated Microfluidic Electrochemical DNA Sensor. Analytical Chemistry. 81, 6503-6508 (2009).
  18. Swensen, J. S. Continuous, Real-Time Monitoring of Cocaine in Undiluted Blood Serum via a Microfluidic, Electrochemical Aptamer-Based Sensor. Journal of the American Chemical Society. 131, 4262-4266 (2009).
המצאה של אלקטרוכימי-DNA Biosensors לגילוי Reagentless של חומצות, חלבונים ומולקולות קטנות גרעין
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rowe, A. A., White, R. J., Bonham, A. J., Plaxco, K. W. Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules. J. Vis. Exp. (52), e2922, doi:10.3791/2922 (2011).More

Rowe, A. A., White, R. J., Bonham, A. J., Plaxco, K. W. Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules. J. Vis. Exp. (52), e2922, doi:10.3791/2922 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter