Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

VIGS-Mediated Forward Genetica screening per la identificazione di geni coinvolti nella resistenza Nonhost

doi: 10.3791/51033 Published: August 23, 2013

Summary

Indotta da virus silenziamento genico è uno strumento utile per identificare geni coinvolti nella resistenza nonhost delle piante. Dimostriamo l'uso di agenti patogeni batterici che esprimono GFPuv nell'identificazione di geni silenziati piante suscettibili ai patogeni nonhost. Questo approccio è semplice, veloce e facilita lo screening su larga scala e di protocollo simili possono essere applicati a studiare varie altre interazioni pianta-microbo.

Abstract

Nonhost resistenza alle malattie delle piante contro i batteri patogeni è controllato da meccanismi di difesa complessi. La comprensione di questo meccanismo è importante per lo sviluppo di piante resistenti alle malattie durevoli contro un'ampia gamma di patogeni. Indotta da virus silenziamento genico (VIGS) a base di genetica diretta screening è un approccio utile per l'identificazione di geni di difesa delle piante imprimere resistenza nonhost. Virus sonaglio tabacco (TRV) a base di VIGS vettore è il più efficiente VIGS vettore ad oggi ed è stato utilizzato in modo efficiente per silenziare geni bersaglio endogeni in Nicotiana benthamiana.

In questo manoscritto, dimostriamo un approccio prospettico di screening genetico per il silenziamento di singoli cloni da una libreria di cDNA in N. benthamiana e valutare la risposta del gene piante silenziate per resistenza nonhost compromessi contro i patogeni nonhost, Pseudomonas syringae pv. pomodoro T1, P. syringae pv. glycINEA, e X. campestris pv. vesicatoria. Questi agenti patogeni batterici sono progettati per esprimere proteine ​​GFPuv e le loro colonie verde fluorescenti possono essere visti ad occhio nudo sotto la luce UV in nonhost piante inoculate patogeni se il gene bersaglio tacere è coinvolto in impartire resistenza nonhost. Questo facilita l'identificazione affidabile e più veloce di geni silenziati piante suscettibili ai patogeni nonhost. Inoltre, promettente informazioni gene candidato può essere conosciuto con il sequenziamento del gene inserto centrale in TRV vettore. Qui mostriamo la capacità di throughput elevato di VIGS-mediate genetica avanti per identificare i geni coinvolti nella resistenza nonhost. Approssimativamente, 100 cDNA possono essere messi a tacere singolarmente in circa due o tre settimane e la loro rilevanza nella resistenza nonhost contro diversi batteri patogeni nonhost può essere studiato in una settimana dopo. In questo manoscritto, annoveriamo i passaggi dettagliati coinvolti in questo screening. VIGS-mediata genetica diretta screening approccio può essere esteso non solo ai geni coinvolti nella resistenza identificativi nonhost ma anche per studiare geni impartendo diverse tolleranze di stress biotico e abiotico in diverse specie vegetali.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nonhost resistenza è la resistenza di tutte le specie vegetali da anelli di un particolare agente patogeno 1,2. Questo conferisce ampio spettro e durevole resistenza alle malattie nelle piante 2,3. Tuttavia, il suo meccanismo, in particolare contro batteri patogeni, non è ben compreso 4. Screening per mutanti o piante tacere che la resistenza nonhost compromesso, e l'alta velocità trascrizione profiling per l'identificazione di geni differenzialmente espressi durante la resistenza nonhost 5-9 sono due principali approcci precedentemente utilizzati per sezionare batterica resistenza nonhost. Perché la resistenza nonhost è controllato da un complesso meccanismo (s) 4 con il coinvolgimento di molti geni, un approccio genomica funzionale di throughput elevato per l'identificazione di geni è fondamentale per una migliore comprensione del meccanismo di resistenza nonhost (s).

Indotta da virus silenziamento genico (VIGS) è stato utilizzato con successo per mettere a tacere pianta endogenageni in molte specie vegetali 10,11. Nicotiana benthamiana è una delle migliori piante adatte per VIGS 10,12 e il suo progetto di sequenza del genoma è ora disponibile 13. virus sonaglio tabacco (TRV) basati VIGS è stato ampiamente utilizzato come strumento di genetica inversa per caratterizzare i geni coinvolti nella resistenza nonhost 2,4,14. Questo VIGS vettori e derivati ​​sono ora disponibili attraverso Arabidopsis Centro di Risorse Biologiche (ABRC, http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html ). VIGS è stato utilizzato anche come strumento di genetica in avanti per identificare geni coinvolti nella immunità pianta 15-17, resistenza soprattutto nonhost 6,18. Valutare la risposta ipersensibile (HR)-mediata morte cellulare indotta da piante contro uno specifico agente patogeno nonhost e valutare la malattia la morte cellulare indotta sono due importanti saggi utilizzati principalmente per identifying gene suscettibile tacere piante. Tuttavia, la morte delle cellule umane è indotta solo contro di tipo II nonhost patogeni e non contro le tipo-I nonhost patogeni 2. Quindi, le analisi delle risorse umane non può essere usato universalmente per identificare strategie di resistenza nonhost utilizzati dalle piante, in particolare contro un'ampia gamma di tipo-I nonhost patogeni. Inoltre, la perdita parziale della resistenza nonhost in un gene silenziato impianto non sempre porta a sintomi di malattia 6 e quindi di punteggio malattia non può essere utilizzato per identificare le piante compromettenti resistenza nonhost. In contrario, valutare la crescita dei patogeni nonhost nelle piante silenziate gene è un metodo migliore per studiare la perdita di resistenza nonhost nel gene piante silenziate.

Rispetto al saggio di crescita convenzionale 6,19, un metodo più veloce per valutare la crescita batterica nonhost sulle piante silenziate gene può ridurre il tempo richiesto per genetica diretta screening. Abbiamo precedentemente riportato un metodo per osservare i batteril crescita patogeno su foglie da occhio nudo sotto ultravioletta (UV) utilizzando batteri esprimenti proteina fluorescente verde (GFP) 19. In questo manoscritto si dimostra l'utilità di GFPuv esprimere patogeni batterici nonhost per una facile identificazione di geni silenziati piante che sono compromesse per la resistenza nonhost. Questa metodologia è accurata per l'identificazione delle piante sensibili e suscettibili di screening ad alto rendimento.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Crescita delle piante e Target silenziamento genico

  1. Condizioni di crescita delle piante:
    1. Seminare N. semi benthamiana sul suolo-meno miscela invasatura, Metro-Mix 350 e germinare i semi in una camera di crescita. Qualsiasi altro suolo o fuori suolo medio può anche essere usato al posto di Metro-Mix.
    2. Trapianto di tre settimane vecchie piantine in singoli vasi e farli crescere in una serra mantenuta a 21 ± 2 ° C insieme ad altre condizioni di crescita, come descritto nella letteratura precedente 12. Due o tre giorni dopo il trapianto, le piante possono essere utilizzati per TRV inoculazione.
  2. Crescere TRV2 cloni:
    TRV è un virus bipartito e il suo genoma è costituito da RNA1 e RNA2. RNA1 codifica un RNA polimerasi RNA-dipendente e una proteina movimento 20,21. RNA2 codifica una proteina di rivestimento (CP) e due proteine ​​non strutturali provenienti dai RNA subgenomici 21. Sia RNA1 e RNA2 sono necessari per la formazione di vir maturatonoi particelle e la loro diffusione 20,21. costruzione della libreria di cDNA in TRV2 vettore è descritto nella letteratura precedente 22,23. Brevemente, biblioteca VIGS utilizzato in questo studio è stato costruito dagli RNA estratto da tessuti fogliari esposti a vari elicitori biotici e abiotici.
    1. Estrarre Agrobacterium (GV2260 ceppo) contenente i cloni di cDNA in TRV2 vettore (una piastra a 96 pozzetti) dal freezer. A poco a poco li scongelare e dopo le culture a temperatura ambiente, inoculare la cultura Agrobacterium individuale su Luria-Bertani (LB) piastra di agar con rifampicina (10 mg / ml) e kanamicina (50 mg / ml) utilizzando un replicatore 96-pin.
    2. Incubare le piastre a 28 ° C per due giorni. Noi di solito crescono quattro colonie repliche per ogni clone in modo adeguato Agrobacterium inoculo è disponibile per pungere l'inoculazione dei due impianti. Eseguire tutte le operazioni in condizioni sterili.
  3. VIGS:
    1. CrescereAgrobacterium (GV2260) portante TRV1 a 28 ° C in terreno liquido LB con antibiotici summenzionati. Celle di raccolta per centrifugazione di culture cresciute durante la notte, risospendere nel buffer di inoculazione (10 mM MES, pH 5.5, 200 mM acetosyringone), e incubare per 3 ore a temperatura ambiente su un agitatore a 50 rpm.
    2. Raccogliere le cellule per centrifugazione e risospendere in 5 mM MES tampone (pH 5,5) e inoculare (OD 600 = 0,3) nel lato abaxial di 3-4 N. benthamiana lascia utilizzando una siringa senza ago. Procedura di inoculazione dettagliato è dimostrato nella letteratura precedente 24. Più tardi, nella sede di inoculazione TRV1, inoculare rispettivi TRV2 colonie, pungendo le foglie con uno stuzzicadenti.
    3. Mantenere le piante con una nutrizione adeguata, come la crescita vigorosa è importante per VIGS efficienti 12. Circa due settimane dopo l'inoculazione le trascrizioni dei geni mirati cominceranno a diminuire e le piante sono pronte per INOC patogenomento a tre settimane dopo l'inoculazione TRV.

2. Preparazione di Nonhost Culture patogeno e inoculazione impianto

  1. Dettagli di agenti patogeni utilizzati in questo studio:
    Pseudomonas syringae pv. Tabaci, P. syringae pv. pomodoro T1, P. syringae pv. glycinea e Xanthomonas campestris pv. vesicatoria sono utilizzati in questo studio. Crescere P. syringae in B Re (KB) mezzo liquido integrato con rifampicina (10 mg / ml), kanamicina (50 mg / ml) a 28 ° C per 12 ore. Crescere X. campestris pv. vesicatoria in LB liquido per 16 ore. Tutti gli agenti patogeni harbor un plasmide che può esprimere GFPuv come descritto nella letteratura precedente 19.
  2. Preparazione delle colture di agenti patogeni per l'inoculazione impianto:
    1. Raccogliere le cellule batteriche mediante centrifugazione e confermare la presenza di fluorescenza verde tramite lunghe walampada UV velength al buio. Lavare le cellule due volte con acqua sterile e risospendere alla concentrazione desiderata con acqua sterile.
    2. Seminare il rispettivo agente patogeno (s) sul lato abaxial di geni silenziati foglie di destinazione (5 all'8) come macchie (circa 1,5 cm diametro). Diversi patogeni nonhost possono essere testati simultaneamente per la loro crescita nel gene piante silenziate bersaglio. Contemporaneamente inoculare il patogeno host come questo può essere usato come controllo positivo per la visualizzazione in planta crescita batterica. Inoculare anche il controllo vettoriale (TRV :: 00) piante.

3. Osservazione in planta di crescita di batteri patogeni

  1. Esporre le foglie inoculate ad una lunga luce UV di lunghezza d'onda nel buio. Colonie batteriche possono essere visualizzate come punti verdi fluorescenti nella parte abassiale della foglia sullo sfondo di fluorescenza rossa emessa dalla superficie della foglia.
  2. Osservare la crescita dei patogeniDa 2 giorni dopo l'inoculazione (dpi) a 5 dpi. L'osservazione quotidiana durante questo intervallo di tempo è necessario.
  3. Dopo la prima schermata, breve elenco dei cloni il cui silenziamento risultati in crescita di uno o più agenti patogeni nonhost (s).
  4. Ripetere VIGS per i cloni selezionati e nuovamente valutare la risposta dei geni di piante silenziate patogeno nonhost (s). Questo secondo livello di screening è fatto per rimuovere i falsi positivi ottenuti nel primo schermo.

4. Conferma di piante selezionate per resistenza Nonhost compromessa

  1. Tacere i cloni di cDNA selezionate dalla schermata come descritto sopra. Inoculare l'intera pianta con nonhost patogeno (s) immergendo le piante con rispettive culture patogeno con 0,01% (v / v) Silwet L-77 e sottoponendo le piante sommerse per aspirare per 3 - 5 min. Quantificare la crescita batterica mediante saggio di crescita convenzionale 6,18,19 come descritto di seguito.
  2. A 0 ore post inoculazione (HPI),3 dpi e 5 dpi, raccolgono due campioni di foglie da cinque biologico repliche per ciascun patogeno nonhost (s) foglie inoculate con un pugno foglia (0,5 cm 2). Macinare i campioni di foglie, di serie diluito e piatto il SAP su KB agar addizionato con antibiotici e incubare appropriate a 28 ° C per 2 giorni. Contare le colonie batteriche utilizzando un contatore di colonie e calcolare la crescita batterica nelle foglie, come descritto nella letteratura precedente 6.
  3. Piante sensibili al nonhost patogeno (s) dovrebbero mostrare maggiore numero di crescita dei patogeni rispetto al controllo vettoriale.

5. Sequenziamento Inserisci e Identificazione di Target Gene

  1. Eseguire colonia PCR per il clone selezionato utilizzando attB1 e attB2 primer o utilizzando i primer fiancheggianti il ​​sito di clonaggio nel vettore TRV2. Eseguire il prodotto di PCR sul gel e controllare l'amplificazione della singola banda.
  2. Inserto gene vegetale nel vettore TRV2 può essere sequenziato usando attBprimer o primer fiancheggianti il ​​sito di clonazione.
  3. Eseguire BLAST utilizzando la sequenza e identificare i dettagli gene.
  4. Ottenere piena sequenza genica lunghezza insieme con le regioni non tradotti (UTR).
  5. Selezionare 300-400 bp frammenti provenienti da tre diverse regioni della sequenza e li clonare in TRV2 vettore. Indipendentemente eseguire VIGS utilizzando tutti e tre i VIGS costrutti e confermare il compromesso di resistenza nonhost in tutte e tre le piante silenziate gene.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Scopo principale di questo studio è quello di dimostrare un metodo per l'identificazione facile e precisa di gene silenziato N. piante benthamiana che sono compromesse per la resistenza nonhost. Ci sono quattro fasi principali di questa metodologia. Il primo passo è quello di mettere a tacere individualmente gran numero di geni che utilizzano TRV-VIGS. Avevamo silenziato circa 5.000 geni 6,18 su un periodo di circa 1,5 anni usando il protocollo illustrato nella Figura 1. Alcune delle piante silenziate gene ha mostrato varie alterazioni fenotipiche tra cui la crescita stentata, ingiallimento e fotometabolismo fenotipi (Figura 2).

Secondo passo è l'identificazione di geni silenziati piante che mostrano suscettibilità al patogeno nonhost (s). Abbiamo usato GFPuv batteri che esprimono e rintracciato la loro crescita in planta (Figure 3a-3c). Per dimostrare il processo di identificazione del gene silenziato piante sensibili al nonhost pathogen (s), abbiamo utilizzato tre patogeni nonhost, P. syringae pv. pomodoro T1, P. syringae pv. glycinea e X. campestris pv. vesicatoria. Come previsto, non silenziato (controllo vettoriale) N. piante benthamiana inoculate con questi agenti patogeni non sono cresciuti come non potevano superare l'immunità pianta. Tuttavia, P. syringae pv. pomodoro T1 formata colonie fluorescenti verdi su NbSGT1 gene (un gene implicato nella resistenza nonhost 25) piante silenziate (Figura 3D). Questi dati dimostrano il processo di identificazione di geni silenziati piante compromesse per la resistenza nonhost. Questo protocollo può essere applicato direttamente a trasmettere lo screening genetica. Ad esempio, i risultati rappresentativi prelevati da un nostro precedente avanti genetica schermo (Figura 4) mostra due geni centrali silenziate indipendenti con diversi gradi di P. syringae pv. pomodoro crescita T1 (Figura 5

Terzo passo è la conferma della crescita batterica nelle piante silenziate geni identificati dallo schermo attraverso la quantificazione della crescita batterica. Un esempio per la stima della crescita batterica in planta nel gene piante silenziate NbSGT1 è mostrato in Figura 3E. I risultati hanno mostrato che in planta crescita di P. syringae pv. pomodoro T1 era molto più alto nei NbSGT1 piante silenziate rispetto ai non-silenziati (TRV :: 00) piante di controllo (Figura 3E). Perdita di resistenza nonhost causa di un particolare silenziamento genico può essere parziale o completa. A seconda di questo, l'entità della crescita nonhost patogeno sulle piante silenziate gene può variare.

Quarto passo è il sequenziamento del inserto in TRV2 vettore. BLAST viene eseguita utilizzando questa sequenza per identificare il gene e suoi dettagli.

Figura 1 Figura 1. Cartone animato che mostra i passaggi necessari per mettere a tacere un gran numero di geni che utilizzano VIGS TRV-based. Tre settimane di età N. piante benthamiana vengono trapiantate in singoli vasi e lasciate crescere per alcuni giorni. Agrobacterium portando TRV1 costrutto è infiltrata in 3-4 foglie usando siringa inutile. Più tardi, 96 cloni di cDNA coltivate su piastra di agar LB prese in modo individuale con uno stuzzicadenti e compunti al posto TRV1 inoculato di rispettive piante. Circa 3 settimane dopo l'inoculazione, il silenziamento del gene bersaglio si verifica nei non-inoculati foglie top di nuova produzione. Queste foglie (5 all'8) sono utilizzate per verificare la crescita di patogeni nonhost (s).

Figura 2
Figura 2. VIGS-mediata in avanti lo screening genetico inN. benthamiana mostra vari cambiamenti nel fenotipo della pianta. Tre settimane di età N. benthamiana inoculate indipendentemente con rispettiva TRV costrutti descried come in Figura 1 come parte di schermo genetica diretta sono mostrate. Le fotografie sono state scattate a 21 giorni dopo l'inoculazione TRV.

Figura 3
Figura 3. Fluorescenza verde da GFPuv esprimere batteri patogeni e il suo uso per l'identificazione di geni coinvolti nella resistenza nonhost. Pseudomonas syringae pv. Tabaci, un agente patogeno ospite, portando GFPuv costruire seminata su piastra KB-media mostra fluorescenza verde sotto raggi UV ad onda lunga al buio ( A). Questi batteri sono coltivate su KB medio e risospesi in acqua (B) e seminati su N. benthamiana 4 cfu / ml). A 3 giorni dopo l'inoculazione (dpi) colonie batteriche sono visti come macchie verde fluorescente ad occhio nudo da parte abaxial delle cellule epidermiche foglia (C, a sinistra). La stessa foglia nella foto a luce normale (campo di vista) è anche mostrato (C, a destra). GFPuv esprimendo P. syringae pv. tabaci (Pstab, 1 x 10 4 cfu / ml) e tre agenti patogeni nonhost, P. syringae pv. pomodoro T1 (PstT1, 1 x 10 4 cfu / ml), P. . syringae pv glycinea (Psg, 3 x 10 5 CFU / ml) e Xanthomonas campestris pv vesicatoria (XCV, 3 x 10 4 UFC / ml) vengono inoculati sul lato abassiale di foglie dal controllo del vettore (TRV :: 00.; D, a sinistra) e NbSGT1 gene piante silenziate (D, a destra). Colonie batteriche di Pstab sono visti su entrambi i fogli e quelli di PstT1 si vedono solo in NbSGT1 gene silenziato foglie. PstT1 crescita NbSGT1 gene silenziato foglie quantificato in 24, 24 e 72 ore dopo l'inoculazione (HPI, E) è illustrato nel grafico. Clicca qui per ingrandire la figura .

Figura 4
Figura 4. Panoramica del protocollo seguito per VIGS-mediata in avanti lo screening genetico per l'identificazione di geni coinvolti nella resistenza nonhost. Una libreria di cDNA in TRV2 vettore costruito utilizzando RNA da patogeno nonhost (s) inoculato N. benthamiana foglie possono essere utilizzati per lo screening. I singoli cloni dalla libreria di cDNA vengono messi a tacere in N. benthamiana da TRV-VIGS. GFPuv rispettivi esprimenti nonhost patogeno batterico (s) viene inoculata su al gene foglie delle piante silenziate. Tra il 2 e il4 dpi i punti inoculati sono osservati usando una lampada UV nel buio e le piante che mostrano una crescita dei patogeni nonhost sono identificati. Dopo questo screening preliminare, i cloni selezionati sono messi a tacere ancora una volta e la crescita dei patogeni nonhost è riconfermato. Questa schermata secondo livello è fatto per rimuovere i falsi positivi. Più tardi, i cloni confermati sono messi a tacere per la terza volta e la rispettiva crescita batterica è stimato. Inserti dei rispettivi cloni nel vettore TRV2 sono in sequenza e l'informazione genetica viene identificato. Contemporaneamente dosaggio HR può essere eseguita anche sulle piante silenziate genica per identificare i geni che contribuiscono a HR indotta contro tipo II nonhost patogeni.

Figura 5
Figura 5. Nonhost crescita batterio patogeno in gene piante silenziate che sono stati identificati come parte di uno schermo genetica avanti. Immagini da una forward genetica di screening che geni identificati coinvolti nella resistenza nonhost di N. piante benthamiana contro PstT1, Psg e xcv. Le fotografie scattate per due geni centrali silenziate rappresentative a 3 DPI dopo l'inoculazione sono mostrati qui. Concentrazioni batteriche utilizzate per l'inoculazione sono descritti in Figura 3. 43D4 o 94C1 indica il numero piastra a 96 pozzetti seguito dal numero di bene.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Immunità impianto limita la crescita di patogeni nonhost e, quindi, poca o nessuna fluorescenza verde è emessa da impianti di controllo vettoriale foglie inoculate con patogeni nonhost sotto luce UV di lunghezza d'onda lunga (Figura 3D). Tuttavia, quando un gene coinvolto nella resistenza nonhost viene messo a tacere, le piante silenziate gene favoriscono la crescita di nonhost fluorescenza patogeno e verde è visto (Figura 3E). Questo è il principio di base coinvolti nel metodo descritto in questo manoscritto. Questa metodologia ha due grandi vantaggi rispetto al saggio HR-based. Uno, l'identificazione di piante silenziate suscettibili di patogeno nonhost mediante test GFPuv-based aumenta la precisione, come in crescita planta può essere visualizzato. In secondo luogo, questo metodo permette l'identificazione di geni coinvolti sia nel tipo-I resistenza nonhost 2,26 (non determina la morte cellulare visibile) e di tipo II resistenza nonhost 2,26 (provoca la morte delle cellule di risposta ipersensibile).Per esempio, abbiamo già identificato un clone chiamato 6C8 e le piante tacere erano suscettibili di entrambi di tipo 1 e di tipo-2 agenti patogeni 18.

Inoltre, è possibile che due o più cloni indipendenti utilizzati per VIGS determinato gene piante silenziate con fenotipi simili che avvengono al silenzio un gene particolare. Questa ridondanza è utile in quanto conferma il fenotipo silenziamento. Il verificarsi di tali ripetizioni dipende dalla libreria utilizzata per lo screening e il tipo di gene (come alcuni geni sono altamente espressi e quindi si ripetono in una biblioteca). Inoltre, la clonazione quasi tutti i geni codificati da N. benthamiana genoma in una libreria VIGS cDNA e loro tacere è possibile in modo indipendente.

Al fine di attuare in modo efficace lo screening genetico in avanti per l'identificazione di geni coinvolti nella resistenza nonhost usando VIGS seguiti da GFPuv fluorescenza saggio, i seguenti suggerimenti sono utili.

In ordineper VIGS di successo, (1) utilizzare 3-4 piante stadio fogliare per TRV inoculazione; (2) ottimale TRV1 e TRV2 titolo è importante. Dal TRV2 titolo può essere un fattore limitante per l'inizio della VIGS, inoculare almeno 4 completamente cresciuto colonie batteriche di Agrobacterium ospitare TRV2, e (3) il mantenimento delle condizioni ambientali ottimali 12. Temperatura ambientale svolge un ruolo importante nell'indurre VIGS ottimali.

Passaggi critici per il rilevamento efficace di fluorescenza verde da agenti patogeni sono: (1) utilizzare sempre colture fresche patogeni raccolti in fase di crescita esponenziale e non conservare prima inoculazione, e (2) la morte delle cellule umane deve essere evitata in quanto può auto fluorescenza ai raggi UV luce e negativamente influenzare le osservazioni. Ciò è particolarmente importante quando tipo II nonhost patogeno (per esempio, P. syringae pv. Pomodoro T1) è utilizzato per lo studio. Utilizzare inferiore concentrazione del patogeno nonhost se HR microscopica si sospetta o evidenced.

Risoluzione dei problemi:

(1) Incoerenza nel silenziamento genico e la presenza di fenotipo silenziamento variabile tra le repliche:

Cambiare i guanti per ogni clone durante l'inoculazione TRV. Inoltre, assicurarsi che il TRV2 Agrobacterium colonia non contiene più cloni dalla colonia PCR. Se colonia PCR rivela più di una banda, è possibile che più di un clone è presente nella colonia. Per separare i cloni, li striscia sulla piastra di agar LB e schermo i cloni dalla colonia PCR. Dopo l'identificazione del singolo clone, eseguire VIGS indipendentemente per ciascuno di essi e identificare il gene silenziato pianta comprometterne resistenza nonhost.

(2) Gravi difetti di crescita nelle piante silenziate:

Se il gene bersaglio silenziato (s) è coinvolto nel metabolismo basale di piante, sono attesi difetti di crescita. Tuttavia, alcuni dei geni piano di tacerets può mostrare maggiore moltiplicazione del TRV rispetto alle piante di controllo vettoriale e ciò può causare effetto additivo sulla gravità del fenotipo. Saggio di lesione locale 12 su Chenopodium piante amaranticolor può essere effettuata per verificare se le piante silenziate hanno maggiore TRV titolo rispetto alle piante di controllo vettoriale. In queste circostanze, piante circa 4 settimane vecchi possono essere utilizzati per VIGS per ridurre la gravità del fenotipo.

(2) Off-target silenziamento genico:

Non specifici silenziamento genico, spesso indicato come off-target silenziamento può verificarsi durante VIGS. Ciò si verifica quando una sequenza parziale omologia permette siRNA generato per gene target previsto per degradare l'mRNA per i geni che non sono gli obiettivi prefissati silenziamento 27. Utilizzare sequenze UTR come inserto nel vettore TRV2. Studiare la down-regulation del gene endogeno di tutti i geni fuori bersaglio previsti e assicurarsi silenzi la costruzione di un singolo gene di interesse. TØ facilitare l'identificazione di frammenti di geni con minima o nessuna off-target, strumenti di bioinformatica possono essere utilizzate (per esempio, http://plantgrn.noble.org/pssRNAit/ ).

(3) n fluorescenza verde da colonie di batteri in planta:

Ciò si verifica più probabilmente mediante l'uso di colture cresciute sopra. Un'altra causa potrebbe essere meno inoculo batterico. Sebbene le concentrazioni batteriche possono essere misurati indirettamente misurando la densità ottica OD 600, cellule batteriche morti possono rendere fino superiore OD. È opportuno calcolare ottimale concentrazione batterica basato su unità formanti colonie (ufc) contando le cellule vive sull'agar piatto medio KB. Valori di OD possono essere regolati in base alla cfu. Inoltre, striscia il patogeno più spesso possibile dal magazzino glicerolo, crescono sul piatto di agar KB e inoculare singola colonia fresca per la preparazione di colture per l'inoculazione.

Una causa che si verificano comunemente in difficoltà con il sequenziamento del inserto in TRV2 vettore (dalla colonia PCR) è la presenza di molteplici colonie. Per superare questo, cloni ospitano singolo costrutto TRV2 devono essere isolati come detto sopra (# 1).

Limiti del metodo GFPuv e modi per superare:

Gli agenti patogeni possono perdere la GFPuv portando plasmide durante la moltiplicazione e, di conseguenza, influenzare negativamente le osservazioni. Inoltre, alcune delle piante silenziate genica mostra ingiallimento e fotometabolismo foglie e le foglie emettono fluorescenza diversa (di colore rosso). Questo rende la fluorescenza verde difficile da vedere. Uno dei modi per ridurre l'effetto di fluorescenza auto dalle foglie di colore giallo o bianco è quello di catturare le immagini dei batteri verde fluorescente utilizzando una macchina fotografica dotata di filtri in grado di rimuovere o ridurre lo sfondo effect. Immagini possono essere utilizzate per dedurre se i batteri sono cresciuti o non. Alcuni software (per esempio, Adobe Photoshop) può essere utilizzato per ridurre l'effetto di sfondo durante l'analisi di tali immagini.

Precauzioni di sicurezza biologica come appropriato smaltimento degli agenti patogeni batterici transgenici devono essere seguite durante la sperimentazione. Inoltre, la pelle del caso e gli scudi di protezione degli occhi devono essere utilizzati quando si maneggia la lampada UV.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Non abbiamo nulla da rivelare.

Acknowledgments

Questo progetto è stato finanziato dalla Fondazione Samuel Roberts Noble. Autori ringraziano Mss. Janie Gallaway e Colleen Elles per un'eccellente cura delle piante, e la signora Katie Brown per opere d'arte. Vorremmo anche ringraziare Mss. Trina Cottrell, Pooja Uppalapati, Moumita Saha, Swetha Vinukonda e il signor Isaac Greenhut per assistenza tecnica durante istituzione di questo protocollo.

Materials

Name Company Catalog Number Comments
96-well U-bottom plates Becton Dickinson Labware (Franklin Lakes, NJ, USA) 35-3077
96-pin replicator stainless steel Nalge Nunc International (Naperville, IL, USA) 250520
High Intensity UV Inspection Lamps, Model B-100ap Thomas scientific (Swedesboro, NJ, USA) 6283K50 Manufacturer ID 95-0127-01
Stuart SC6 colony counter Bibby Scientific Limited, Staffordshire, UK SC6PLUS
Soil-less potting mixture, Metro-Mix 350 SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)
Primers:
attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT)
attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)
Integrated DNA Technologies, Inc (Coralville, IA, USA) Custom synthesized
MES, Monohydrate VWR international (Radnor, PA, USA) CAS No. 145224-94-8
Acetosyringone (Dimethoxy-4’-hydroxyacetophenone) Sigma Aldrich (St. Louis, MO, USA) D134406
Vac-In-Stuff (Silwet L-77) Lehle Seeds (Round Rock, TX, USA) VIS-30

DOWNLOAD MATERIALS LIST

References

  1. Heath, M. C. Nonhost resistance and nonspecific plant defenses. Currrent Opinion in Plant Biology. 3, 315-319 (2000).
  2. Mysore, K. S., Ryu, C. -M. Nonhost resistance: how much do we know. Trends in Plant Science. 9, 97-104 (2004).
  3. Ellis, J. Insights into nonhost disease resistance: can they assist disease control in agriculture. The Plant Cell. 18, 523-528 (2006).
  4. Senthil-Kumar, M., Mysore, K. S. Nonhost resistance against bacterial pathogens: retrospects and prospects. Annual Review of Phytopathology. 51, (2013).
  5. Lu, M., Tang, X., Zhou, J. -M. Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria. The Plant Cell. 13, 437-447 (2001).
  6. Rojas, C. M., et al. Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways. The Plant Cell. 24, 336-352 (2012).
  7. Daurelio, L. D., et al. Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco. Journal of Plant Physiology. 168, 382-391 (2011).
  8. Moreau, M., et al. EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora. Molecular Plant-Microbe Interactions. 25, 421-430 (2012).
  9. Senthil-Kumar, M., Mysore, K. S. Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response. Plant, Cell & Environment. 35, 1329-1343 (2012).
  10. Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal. 39, 734-746 (2004).
  11. Senthil-Kumar, M., Mysore, K. S. New dimensions for VIGS in plant functional genomics. Trends in Plant Science. 16, 656-665 (2011).
  12. Senthil-Kumar, M., Mysore, K. S. Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnology Journal. 9, 797-806 (2011).
  13. Bombarely, A., et al. A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research. Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).
  14. Sharma, P. C., et al. Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana. Mol Gen Genomics. 269, 583-591 (2003).
  15. Baulcombe, D. C. Fast forward genetics based on virus-induced gene silencing. Current Opinion in Plant Biology. 2, 109-113 (1999).
  16. Lu, R., et al. High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO Journal. 22, 5690-5699 (2003).
  17. Pozo, O., Pedley, K. F., Martin, G. B. MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease. EMBO Journal. 23, 3072-3082 (2004).
  18. Wang, K., Senthil-Kumar, M., Ryu, C. -M., Kang, L., Mysore, K. S. Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast. Plant Physiology. 158, 1789-1802 (2012).
  19. Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv. New Phytologist. 174, 212-223 (2007).
  20. Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal. 25, 237-245 (2001).
  21. MacFarlane, S. A. Molecular biology of the tobraviruses. Journal of General Virology. 80, 2799-2807 (1999).
  22. Anand, A., et al. Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Molecular Plant-Microbe Interactions. 20, 41-52 (2007).
  23. Liu, E., Page, J. Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods. 4, 5 (2008).
  24. Velásquez, A. C., Chakravarthy, S., Martin, G. B. Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. J. Vis. Exp. (28), e1292 (2009).
  25. Peart, J. R., et al. Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants. Proceedings of the National Academy of Sciences. 99. 99-10869 (2002).
  26. Oh, S. -K., et al. Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco. Planta. 223, 1101-1107 (2006).
  27. Senthil-Kumar, M., Mysore, K. RNAi and Plant Gene Function Analysis. Methods in Molecular Biology. Kodama, H., Komamine, A. 744, Humana Press. 13-25 (2011).
VIGS-Mediated Forward Genetica screening per la identificazione di geni coinvolti nella resistenza Nonhost
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).More

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter