Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

विद्युत रासायनिक डीएनए Biosensors के न्यूक्लिक एसिड, प्रोटीन और छोटे अणुओं के Reagentless पता लगाने के लिए निर्माण कार्य

doi: 10.3791/2922 Published: June 1, 2011

Summary

"ई - डीएनए" सेंसर reagentless, विद्युत biosensors है कि अच्छी तरह से भी प्रदर्शन जब रक्त और अन्य जटिल matrices में सीधे चुनौती दी, nucleic एसिड, प्रोटीन और छोटे अणु analytes की एक विस्तृत श्रृंखला का पता लगाने के के लिए अनुकूलित किया गया है. यहाँ हम और इस तरह के सेंसर का निर्माण और उपयोग के लिए एक सामान्य प्रक्रिया मौजूद है.

Abstract

के रूप में दवा वर्तमान में प्रचलित है, डॉक्टरों ने परीक्षण के लिए एक केंद्रीय प्रयोगशाला नमूनों भेजने के लिए और इस तरह घंटे या दिन प्रतीक्षा करने के लिए परिणाम प्राप्त करना चाहिए. कई रोगियों को बेहतर तेजी, बिस्तर परीक्षण द्वारा कार्य किया जाएगा. यह अंत करने के लिए हमारी प्रयोगशाला और दूसरों के लिए एक बहुमुखी, reagentless biosensor मंच है कि मात्रात्मक, reagentless, न्यूक्लिक एसिड (डीएनए, शाही सेना), प्रोटीन (एंटीबॉडी सहित) और unprocessed नैदानिक ​​और पर्यावरणीय नमूनों में सीधे छोटे अणुओं analytes की विद्युत का पता लगाने का समर्थन करता है विकसित किया है. इस वीडियो में, हम और इस "ई - डीएनए" वर्ग में कई biosensors की तैयारी का उपयोग प्रदर्शित करता है. विशेष रूप में, हम बनाना और एक पोलीमरेज़ चेन रिएक्शन मिश्रण, एक एचआईवी विशिष्ट एंटीबॉडी और दवा कोकीन में एक लक्ष्य डीएनए अनुक्रम का पता लगाने के के लिए सेंसर का प्रदर्शन. तैयार करने की प्रक्रिया में केवल तीन घंटे की आवश्यकता हाथ पर एक रात ऊष्मायन द्वारा पीछा प्रयास, और उनके उपयोग के केवल कुछ मिनट की आवश्यकता है.

Protocol

1. स्टेज स्थापना

  1. प्रासंगिक, रासायनिक संशोधित जांच डीएनए Biosearch टेक्नोलॉजीज (Novato, CA) या मिडलैंड प्रमाणित (Midland, TX) के रूप में एक कस्टम oligonucleotide संश्लेषण कंपनी से खरीद. जांच संश्लेषण के दौरान अपने 3'-अंत में एक C6 thiol के अलावा और अपनी 5'-अंत में एक redox सक्रिय methylene नीले द्वारा संशोधित किया गया है.
  2. फॉस्फेट में डीएनए जांच भंग 200 सुक्ष्ममापी की एकाग्रता के लिए खारा 7.4 पीएच buffered और 260 एनएम पर एक स्पेक्ट्रोफोटोमीटर का उपयोग कर अपनी absorbance को मापने के द्वारा अपनी एकाग्रता को सत्यापित. डीएनए जांच पर methylene नीले आधा भाग के कारण समाधान एक दृश्य नीले रंग का होना चाहिए.
  3. हौसले से आसुत, विआयनीकृत जल (डि - पानी) में एक (2 - carboxyethyl) tris phosphine TCEP 10 मिमी समाधान के 1 एमएल तैयार. हमारे अनुभव में, इन TCEP समाधान एक सप्ताह के लिए ताजा रहता है जब 4 डिग्री सेल्सियस पर अंधेरे में संग्रहीत
  4. किसी भी डाइसल्फ़ाइड बांड कि जांच डीएनए समाधान में मौजूद हो सकता है कम करने के लिए, TCEP समाधान के 2 μL जांच डीएनए शेयर समाधान के साथ 1 μL गठबंधन और एक विंदुक के साथ धीरे मिश्रण. एक काले, प्रशीतित कंटेनर में एक घंटे के लिए मिश्रण को सेते हैं. शुरू में नीले समाधान स्पष्ट हो के रूप में TCEP reversibly methylene नीले रंग कम कर देता है चाहिए. यदि समाधान स्पष्ट नहीं हो जाता है, एक ताजा TCEP समाधान का उपयोग कर प्रक्रिया दोहराने, या संभवतः कमरे के तापमान पर.
  5. एक घंटे के बाद बफर के 1 एमएल के साथ कम डीएनए जांच के समाधान जलमिश्रित, यह 200nM की एकाग्रता को कमजोर होगी. बाद में, आप इस पतला जांच के समाधान के 200 μL भागों में सोने डिस्क इलेक्ट्रोड का एक सेट सेते जाएगा.
  6. हौसले फॉस्फेट में 2mm mercaptohexanol के कम से कम 2 एमएल तैयार खारा buffered.

2. सेंसर तैयार

  1. एक ठीक चमकाने के कपड़े पर 0.05 माइक्रोन पानी के साथ एल्यूमिना पाउडर का मिश्रण. सोने की सतह गीले कपड़े में मजबूती, दबाव और उन्हें एक आंकड़ा बढ़ इलेक्ट्रोड के अनुसार लगभग तीन मिनट के लिए आठ पैटर्न से पोलिश सोने डिस्क इलेक्ट्रोड (सीएच उपकरण, ऑस्टिन, TX) का एक सेट.
  2. डि - पानी के साथ पॉलिश इलेक्ट्रोड कुल्ला और उन्हें Eppendorf ट्यूब उसी के साथ भरा में विसर्जित कर दिया. पांच मिनट के लिए Sonicate के लिए किसी भी अवशिष्ट एल्यूमिना पाउडर निकालने.
  3. एक 0.5 एम सल्फ्यूरिक एसिड समाधान में इलेक्ट्रोड प्लेस, उन्हें एक प्लैटिनम काउंटर और चांदी / चांदी क्लोराइड संदर्भ इलेक्ट्रोड के साथ potentiostat देते और voltammograms की एक श्रृंखला है oxidize के लिए, कम करने, और electrochemically उनके सतहों को साफ चलाते हैं. के बाद यह 0.1 एम सल्फ्यूरिक एसिड में 0.01 एम KCl के समाधान में एक दूसरे विद्युत सफाई प्रदर्शन. इन प्रक्रियाओं की सफाई ठीक विवरण हमारी प्रकृति प्रोटोकॉल एक कागज में, और इस वीडियो के लिए पूरक में पाया जा सकता है.
  4. एक रैक में 2 एमएल Eppendorf ट्यूबों का एक सेट व्यवस्था और जांच डीएनए समाधान के 200 μL के साथ प्रत्येक को भरने. संवेदक सतह पर जो जांच DNAs पैक के साथ इस समाधान में डीएनए जांच की एकाग्रता घनत्व को परिभाषित करेगा. सेंसर प्रदर्शन इष्टतम एक सेंसर वास्तुकला से अगले करने के लिए अलग घनत्व के साथ, दृढ़ता से जांच घनत्व पर निर्भर है. जांच के इस कदम पर इस्तेमाल किया एकाग्रता इस प्रकार 2 सेंसर के प्रत्येक नए प्रकार के लिए अनुकूलित किया जाना चाहिए. जांच आर्किटेक्चर हम तारीख करने के लिए जांच की है के लिए, जांच डीएनए सांद्रता हम इस कदम रेंज में 15 एनएम से 2 सुक्ष्ममापी 200 एनएम के साथ एक ठेठ मूल्य जा रहा है, रोजगार.
  5. डि - पानी के साथ सोने डिस्क इलेक्ट्रोड कुल्ला, और फिर एक घंटे के लिए एक Eppendorf ट्यूब में प्रासंगिक जांच डीएनए समाधान में उन्हें विसर्जित. इस बिंदु पर जांच डीएनए thiol पर सोने की एक आत्म इकट्ठे monolayer के गठन के माध्यम से सोने इलेक्ट्रोड सतह के लिए देते हैं जाएगा.
  6. डि पानी के साथ इलेक्ट्रोड कुल्ला करने के लिए, उन्हें 2mm mercaptohexanol में एक Eppendorf ट्यूब में विसर्जित 3 घंटे के लिए एक अंधेरे कमरे के तापमान पर रातोंरात के लिए जगह में उन्हें स्टोर करने के लिए आत्म इकट्ठे monolayer की पूरी गठन सुनिश्चित. यह कदम एक मिश्रित monolayer के भाग के रूप में mercaptohexanol शामिल एक स्थिर monolayer के गठन को सुनिश्चित करने. वाष्पीकरण को रोकने के लिए आप Eppendorf ट्यूब में parafilm के साथ इलेक्ट्रोड सील करना चाहते हो सकता है. सेंसर यदि आवश्यक हो तो कई दिनों के लिए इस समाधान में संग्रहीत किया जा सकता है.
  7. जब आप सेंसर का उपयोग करने के लिए तैयार कर रहे हैं, यह डि पानी से कुल्ला और फिर कम से कम दस मिनट के लिए बफर में यह सोख. एंटीबॉडी का पता लगाने के उद्देश्य से सेंसर भी प्रासंगिक मान्यता भूग्रस्त के एक 100 एनएम से पहले समाधान का उपयोग करने के लिए एक अत्यंत जल्दी बफर के साथ कुल्ला द्वारा पीछा में डूब जाना चाहिए.

3. सेंसर परीक्षण, डीएनए जांच

  1. इस प्रोटोकॉल में, एक 17 nucleotide जांच कतरा एक सोने की इलेक्ट्रोड पर चिपका है. यह अपने 3'-अंत में एक methylene नीले redox रिपोर्टर (चित्रा 1) है. जब जांच अणु के साथ एक पर कब्जा कतरा hybridizes, सेंसर सर्किट के माध्यम से वर्तमान घट जाती है.
  2. डि - पानी के साथ एक ताजा सेंसर कुल्ला और एक रिक्त में विसर्जितनमूना लक्ष्य की कमी के क्रम में यह उत्पादन पृष्ठभूमि संकेत रिकॉर्ड. काम potentiostat के इलेक्ट्रोड नेतृत्व करने के लिए सेंसर संलग्न. एक प्लैटिनम काउंटर इलेक्ट्रोड और समाधान में एक चांदी / चांदी क्लोराइड संदर्भ इलेक्ट्रोड प्लेस.
  3. एक वर्ग तरंग 0 से 25 एम वी के एक आयाम और 1mV के एक कदम के आकार के साथ -0.6 वी माप चलाएँ. इष्टतम वर्ग तरंग आवृत्ति जांच 2,3 वास्तुकला के विवरण पर निर्भर करेगा, जांच आर्किटेक्चर के लिए हम इष्टतम मूल्यों कार्यरत है 60 रेंज में आम तौर पर 600 हर्ट्ज हैं. आप -0.35 लगभग वी, methylene नीले रंग के redox संभावित (पीक क्षमता थोड़ा बदलाव कर सकते हैं अपने परीक्षण समाधान के सटीक पीएच पर निर्भर करता है) पर एक गोल चोटी देखना चाहिए. इस पीक करने के लिए वर्तमान आधारभूत से ऊंचाई methylene नीले और सोने इलेक्ट्रोड (Figure2) के बीच दक्षता इलेक्ट्रॉन हस्तांतरण करने के लिए आनुपातिक है. इस पृष्ठभूमि माप सहेजें.
  4. एक समाधान है कि ब्याज के लक्ष्य डीएनए अणु होते हैं करने के लिए इलेक्ट्रोड हटो, (5 करने के लिए 120 मिनट, आकार, और 5, target4 की संरचना और एकाग्रता पर निर्भर करता है) संतुलित और एक दूसरे वर्ग तरंग voltammagram इकट्ठा. -0.35 वी में चोटी की ऊंचाई प्रारंभिक, पृष्ठभूमि माप से बदल जाएगा. इस परिवर्तन के परिमाण analyte की एकाग्रता से संबंधित है. यह इस सेंसर के मुख्य उत्पादन डेटा (चित्रा 3) है.
  5. मापने रिश्तेदार संकेत बदलने के लिए, प्रतिशत कमी या पृष्ठभूमि पीक करने के लिए सापेक्ष संकेत में वृद्धि, अक्सर इलेक्ट्रोड की सतह क्षेत्र में बदलाव के लिए इस corrects के रूप में, वर्तमान में पूर्ण परिवर्तन को मापने की तुलना में अधिक प्रतिलिपि प्रस्तुत करने योग्य है. ऐसा करने के लिए चोटी वर्तमान और पृष्ठभूमि शिखर वर्तमान के बीच अंतर पृष्ठभूमि वर्तमान शिखर द्वारा विभाजित कर रहे हैं.

4. सेंसर पुनर्जनन

  1. एक बार अपने माप को पूरा कर रहे हैं, एक 30 के लिए डि पानी से भरा कंटेनर में सेंसर ले जाने के लिए, या एस के लिए 30 धार डि पानी की एक सतत स्ट्रीम के साथ ताजा विआयनीकृत जल के साथ इस दो से अधिक बार दोहराएँ. नोट: कुछ analytes इस दृष्टिकोण के लिए प्रतिरोधी रहे हैं, के लिए उन्हें आक्रामक 6 एम guanidine हाइड्रोक्लोराइड या 70% इथेनॉल में rinsing कोशिश.
  2. सेंसर जहां मापन किया जाएगा एक समाधान में वापस रखो. एक मिनट के भीतर, पीक ऊंचाई अपने मूल मूल्य के लिए लौट आना चाहिए. यह देखते हुए कि इन सेंसरों अक्सर एक्ज़िबिट अपनी पहली परीक्षण और उत्थान चक्र के दौरान एक थोड़ा बड़ा संकेत बदलने के लिए, और बाद के छह चक्र के दौरान अत्यधिक अनुरूप परिणाम के लायक है.

5. सेंसर परीक्षण एंटीबॉडी जांच

  1. इस प्रोटोकॉल में, methylene नीले और thiol संशोधित डीएनए जांच इन सेंसरों में इस्तेमाल किया एक "लंगर" 7 भूग्रस्त के रूप में कार्य करता है. यह सीधे सोने इलेक्ट्रोड से जुड़ा हुआ है. यह तो एक दूसरा, "मान्यता" डीएनए भूग्रस्त है कि प्रासंगिक प्रतिजन (चित्रा 4) के लिए covalently संयुग्मित किया गया है के साथ संकरित है. हम Biosearch टेक्नोलॉजीज और Panagene जैसे वाणिज्यिक संश्लेषण घरों, के साथ अच्छे भाग्य किया है, जरूरत डीएनए प्रतिजन chimeras के संश्लेषण के लिए. संकरण कदम बाहर एक Eppendorf पीबीएस में प्रासंगिक मान्यता डीएनए भूग्रस्त के 1 घंटे के लिए 100 एनएम युक्त ट्यूब में एक पूर्व निर्मित सेंसर स्थानांतरित द्वारा किया जाता है.
  2. प्रासंगिक रिक्त समाधान में सेंसर रखें. यह काम कर रहे एक potentiostat के इलेक्ट्रोड का नेतृत्व करने के लिए संलग्न है और एक प्लैटिनम काउंटर और समाधान में चांदी / चांदी क्लोराइड संदर्भ इलेक्ट्रोड इलेक्ट्रोड जगह.
  3. वर्ग तरंग voltammetry प्रदर्शन के रूप में ऊपर वर्णित है. विशेष जांच वास्तुकला के लिए हम यहाँ कार्यरत है इष्टतम वर्ग तरंग 60 हर्ट्ज आवृत्ति है. आप -0.35 चारों ओर एक गोल चोटी देख वी. इस पृष्ठभूमि माप सहेजें चाहिए.
  4. इलेक्ट्रोड युक्त समाधान लक्ष्य analyte के लिए स्थानांतरण करने के लिए, 5 से 60 मिनट के लिए सेते हैं, और एक दूसरे वर्ग लहर voltammagram इकट्ठा. यदि लक्ष्य एंटीबॉडी मौजूद है -0.35 वी पर चोटी में कमी होगी. इस परिवर्तन के परिमाण एंटीबॉडी एकाग्रता से संबंधित है.

6. सेंसर परीक्षण, लघु अणु जांच

  1. इस मामले में, संवेदक सतह पर जांच अणु एक aptamer है, एक डीएनए या शाही सेना अणु है कि इन विट्रो में चयनित किया गया है करने के लिए अपने लक्ष्य 8,9 analyte के लिए बाध्य पर एक विशिष्ट आणविक analyte है, कि इसकी संरचना में परिवर्तन ( परतों) बाइंड ( चित्रा 5). यहाँ हम एक कोकीन बाध्यकारी, डीएनए Stojanovic 10,11 प्रयोगशाला द्वारा विकसित aptamer रोजगार.
  2. डि - पानी के साथ एक ताजा सेंसर कुल्ला और यह एक खाली लक्ष्य की कमी के क्रम में यह उत्पादन पृष्ठभूमि संकेत रिकॉर्ड नमूना में विसर्जित. काम potentiostat के इलेक्ट्रोड नेतृत्व करने के लिए सेंसर संलग्न. एक प्लैटिनम काउंटर और चांदी / चांदी के समाधान में क्लोराइड संदर्भ रखें.
  3. वर्ग तरंग voltammetry प्रदर्शन के रूप में ऊपर वर्णित है. विशेष जांच वास्तुकला हम यहाँ कार्यरत है के लिए इष्टतम वर्ग तरंग आवृत्ति 200Hz है (लेकिन 60 हर्ट्ज भी) काम करता है. आप -0.35 चारों ओर एक गोल चोटी देख वी. इस पृष्ठभूमि माप सहेजें चाहिए.
  4. एक लक्ष्य analyte युक्त समाधान के लिए इलेक्ट्रोड स्थानांतरण करने के लिए ~ 5 मिनट के लिए सेते हैं, और एक दूसरे वर्ग लहर voltammagram इकट्ठा. -0.35 वी में चोटी की ऊंचाई बदल जाएगा. इस परिवर्तन के परिमाण लक्ष्य analyte की एकाग्रता से संबंधित है. यदि आप एक कोकीन नमूना, procaine नहीं प्राप्त कर सकते हैं, उपयोग, जिनमें से अनियमित है, एक विकल्प के रूप में इस्तेमाल किया जा सकते हैं.

7. प्रतिनिधि परिणाम:

जब पहली वास्तुकला का उपयोग करने के लिए डीएनए का पता लगाने के लिए प्रयोग किया जाता है, संकेत कम से कम 60% से कम करना चाहिए जब 200 एनएम लक्ष्य पर equilibrated है. विआयनीकृत जल में तीन संक्षिप्त rinses के बाद, संकेत बहुत करीब अपने मूल मूल्य (0.1-5% के भीतर) वापस आ जाना चाहिए. एंटीबॉडी का पता लगाने सेंसर 40 से 80% के एक संकेत की कमी से गुजरना चाहिए. कोकीन का पता लगाने के लिए aptamer आधारित सेंसर संकेत 200% तक की वृद्धि आवृत्ति और सतह के कवरेज है, जिस पर वे काम के आधार पर प्रदर्शन. कोकीन संवेदक के लिए, एक कम सतह कवरेज सबसे अच्छा है 3.

चित्रा 1
1 चित्रा डीएनए के एक विद्युत रासायनिक डीएनए biosensor के साथ जांच .

चित्रा 2
चित्रा स्क्रीन 2. शॉट वर्ग की लहर voltammetry के दौरान एक ई - डीएनए biosensor द्वारा उत्पादित संकेत दिखा .

चित्रा 3
चित्रा स्क्रीन 3. वर्ग की लहर voltammetry के दौरान एक ई - डीएनए biosensor द्वारा उत्पादित संकेतों के पहले और बाद में एक analyte के साथ संकरण, शॉट दिखा.

चित्रा 4
चित्रा 4 एक पाड़ biosensor के साथ एंटीबॉडी की जांच .

चित्रा 5
चित्रा 5 कोकीन या एक विद्युत aptamer biosensor साथ procaine की जांच.

कस्टम oligo अनुक्रम टिप्पणियाँ
रैखिक जांच डीएनए (LP17) 5'-एच एस (CH2) 6 - TGGATCGGCGTTTTATT (CH2) 7 राष्ट्रीय राजमार्ग MB-3 ' HPLC शुद्ध, एसएस के साथ आदेश दिया जा सकता है
लक्ष्य analyte डीएनए AATAAAACGCCGATCCA असंशोधित
मान्यता Strand 5'-एंटीजन - तेग - CAGTGGCGTTTTATTCTTGTTACTG-3 '
पाड़ एंकर 5'-एच एस (सीएच 2) 6 - GCAGTAACAAGAATAAAACGC CACTGC (सीएच 2) 7 एमबी HPLC शुद्ध, एसएस के साथ आदेश दिया जा सकता है
A4 कोकीन aptamer 5'-HS-AGACAAGGAAAATCCTTCAATGAAGTGGGTCG - MethyleneBlue-3 ' HPLC शुद्ध, एसएस के साथ आदेश दिया जा सकता है

तालिका 1. जांच और लक्ष्य डीएनए अनुक्रम.

Discussion

एक महत्वपूर्ण ध्यान दें कि ऊपर वर्णित प्रयोगों में से कोई भी ठीक से काम जब तक इलेक्ट्रोड ठीक से साफ कर दिया है. यहाँ हमारे विद्युत सफाई की प्रक्रिया के लिए एक गाइड है. जब दर्पण उपकरण potentiostats के साथ काम कर रहे हैं, हम इन सफाई तीन मैक्रो कार्यक्रमों का एक सेट चरणों का उपयोग कर चलाते हैं.

शून्य चरण (हे ई - स्वच्छ)
2 0.5MH अतः 4 में इलेक्ट्रोड को विसर्जित और उन्हें एक potentiostat का काम कर रहे इलेक्ट्रोड से कनेक्ट . इसके अलावा देते हैं और एक संदर्भ एजी / AgCl और प्लैटिनम काउंटर इलेक्ट्रोड विसर्जित कर दिया. एक ऑक्सीकरण कदम (2 के लिए 5 वी) और फिर कमी कदम (10 एस के लिए 0.35 वी) के साथ शुरू करो.

चरण एक (1 ई - स्वच्छ)
0,35 करने के लिए 1,5 वी (4 वी / s स्कैन दर पर 20 स्कैन और वी 0.01 का एक नमूना अंतराल, एक स्कैन दर पर चार स्कैन के द्वारा पीछा से ही अम्लीय शर्तों (0.5MH 2 अतः 4) के तहत ऑक्सीकरण और कमी स्कैन प्रारंभ करें 0.1 वी / s और 0.01 वी के एक नमूना अंतराल के).

चरण दो (2 ई - स्वच्छ)
अम्लीय शर्तों (0.01 एम KCl/0.1 2 महाराष्ट्र अतः 4) चार अलग अलग क्षमता पर्वतमाला (स्कैन दर 0.1 वी एस 1 और 0.01 वी के एक नमूना अंतराल पर सभी 10 क्षेत्रों के लिए प्रदर्शन को कवर के तहत विद्युत ऑक्सीकरण और कमी स्कैन का एक और सेट आचरण ): (i) 0.2 से 0.75 वी करने के लिए संभावित रेंज, (ii) 0.2 से 1.0 वी के लिए संभावित रेंज, (iii) 0.2 से 1.25 वी करने के लिए संभावित रेंज, (iv) 0.2 से 1.5 के लिए संभावित रेंज वी.

सोने के इलेक्ट्रोड के कई प्रकार के इन प्रयोगों का संचालन करने के लिए इस्तेमाल किया जा सकता है. यहाँ कार्यरत उन के रूप में सोने डिस्क इलेक्ट्रोड के अलावा, हम microfabricated सोने सतहों, सोने के तार, और मुद्रित सर्किट बोर्डों पर सोने के साथ सफलता मिली है.

इस पत्र में वर्णित सेंसर के साथ साथ कई अन्य विद्युत डीएनए biosensor आर्किटेक्चर की सूचना दी गई है. यह एक 12 pseudoknot के साथ सेंसर, ट्रिपल कतरा 13, 14 सैंडविच, सुपर 15 सैंडविच, या triplex 16 वास्तुकला भी शामिल है .

भविष्य में, हम उम्मीद है कि इन सेंसरों देखभाल चिकित्सा निदान के बिंदु में उपयोग किया जाएगा. वे सफलतापूर्वक किया गया है कई microfluidic 17,18 उपकरणों में एकीकृत है, और ऑप्टिकल analyte का पता लगाने प्रणालियों पर कई लाभ प्रदान करते हैं. विशेष रूप से, turbid में इन सेंसरों समारोह, ऑप्टिकली घने और अत्यधिक ऑटो फ्लोरोसेंट नमूने कर सकते हैं.

Disclosures

खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgments

इस काम के बिल और मेलिंडा गेट्स फाउंडेशन से एक अनुदान (OPP1015402) द्वारा ग्रांड Explorations चुनौतियां पहल के माध्यम से, और GM062958-01 और 2R01EB002046 अनुदान के माध्यम से NIH द्वारा वित्त पोषित किया गया था. इस काम के हिस्से में अमेरिकी ऊर्जा विभाग के तत्वावधान में डे - AC52 - 07NA27344 अनुबंध के तहत लॉरेंस लिवरमोर राष्ट्रीय प्रयोगशाला द्वारा प्रदर्शन किया गया था.

Materials

Name Company Catalog Number Comments
Gold Disk Electrodes CH Instruments, Inc. CHI101 Can be re-used
Synthetic Probe DNA Biosearch Technologies Custom
Synthetic Target DNA Sigma-Aldrich Custom
Mercaptohexanol Sigma-Aldrich 725226-1G Store in cool dark place
Platinum Electrode BASi MW-1032 Can be re-used
Ag/AgCl Reference BASi MF-2052 Can be re-used
Polishing Cloth Buehler 40-7212
Alumina Polish Buehler 40-6325-016
Phosphate buffered saline Buffer, pH 7.4 Sigma-Aldrich P7059-1L
CH Instruments 605A CH Instruments, Inc. 605A Use any potentiostat
Newborn Calf Serum Sigma-Aldrich N4637-500ML Stored frozen
NanoDrop Fisher Scientific ND-2000 Use any UV-Vis
PCR Mix Bio-Rad 170-8862 Stored frozen
Cocaine Sigma-Aldrich C5776 DEA License Required
Procaine Sigma-Aldrich P9879 Substitute for Cocaine
Anti-Flag Antibody Sigma-Aldrich F1804-1mg

DOWNLOAD MATERIALS LIST

References

  1. Xiao, Y., Lai, R. Y., Plaxco, K. W. Preparation of electrode-immobilized, redox-modified oligonucleotides for electrochemical DNA and aptamer-based sensing. Nat. Protocols. 2, 2875-2880 (2007).
  2. Ricci, F., Lai, R. Y., Heeger, A. J., Plaxco, K. W., Sumner, J. J. Effect of Molecular Crowding on the Response of an Electrochemical DNA Sensor. Langmuir. 23, 6827-6834 (2007).
  3. White, R. J., Phares, N., Lubin, A. A., Xiao, Y., Plaxco, K. W. Optimization of Electrochemical Aptamer-Based Sensors via Optimization of Probe Packing Density and Surface Chemistry. Langmuir. 24, 10513-10518 (2008).
  4. Lubin, A. A., Vander Stoep Hunt, B., White, R. J., Plaxco, K. W. Effects of Probe Length, Probe Geometry, and Redox-Tag Placement on the Performance of the Electrochemical E-DNA Sensor. Analytical Chemistry. 81, 2150-2158 (2009).
  5. Lubin, A. A., Plaxco, K. W. Folding-Based Electrochemical Biosensors: The Case for Responsive Nucleic Acid Architectures. Accounts of Chemical Research. 43, 496-505 (2010).
  6. Lubin, A. A., Lai, R. Y., Baker, B. R., Heeger, A. J., Plaxco, K. W. Sequence-Specific, Electronic Detection of Oligonucleotides in Blood, Soil, and Foodstuffs with the Reagentless, Reusable E-DNA Sensor. Analytical Chemistry. 78, 5671-5677 (2006).
  7. Cash, K. J., Ricci, F., Plaxco, K. W. An Electrochemical Sensor for the Detection of Protein?Small Molecule Interactions Directly in Serum and Other Complex Matrices. Journal of the American Chemical Society. 131, 6955-6957 (2009).
  8. Baker, B. R. An Electronic, Aptamer-Based Small-Molecule Sensor for the Rapid, Label-Free Detection of Cocaine in Adulterated Samples and Biological Fluids. Journal of the American Chemical Society. 128, 3138-3139 (2006).
  9. Ferapontova, E. E., Olsen, E. M., Gothelf, K. V. An RNA Aptamer-Based Electrochemical Biosensor for Detection of Theophylline in Serum. Journal of the American Chemical Society. 130, 4256-4258 (2008).
  10. Stojanovic, M. N., Landry, D. W. Aptamer-Based Colorimetric Probe for Cocaine. Journal of the American Chemical Society. 124, 9678-9679 (2002).
  11. Stojanovic, M. N., Prada, P. de, Landry, D. W. Aptamer-Based Folding Fluorescent Sensor for Cocaine. Journal of the American Chemical Society. 123, 4928-4931 (2001).
  12. Cash, K. J., Heeger, A. J., Plaxco, K. W., Xiao, Y. Optimization of a Reusable, DNA Pseudoknot-Based Electrochemical Sensor for Sequence-Specific DNA Detection in Blood Serum. Analytical Chemistry. 81, 656-661 (2009).
  13. Xiao, Y. An Electrochemical Sensor for Single Nucleotide Polymorphism Detection in Serum Based on a Triple-Stem DNA Probe. Journal of the American Chemical Society. 131, 15311-15316 (2009).
  14. Zuo, X., Xiao, Y., Plaxco, K. W. High Specificity, Electrochemical Sandwich Assays Based on Single Aptamer Sequences and Suitable for the Direct Detection of Small-Molecule Targets in Blood and Other Complex Matrices. Journal of the American Chemical Society. 131, 6944-6945 (2009).
  15. Xia, F. An Electrochemical Supersandwich Assay for Sensitive and Selective DNA Detection in Complex Matrices. Journal of the American Chemical Society. 132, 14346-14348 (2010).
  16. Patterson, A. Using Triplex-Forming Oligonucleotide Probes for the Reagentless, Electrochemical Detection of Double-Stranded DNA. Analytical Chemistry. 82, 9109-9115 (2010).
  17. Ferguson, B. S. Integrated Microfluidic Electrochemical DNA Sensor. Analytical Chemistry. 81, 6503-6508 (2009).
  18. Swensen, J. S. Continuous, Real-Time Monitoring of Cocaine in Undiluted Blood Serum via a Microfluidic, Electrochemical Aptamer-Based Sensor. Journal of the American Chemical Society. 131, 4262-4266 (2009).
विद्युत रासायनिक डीएनए Biosensors के न्यूक्लिक एसिड, प्रोटीन और छोटे अणुओं के Reagentless पता लगाने के लिए निर्माण कार्य
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rowe, A. A., White, R. J., Bonham, A. J., Plaxco, K. W. Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules. J. Vis. Exp. (52), e2922, doi:10.3791/2922 (2011).More

Rowe, A. A., White, R. J., Bonham, A. J., Plaxco, K. W. Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules. J. Vis. Exp. (52), e2922, doi:10.3791/2922 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter