Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

VIGS-medierad Forward Genetics Screening för Identifiering av gener involverade i Nonhost Resistance

doi: 10.3791/51033 Published: August 23, 2013

Summary

Virus-inducerad geners uttryck är ett användbart verktyg för att identifiera gener som är involverade i nonhost motstånd växter. Vi visar användningen av bakteriella patogener som uttrycker GFPuv i att identifiera gen tystas växter som är mottagliga för nonhost patogener. Denna metod är enkel, snabb och underlättar storskalig screening och liknande protokoll kan användas till att studera olika andra växt-mikrob-interaktioner.

Abstract

Nonhost sjukdomsresistens av växter mot bakteriella patogener styrs av komplexa försvar vägar. Att förstå denna mekanism är viktig för att utveckla hållbara sjukdomen-resistenta växter mot många olika patogener. Virus-inducerad geners uttryck (VIGS)-baserad framåt genetik screening är en användbar metod för identifiering av gener växters försvar överförande nonhost motstånd. Tobacco rattle virus (TRV)-baserade VIGS vektorn är den mest effektiva VIGS vektor hittills och har effektivt använts att tysta endogena målgener i Nicotiana benthamiana.

I detta manuskript, visar vi en framåt genetik screening för att tysta av enskilda kloner från ett cDNA-bibliotek i N. benthamiana och mäta effekten av genen tystas växter för äventyras nonhost resistens mot nonhost patogener, Pseudomonas syringae pv. tomat T1, P. syringae pv. GlycInea, och X. campestris pv. vesicatoria. Dessa bakteriella patogener är konstruerade för att uttrycka GFPuv protein och deras gröna fluorescerande kolonier kan ses av blotta ögat under UV-ljus i nonhost inokulerade patogener växter om det tystade målgenen är involverad i att förmedla nonhost motstånd. Detta underlättar tillförlitlig och snabbare identifiering av genen tystas växter som är mottagliga för nonhost patogener. Vidare kan lovande kandidat gen informationen vara känd genom sekvensering insatsen växtgen i TRV vektor. Här kan vi visa den höga genomströmningen förmåga VIGS-medierade framåt genetik för att identifiera gener som är involverade i nonhost motstånd. Ungefär, kan 100 cDNA individuellt tystas i cirka två till tre veckor och deras relevans i nonhost resistens mot flera nonhost bakteriella patogener kan studeras i en vecka därefter. I detta manuskript, räkna vi de detaljerade stegen i denna screening. VIGS-medierad framåt genetik screening tillvägagångssätt kan utökas inte bara att identifiera gener som är involverade i nonhost motstånd, men också för att studera gener överförande flera biotiska och abiotiska stressfaktorer toleranser i olika växtarter.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nonhost resistans är resistansen hos alla växtarter mot raser av en viss patogen 1,2. Detta ger ett brett spektrum och tålig sjukdomsresistens hos växter 2,3. Men dess mekanism, särskilt mot bakteriella patogener, inte förstått 4. Screening för mutanter eller tystade växter som kompromiss nonhost motstånd och hög genomströmning avskrift profilering för identifiering av differentiellt uttryckta gener under nonhost resistens 5-9 är två viktiga metoder som tidigare använts för att dissekera bakteriell nonhost motstånd. Eftersom nonhost motstånd styrs av en komplex mekanism (er) 4 med medverkan av många gener, en hög genomströmning funktionell genomikaspekter för genidentifiering är avgörande för att bättre förstå den nonhost resistensmekanismen (s).

Virus-inducerad geners uttryck (VIGS) har framgångsrikt använts för att tysta endogen anläggninggener i många växtarter 10,11. Nicotiana benthamiana är en av de bäst lämpade växter för VIGS 10,12 och dess förslag arvsmassa finns nu 13. Tobacco rattle virus (TRV)-baserade VIGS har i stor utsträckning använts som reverse genetics verktyg att karakterisera gener som är involverade i nonhost motstånd 2,4,14. Detta VIGS vektorer och derivat finns nu tillgängliga via Arabidopsis Biological Resource Center (ABRC, http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html ). VIGS har också använts som en framåt genetik verktyg för att identifiera gener involverade i växt immunitet 15-17, speciellt nonhost motstånd 6,18. Uppskatta överkänsliga svaret (HR)-förmedlad celldöd inducerad av växter mot en specifik nonhost patogen och bedöma sjukdomen inducerad celldöd finns två stora analyser huvudsakligen används för identifying mottagliga genen tystas växter. Dock är HR celldöd inducerad endast mot typ-II nonhost patogener och inte mot typ-I nonhost patogener 2. Därför kan HR-analyser inte allmänt används för att identifiera nonhost motstånd strategier som används av växter, speciellt mot många olika typ-I-nonhost patogener. Dessutom gör partiell förlust av nonhost motstånd i en tyst gen anläggning inte alltid leda till sjukdomssymptom 6 och därmed sjukdomen scoring kan inte användas för att identifiera växter kompromissa nonhost motstånd. I motsats, bedöma tillväxten av nonhost patogener i de tystade genen växterna är en bättre metod för att studera förlusten av nonhost motstånd i genen tystas växter.

Jämfört med konventionell tillväxt analys 6,19, en snabbare metod för att bedöma nonhost bakterietillväxt på de tystade genen växter kan förkorta tiden som krävs för framåt genetik screening. Vi rapporterade tidigare en metod för att observation bakterierl patogen tillväxt på blad från blotta ögat under ultraviolett (UV) ljus med hjälp av bakterier som uttrycker grönt fluorescerande protein (GFP) 19. I detta manuskript vi demonstrera användbarheten av GFPuv uttrycka nonhost bakteriella patogener för enkel identifiering av genen tystas växter som äventyras för nonhost motstånd. Denna metod är exakt för identifiering av mottagliga växter och lämpade för high throughput screening.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ett. Växternas tillväxt och Target geners uttryck

  1. Plantera tillväxtbetingelser:
    1. Sugga N. benthamiana frön på marken mindre ingjutning blandning, Metro-Mix 350 och gror fröna i en tillväxt kammare. Varje annan jord eller jord-mindre mediet kan också användas i stället för Metro-Mix.
    2. Transplant tre veckor gamla plantor i enskilda krukor och odla dem i ett växthus som hölls vid 21 ± 2 ° C tillsammans med andra tillväxtfaktorer villkor som beskrivs i tidigare litteratur 12. Två till tre dagar efter omplantering, kan växter användas för TRV ympning.
  2. Växande TRV2 kloner:
    TRV är en tvåparts viruset och dess genomet består av RNA1 och RNA2. RNA1 kodar för ett RNA-beroende RNA-polymeras och en rörelse protein 20,21. RNA2 kodar ett skalprotein (CP) och två icke-strukturella proteiner från subgenomiska RNA 21. Både RNA1 och RNA2 krävs för bildandet av mognat virus partiklar och deras spridning 20,21. cDNA-bibliotek konstruktion i TRV2 vektor beskrivs i tidigare litteratur 22,23. Kortfattat VIGS bibliotek som används i denna studie konstrueras från RNA extraherat från bladvävnader exponerad för olika biotiska och abiotiska framkallare.
    1. Ta ut Agrobacterium (GV2260-stam) innehållande cDNA-klonerna i TRV2 vektor (en 96-brunnar) från frysen. Gradvis tina dem och efter kulturerna når rumstemperatur, inokulera individen Agrobacterium kultur på Luria-Bertani (LB)-agarplatta och rifampicin (10 | ig / ml) och kanamycin (50 pg / ml) med användning av en 96-pin replicator.
    2. Inkubera plattorna vid 28 ° C under två dagar. Vi växer vanligtvis fyra likadana kolonier för varje klon så att tillräcklig Agrobacterium ympen är tillgänglig för prick ympning av två fabriker. Utför alla stegen under sterila förhållanden.
  3. VIGS:
    1. GrowAgrobacterium (GV2260) som uppbär TRV1 vid 28 ° C i LB-vätskemedium med antibiotika som nämns ovan. Harvest cellerna genom centrifugering från över natten odlade kulturer, återsuspendera i inokulering buffert (10 mM MES, pH 5,5, 200 | iM acetosyringon), och inkubera under 3 h vid rumstemperatur på en skakanordning vid 50 rpm.
    2. Skörda cellerna genom centrifugering och återsuspendera i 5 mM MES-buffert (pH 5,5) och inokulera (OD 600 = 0,3) i abaxial sidan av 3-4 N. benthamiana lämnar med en spruta utan nål. Detaljerad inokulerar demonstreras i tidigare litteratur 24. Senare, på platsen för TRV1 ympning, ympa respektive TRV2 kolonier genom att sticka bladen med en tandpetare.
    3. Behåll plantorna med tillräckligt med näring så kraftig tillväxt är viktigt för effektiva VIGS 12. Ungefär två veckor efter ympning utskrifter av riktade gener kommer att börja minska och växterna är redo för patogen INOCulation vid tre veckor efter TRV ympning.

2. Framställning av Nonhost Patogen kulturer och Anläggning ympning

  1. Detaljer för patogener som används i denna studie:
    Pseudomonas syringae pv. Tabaci, P. syringae pv. tomat T1, P. syringae pv. glycinea och Xanthomonas campestris pv. vesicatoria används i denna studie. Grow P. syringae-stammar i Kings B (KB) flytande medium supplementerat med rifampicin (10 pg / ml), kanamycin (50 | ig / ml) vid 28 ° C under 12 tim. Grow X. campestris pv. vesicatoria i LB-vätskemedium under 16 timmar. Alla patogener hyser en plasmid som kan uttrycka GFPuv såsom beskrivits i tidigare litteratur 19.
  2. Beredning av patogener kulturer för växt ympning:
    1. Harvest bakterieceller genom centrifugering och bekräfta förekomsten av grön fluorescens med lång wavelength UV-lampa i mörker. Tvätta cellerna två gånger med sterilt vatten och återsuspendera dem till önskad koncentration med användning av sterilt vatten.
    2. Inokulera respektive patogen (er) på till abaxial sidan av mål-tystade genen blad (5: e till 8: e) som fläckar (omkring 1,5 cm diameter). Flera nonhost patogener samtidigt kan testas för deras tillväxt i de berörda tystade genen växter. Samtidigt inokulera värden patogen eftersom detta kan användas som en positiv kontroll för visning in planta bakterietillväxt. Också Inokulat vektorkontroll (TRV :: 00) växter.

Tre. Observation av in planta Tillväxt sjukdomsalstrande bakterier

  1. Exponera de inokulerade bladen till en lång våglängd UV-ljus i mörker. Bakteriella kolonier kan ses som grönt fluorescerande prickar i abaxial sidan av bladet i bakgrunden av röda fluorescens som emitteras av bladytan.
  2. Beakta patogen tillväxtfrån 2 dagar efter inokulering (dpi) till 5 dpi. Dagligt observation under detta tidsintervall är nödvändigt.
  3. Efter den första skärmen, kort lista klonerna vars tysta resulterar i tillväxt av en eller flera nonhost patogen (er).
  4. Upprepa VIGS för utvalda kloner och återigen testa svaret av genprodukter tystade växter för att nonhost patogen (er). Denna andra nivå av screening görs för att ta bort de falska positiva som erhållits under den första skärmen.

4. Bekräftelse av Förhandsuttagna växter för Äventyras Nonhost Resistance

  1. Tysta de cDNA-kloner valda från skärmen som beskrivits ovan. Inokulera hela anläggningen med nonhost patogen (er) genom att sänka ned växterna med respektive patogen kulturer med 0,01% (volym / volym) Silwet L-77 och att utsätta de nedsänkta växterna till vakuum i 3 - 5 min. Kvantifiera bakterietillväxt genom konventionell tillväxt analys 6,18,19 såsom beskrivs nedan.
  2. Vid 0 timmar efter inokulering (HPI),3 dpi och 5 dpi, samla två bladprover från fem ympade biologiska replikat för varje nonhost patogen (er) blad med ett löv stans (0,5 cm 2). Slipa bladprover, seriellt utspädda och platta Saven på KB agarmedium kompletterat med lämpliga antibiotika och inkubera vid 28 ° C i 2 dagar. Räkna de bakteriella kolonier med användning av en koloniräknare och beräkna bakterietillväxt i bladen såsom beskrivits i tidigare litteratur 6.
  3. Växter som är mottagliga för nonhost patogen (er) borde visa större antal patogen tillväxt jämfört med vektor kontroll.

Fem. Sekvensering Infoga och Identifiering av Målgen

  1. Utför koloni-PCR för den valda klonen med användning attB1 och attB2 primers eller med användning av primrarna flankerar kloningsstället i TRV2 vektorn. Kör PCR-produkten på gelén och kolla för amplifiering av den enda band.
  2. Växt geninsättning i TRV2 vektorn kan sekvenseras med användning av attBprimrar eller primrar som flankerar kloningsstället.
  3. Utför BLAST hjälp av sekvensen och identifiera genen detaljer.
  4. Få full sekvenslängd genen tillsammans med FN-översatta regioner (UTRs).
  5. Välj 300-400 bp-fragmenten från tre olika regioner av sekvensen och klona dem in TRV2 vektor. Självständigt utföra VIGS använder alla tre VIGS konstruktioner och bekräfta kompromiss nonhost motstånd i alla tre tystade genen växter.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Större Syftet med denna studie är att demonstrera en metod för enkel och korrekt identifiering av genen tystas N. benthamiana växter som äventyras för nonhost motstånd. Det finns fyra viktiga steg i denna metod. Första steget är att individuellt tysta stort antal gener med TRV-VIGS. Vi hade tystats omkring 5.000 gener 6,18 under en period av cirka 1,5 år med det protokoll som visas i figur 1. Några av de tystade genen växterna visade olika fenotypiska förändringar inklusive hämmad tillväxt, gulnar och foto-blekning fenotyper (Figur 2).

Andra steget är att identifiera genen tystas växter som visar känslighet för nonhost patogen (er). Vi använde GFPuv uttryckande bakterier och spårade sin tillväxt i planta (figurerna 3A-3C). För att demonstrera processen för identifiering av genen tystade växter som är mottagliga för nonhost pathogen (s), använde vi tre nonhost patogener, P. syringae pv. tomat T1, P. syringae pv. glycinea och X. campestris pv. vesicatoria. Som väntat, icke-tystas (vector kontroll) N. benthamiana plantor ympade med dessa patogener inte växa eftersom de inte kunde övervinna växten immunitet. Emellertid P. syringae pv. tomat T1 bildas grönt fluorescerande kolonier på NbSGT1 gen (en gen inblandad i nonhost resistans 25) tystade växter (Figur 3D). Dessa data visar att processen att identifiera genen tystas växter kompromissade för nonhost motstånd. Detta protokoll kan tillämpas direkt att vidarebefordra genetik screening. Till exempel visar de representativa resultat tagna från en av våra tidigare framåt genetik skärm (Figur 4) två oberoende gen tystas växter med varierande grad av P. syringae pv. tomat T1 tillväxt (Figur 5

Tredje steget är en bekräftelse av bakterietillväxt i de tystade genen växter identifierats från skärmen genom att kvantifiera bakterietillväxt. Ett exempel för beräkningar av in planta bakterietillväxt i NbSGT1 tystade genen växter visas i figur 3E. Resultaten visade att i planta tillväxten av P. syringae pv. tomat T1 var mycket högre i de tystade NbSGT1 plantor jämfört med icke-tystade (TRV :: 00) kontrollväxter (figur 3E). Förlust av nonhost resistens beror på en viss geners uttryck kan vara antingen partiell eller fullständig. Beroende på detta kan omfattningen av nonhost patogen växt på tystade genen växterna variera.

Fjärde steget är sekvensering av insertet i TRV2 vektor. BLAST utförs med användning av denna sekvens för att identifiera genen och dess detaljer.

Figur 1 Figur 1. Cartoon visar de olika stegen i tysta ett stort antal gener med TRV-baserade VIGS. Tre veckor gamla N. benthamiana plantor transplanteras in i enskilda krukor och fick växa i ett par dagar. Agrobacterium som bär TRV1 konstrukt infiltreras i 3-4 blad med hjälp onödigt spruta. Senare är 96 cDNA-kloner som odlas på LB-agar platta individuellt tagits med en tandpetare och stack vidare till TRV1 ympade plats för respektive anläggningar. Ca 3 veckor efter inokulering, inträffar mål geners uttryck i de bästa icke-ympade nyligen vuxit blad. Dessa blad (5: e till 8: e) används för testning av tillväxten av nonhost patogen (er).

Figur 2
Figur 2. VIGS-medierad framåt genetik screening iN. benthamiana visar olika förändringar i växtfenotyp. Tre veckor gamla N. benthamiana växter självständigt inokulerats med respektive TRV konstruktioner såsom descried i figur 1 som en del av framåt genetik skärmen visas. Fotografier togs vid 21 dagar efter TRV ympning.

Figur 3
Figur 3. Grön fluorescens från GFPuv uttrycka bakteriella patogener och dess användning för att identifiera gener som är involverade i nonhost motstånd. Pseudomonas syringae pv. Tabaci, en värd patogen, bär GFPuv konstruera ströks på KB-mediet plattan visar grön fluorescens under långvågigt UV-ljus i mörkret ( A). Dessa bakterier odlas på KB mediet och återsuspenderas i vatten (B) och inokulerades på till N. benthamiana 4 cfu / ml). Vid 3 dagar efter inokulering (dpi) kolonier ses som gröna fluorescerande fläckar med blotta ögat från abaxial sidan av blad epidermalceller (C, vänster). Samma blad avbildad i normalt ljus (synligt spektrum) visas också (C, höger). Uttrycker P. GFPuv syringae pv. tabaci (Pstab, 1 x 10 4 cfu / ml) och tre patogener nonhost, P. syringae pv. tomat T1 (PstT1, 1 x 10 4 cfu / ml), P. . syringae pv glycinea (PSG, 3 x 10 5 cfu / ml) och Xanthomonas campestris pv vesicatoria (XCV, 3 x 10 4 cfu / ml) inokuleras vidare till abaxial sidan av bladen från vektorkontroll (TRV :: 00.; D, vänster) och NbSGT1 gen tystas växter (D, höger). Bakteriella kolonier av Pstab ses på båda blad och de av PstT1 ses endast på NbSGT1 genen tystas blad. PstT1 tillväxt NbSGT1 genen tystas lämnar kvantifieras vid 24, 24 och 72 timmar efter inokulering (HPI, E) visas i diagrammet. Klicka här för att visa en större bild .

Figur 4
Figur 4. Översikt av protokoll följas för VIGS-medierad framåt genetik screening för identifiering av gener involverade i nonhost motstånd. En cDNA-bibliotek i TRV2 vektor konstruerats med hjälp av RNA från nonhost patogen (er) ympades N. benthamiana blad kan användas för screening. Individuella kloner från cDNA-biblioteket tystas i N. benthamiana av TRV-VIGS. Respektive GFPuv uttryckande nonhost bakteriell patogen (er) ympas på till genen tystade växtblad. Mellan 2 och4 dpi de ympade fläckar observeras med hjälp av en UV-lampa i mörkret och de växter som visar nonhost patogen tillväxt identifieras. Efter denna inledande screening, de utvalda klonerna tystas igen och nonhost patogen tillväxt är bekräftade. Denna andra nivå skärm görs för att ta bort de falska positiva. Senare bekräftas kloner tystas för tredje gången och respektive bakterietillväxt uppskattas. Skär av respektive kloner i TRV2 vektor sekvenseras och gen information identifieras. Samtidigt HR analys kan också utföras på de tystade genen växter för att identifiera gener som bidrar till HR induceras mot typ II nonhost patogener.

Figur 5
Figur 5. Nonhost bakteriell patogen tillväxt i genen tystas växter som identifierades som en del av ett framåt genetik skärm. Bilder från en forward genetik screening som identifierade gener involverade i nonhost motstånd N. benthamiana växter mot PstT1, Psg och XCV. Fotografier tagna för två representativa tystade gener växter på 3 dpi efter ympning visas här. Bakteriella koncentrationerna som användes för ympning beskrivs i figur 3. 43D4 eller 94C1 indikerar 96-brunnar nummer följt av brunn nummer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Växt immunitet begränsar tillväxten av nonhost patogener och därmed ringa eller ingen grön fluorescens utsänds från vektorstyrning växtblad inokuleras med nonhost patogen enligt långvågigt UV-ljus (Figur 3D). Men när en gen som är involverad i nonhost motstånd tystas, genen tystade växter gynnar tillväxten av nonhost patogen och grön fluorescens ses (Figur 3E). Detta är den grundläggande principen involverad i den metod som beskrivs i detta manuskript. Denna metod har två stora fördelar jämfört med HR-baserad analys. En kartläggning av tystade växter som är mottagliga för nonhost patogen vid GFPuv-baserad analys ökar precisionen i planta tillväxt kan ses. Det andra, gör denna metod att identifiera gener som är involverade i både typ-I nonhost motståndet 2,26 (inte resulterar i synlig celldöd) och typ-II nonhost motståndet 2,26 (resultat i hypersensitivitetsrespons celldöd).Till exempel, identifierade vi tidigare en klon som heter 6C8 och tystade växterna var mottagliga för både typ-1 och typ-2 patogener 18.

Dessutom är det möjligt att två eller flera oberoende kloner som används för VIGS gav gen tystas växter med liknande fenotyper som de händer att tysta en särskild gen. Denna redundans är användbar eftersom den bekräftar ljuddämpande fenotypen. Förekomsten av sådana upprepningar beror på biblioteket som används för screening och typ av gen (som vissa gener starkt uttrycks och därmed förekommer upprepade gånger i ett bibliotek). Vidare, kloning nästan alla gener kodas av N. benthamiana genomet in ett cDNA VIGS bibliotek och tysta dem oberoende är möjligt.

För att effektivt genomföra framåt genetik screening för identifiering av gener involverade i nonhost motstånd med VIGS följt av GFPuv fluorescensanalys, följande tips är användbara.

Förför framgångsrika VIGS, (1) använda 3 - 4 anläggningar bladstadiet för TRV ympning, (2) optimal TRV1 och TRV2 titer är viktigt. Sedan TRV2 titer kan vara en begränsande faktor för initiering av VIGS, ympa minst 4 fullvuxna bakteriella kolonier av Agrobacterium hyser TRV2, och (3) upprätthålla optimala miljöförhållanden 12. Miljö temperatur spelar en viktig roll i att framkalla optimala VIGS.

Kritiska steg för effektiv detektion av grön fluorescens från patogener innefattar: (1) Använd alltid färska patogen kulturer skördas vid exponentiell tillväxtfas och inte lagra dem före inokulering, och (2) HR celldöd bör undvikas eftersom de kan auto fluorescerar under UV ljus och negativt påverka observationerna. Detta är speciellt viktigt när typ-II nonhost patogen (t.ex. P. syringae pv. Tomat T1) används för studien. Använd lägre koncentration av nonhost patogen vid mikroskopisk HR misstänks eller evidenced.

Felsökning:

(1) Bristande överensstämmelse i geners uttryck och förekomst av rörlig tysta fenotypen bland replikerar:

Byt handskar för varje klon under TRV ympning. Se också till att TRV2 Agrobacterium kolonin inte innehåller multipla kloner genom koloni-PCR. Om koloni-PCR avslöjar mer än ett band, är det möjligt att mer än en klon finns närvarande i kolonin. För att separera klonerna, strimma dem på LB-agarplatta och skärmens de kloner genom koloni-PCR. Efter identifiering av enskilda kloner, utför VIGS oberoende för var och en av dem och identifiera genen tystas växten kompromissa nonhost motstånd.

(2) Allvarliga tillväxt defekter i de tystade växterna:

Om tystade målgen (er) är involverad i basal metabolism av växter, är tillväxt defekter förväntas. Emellertid tystade några av genen planents kan visa högre multiplikation av TRV jämfört smittospridare växter och detta kan orsaka additiv effekt på svårighetsgraden av fenotypen. Lokala lesion analys 12 om Chenopodium amaranticolor växter kan utföras för att ta reda på om de tystade växter har högre TRV titer jämfört med vektorkontroll växter. Under dessa omständigheter kan växter ca 4 veckor gamla användas för VIGS för att minska graden av fenotypen.

(2) Av-mål geners:

Icke-specifika geners uttryck, ofta kallat off-target tysta kan förekomma under VIGS. Detta inträffar när en partiell sekvenshomologi möjliggör siRNA genereras för avsedda målet gen att bryta ner mRNA för gener som inte är den avsedda ljuddämpning mål 27. Använd UTR sekvenser som insats i TRV2 vektor. Studera den endogena genen nedreglering av alla förväntade off-mål gener och kontrollera konstruktionen tystar en enda gen av intresse. To underlätta identifieringen av genfragment med minimal eller ingen off-target, kan bioinformatiska verktyg kan användas (till exempel http://plantgrn.noble.org/pssRNAit/ ).

(3) Ingen grön fluorescens från bakteriekolonier in planta:

Detta sker troligen genom användning av över odlade kulturer. En annan orsak kan vara mindre bakteriell ymp. Även bakteriella koncentrationer kan indirekt mätas genom mätning av optisk densitet OD 600, kan döda bakterieceller utgör högre OD. Det är lämpligt att beräkna optimal bakteriell koncentration baserad på kolonibildande enheter (cfu) genom att räkna levande celler på KB agarmediet plattan. OD-värden kan justeras baserat på cfu. Även strimma patogenen så ofta som möjligt från glycerol lager, växer det på KB agarplattan och ympa enda färska koloni för framställning kulturer för ympning.

En vanligt förekommande orsak till svårigheterna med sekvensering av insertet i TRV2 vektor (genom koloni-PCR) är förekomsten av flera kolonier. För att övervinna detta bör kloner individuell TRV2 konstrukt isoleras som nämns ovan (# 1).

Begränsningar av GFPuv metod och sätt att övervinna:

Patogener kan förlora GFPuv bär plasmiden under multiplikation och därmed negativt påverka observationerna. Dessutom visar några av de tystade genen växter gulnar och foto-blekning löv och dessa blad avger olika fluorescens (än rött). Detta gör det gröna fluorescens svåra att se. Ett sätt att minska effekten av auto fluorescens från de gula eller vita blad är att fånga bilder av det grönt fluorescerande bakterier genom att använda en kamera utrustad med filter som kan ta bort eller minska bakgrunden effect. Bilder kan användas för att sluta sig till huruvida bakterierna har vuxit eller ej. Vissa program (t.ex. Adobe Photoshop) kan användas för att minska bakgrunden effekt under analys av sådana bilder.

Biologiska säkerhetsrutiner som lämpligt bortskaffande av transgena bakteriella patogener måste följas under experiment. Dessutom bör lämpliga hud och ögon sköldar skydd användas vid hantering av UV-lampan.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Vi har inget att lämna ut.

Acknowledgments

Detta projekt har finansierats av Samuel Roberts Noble Foundation. Författarna tackar Mss. Janie Gallaway och Colleen Elles för utmärkt växt vård, och Ms Katie Brown för konstverk. Vi vill också tacka Mss. Trina Cottrell, Pooja Uppalapati, Moumita Saha, Swetha Vinukonda och Mr Isaac Greenhut för teknisk hjälp vid etablering av detta protokoll.

Materials

Name Company Catalog Number Comments
96-well U-bottom plates Becton Dickinson Labware (Franklin Lakes, NJ, USA) 35-3077
96-pin replicator stainless steel Nalge Nunc International (Naperville, IL, USA) 250520
High Intensity UV Inspection Lamps, Model B-100ap Thomas scientific (Swedesboro, NJ, USA) 6283K50 Manufacturer ID 95-0127-01
Stuart SC6 colony counter Bibby Scientific Limited, Staffordshire, UK SC6PLUS
Soil-less potting mixture, Metro-Mix 350 SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)
Primers:
attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT)
attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)
Integrated DNA Technologies, Inc (Coralville, IA, USA) Custom synthesized
MES, Monohydrate VWR international (Radnor, PA, USA) CAS No. 145224-94-8
Acetosyringone (Dimethoxy-4’-hydroxyacetophenone) Sigma Aldrich (St. Louis, MO, USA) D134406
Vac-In-Stuff (Silwet L-77) Lehle Seeds (Round Rock, TX, USA) VIS-30

DOWNLOAD MATERIALS LIST

References

  1. Heath, M. C. Nonhost resistance and nonspecific plant defenses. Currrent Opinion in Plant Biology. 3, 315-319 (2000).
  2. Mysore, K. S., Ryu, C. -M. Nonhost resistance: how much do we know. Trends in Plant Science. 9, 97-104 (2004).
  3. Ellis, J. Insights into nonhost disease resistance: can they assist disease control in agriculture. The Plant Cell. 18, 523-528 (2006).
  4. Senthil-Kumar, M., Mysore, K. S. Nonhost resistance against bacterial pathogens: retrospects and prospects. Annual Review of Phytopathology. 51, (2013).
  5. Lu, M., Tang, X., Zhou, J. -M. Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria. The Plant Cell. 13, 437-447 (2001).
  6. Rojas, C. M., et al. Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways. The Plant Cell. 24, 336-352 (2012).
  7. Daurelio, L. D., et al. Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco. Journal of Plant Physiology. 168, 382-391 (2011).
  8. Moreau, M., et al. EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora. Molecular Plant-Microbe Interactions. 25, 421-430 (2012).
  9. Senthil-Kumar, M., Mysore, K. S. Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response. Plant, Cell & Environment. 35, 1329-1343 (2012).
  10. Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal. 39, 734-746 (2004).
  11. Senthil-Kumar, M., Mysore, K. S. New dimensions for VIGS in plant functional genomics. Trends in Plant Science. 16, 656-665 (2011).
  12. Senthil-Kumar, M., Mysore, K. S. Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnology Journal. 9, 797-806 (2011).
  13. Bombarely, A., et al. A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research. Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).
  14. Sharma, P. C., et al. Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana. Mol Gen Genomics. 269, 583-591 (2003).
  15. Baulcombe, D. C. Fast forward genetics based on virus-induced gene silencing. Current Opinion in Plant Biology. 2, 109-113 (1999).
  16. Lu, R., et al. High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO Journal. 22, 5690-5699 (2003).
  17. Pozo, O., Pedley, K. F., Martin, G. B. MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease. EMBO Journal. 23, 3072-3082 (2004).
  18. Wang, K., Senthil-Kumar, M., Ryu, C. -M., Kang, L., Mysore, K. S. Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast. Plant Physiology. 158, 1789-1802 (2012).
  19. Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv. New Phytologist. 174, 212-223 (2007).
  20. Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal. 25, 237-245 (2001).
  21. MacFarlane, S. A. Molecular biology of the tobraviruses. Journal of General Virology. 80, 2799-2807 (1999).
  22. Anand, A., et al. Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Molecular Plant-Microbe Interactions. 20, 41-52 (2007).
  23. Liu, E., Page, J. Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods. 4, 5 (2008).
  24. Velásquez, A. C., Chakravarthy, S., Martin, G. B. Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. J. Vis. Exp. (28), e1292 (2009).
  25. Peart, J. R., et al. Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants. Proceedings of the National Academy of Sciences. 99. 99-10869 (2002).
  26. Oh, S. -K., et al. Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco. Planta. 223, 1101-1107 (2006).
  27. Senthil-Kumar, M., Mysore, K. RNAi and Plant Gene Function Analysis. Methods in Molecular Biology. Kodama, H., Komamine, A. 744, Humana Press. 13-25 (2011).
VIGS-medierad Forward Genetics Screening för Identifiering av gener involverade i Nonhost Resistance
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).More

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter