Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

VIGS mediada por delante de detección genética para la identificación de genes implicados en la resistencia no huésped

doi: 10.3791/51033 Published: August 23, 2013

Summary

Inducida por el virus de silenciamiento génico es una herramienta útil para la identificación de genes implicados en la resistencia de las plantas hospedantes. Se demuestra el uso de patógenos bacterianos que expresan GFPuv en la identificación de genes silenciados plantas susceptibles a los agentes patógenos no hospedantes. Este método es fácil, rápido y facilita la detección a gran escala y protocolo similar se puede aplicar al estudio de otras interacciones planta-microorganismo.

Abstract

No hospedantes resistencia a las enfermedades de las plantas frente a patógenos bacterianos es controlado por las vías de defensa complejas. La comprensión de este mecanismo es importante para el desarrollo de plantas resistentes a las enfermedades duraderas contra la amplia gama de patógenos. Inducida por el virus de silenciamiento génico (VIGS) basado en la detección genética hacia adelante es un enfoque útil para la identificación de genes que confieren resistencia a la defensa de las plantas no huésped. Virus del cascabel del tabaco (TRV) vector basado en VIGS es el vector más eficiente VIGS hasta la fecha y se ha utilizado de manera eficiente para silenciar genes diana endógenos en Nicotiana benthamiana.

En este manuscrito, se demuestra un método de detección genética adelante para el silenciamiento de clones individuales de una biblioteca de ADNc de N. benthamiana y la evaluación de la respuesta de las plantas silenciadas de genes para la resistencia no huésped frente a patógenos comprometida no hospedantes, Pseudomonas syringae pv. tomate T1, P. syringae pv. glycINEA y X. campestris pv. vesicatoria. Estos patógenos bacterianos están diseñados para expresar proteínas GFPuv y sus colonias fluorescentes verdes se pueden ver a simple vista bajo luz UV en las plantas inoculadas no hospedantes de patógenos si el objetivo de genes silenciados está implicado en la difusión de la resistencia no huésped. Esto facilita la identificación fiable y más rápida de las plantas de genes silenciados no hospedantes susceptibles a los agentes patógenos. Además, la información gen candidato prometedor puede ser conocido por la secuenciación del inserto de genes de plantas en TRV vectorial. Aquí se demuestra la capacidad de alto rendimiento de la genética hacia adelante VIGS mediadas para identificar los genes implicados en la resistencia no hospedante. Aproximadamente, 100 ADNc pueden ser silenciados individualmente en alrededor de dos a tres semanas y su importancia en la resistencia de no huésped frente a varios patógenos bacterianos no hospedantes pueden ser estudiados en una semana a partir de entonces. En este manuscrito, enumeramos los pasos detallados que participan en esta prueba. Adelante VIGS mediada genética Screening enfoque se puede extender no sólo a la identificación de los genes implicados en la resistencia no huésped, sino también para el estudio de los genes que imparten varias tolerancias de estrés biótico y abiótico en varias especies de plantas.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Resistencia no hospedantes es la resistencia de todas las especies de plantas contra razas de un patógeno en particular 1,2. Esto imparte amplio espectro y resistencia a las enfermedades en las plantas duradera 2,3. Sin embargo, su mecanismo, en particular contra patógenos bacterianos, no se entiende bien 4. La detección de mutantes o plantas silenciadas que la resistencia de no huésped de compromiso, y de alto rendimiento de perfiles de transcripción para la identificación de genes expresados ​​diferencialmente durante la resistencia no hospedante 5-9 son dos enfoques principales usados ​​anteriormente para la disección de la resistencia no hospedante bacteriana. Debido a que la resistencia no huésped es controlada por un complejo mecanismo (s) 4 con la participación de muchos genes, un enfoque genómico funcional de alto rendimiento para la identificación de genes es esencial para una mejor comprensión del mecanismo de resistencia no hospedante (s).

Inducida por el virus de silenciamiento génico (VIGS) ha sido utilizado con éxito para silenciar vegetal endógenoAhora genes en muchas especies de plantas. 10,11 Nicotiana benthamiana es una de las mejores plantas adecuados para VIGS 10,12 y su proyecto de secuencia del genoma está disponible 13. virus del cascabel del tabaco (TRV) basados ​​en VIGS ha sido ampliamente utilizado como herramienta genética inversa para caracterizar los genes implicados en la resistencia no hospedante 2,4,14. Esto VIGS vectores y derivados ya están disponibles a través del Centro de Recursos Biológicos Arabidopsis (ABRC, http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html ). VIGS también se ha utilizado como una herramienta genética hacia delante para la identificación de genes implicados en la inmunidad planta de 15-17, especialmente la resistencia no hospedante 6,18. La evaluación de la respuesta hipersensible (HR) mediada por la muerte celular inducida por las plantas contra un patógeno no hospedante específica y la evaluación de la muerte celular inducida por la enfermedad son dos ensayos principales que se utilizan principalmente para IDENTIFICAgen susceptibles g silenciada plantas. Sin embargo, la muerte celular HR se induce sólo contra los agentes patógenos de tipo II no hospedantes y no contra los de tipo I patógenos no hospedantes 2. Por lo tanto, los ensayos de recursos humanos no se pueden usar universalmente para identificar estrategias de resistencia no hospedantes utilizados por las plantas, especialmente contra la amplia gama de agentes patógenos de tipo I no hospedantes. Además, la pérdida parcial de la resistencia no hospedante en una planta silenciada gen no siempre conduce a síntomas de la enfermedad 6 y por lo tanto de puntuación enfermedad no se puede utilizar para la identificación de plantas comprometer la resistencia no hospedante. Por el contrario, la evaluación de la proliferación de patógenos no hospedantes en las plantas silenciadas de genes es un mejor método para el estudio de la pérdida de resistencia en las plantas no huésped de genes silenciados.

En comparación con el ensayo de crecimiento convencional de 6,19, un método más rápido para evaluar el crecimiento bacteriano no hospedante en las plantas silenciadas de genes puede acortar el tiempo requerido para la detección genética hacia adelante. Nos han informado de un método de observación de bacteriasluz de l crecimiento de patógenos en las hojas por simple vista bajo la luz ultravioleta (UV) con bacterias que expresan la proteína verde fluorescente (GFP) 19. En este manuscrito se demuestra la utilidad de GFPuv expresando bacterias patógenas no hospedantes para facilitar la identificación de los genes silenciados plantas que están comprometidos para la resistencia no huésped. Esta metodología es precisa para la identificación de las plantas sensibles y susceptibles de cribado de alto rendimiento.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Crecimiento de las plantas y Target Silenciador del Gen

  1. Las condiciones de crecimiento de las plantas:
    1. Siembre N. semillas benthamiana en suelo-menos mezcla para macetas, Metro-Mix 350 y germinar las semillas en una cámara de crecimiento. Cualquier otro suelo o suelo-menos medio también se pueden utilizar en lugar de Metro-Mix.
    2. Trasplante de tres semanas de edad plantas de semillero en macetas individuales y crecer en un invernadero mantenido a 21 ± 2 ° C junto con otras condiciones de crecimiento, como se detalla en la literatura anterior 12. Dos a tres días después del trasplante, las plantas se pueden utilizar para TRV inoculación.
  2. Creciendo TRV2 clones:
    TRV es un virus bipartito y su genoma consta de ARN1 y ARN2. ARN1 codifica una ARN polimerasa dependiente de ARN y una proteína de movimiento 20,21. ARN2 codifica una proteína de cubierta (CP) y dos proteínas no estructurales de los RNAs subgenómicos 21. Se requieren dos ARN1 y ARN2 para la formación de vir maduradosomos partículas y su propagación 20,21. construcción de la biblioteca de ADNc en el vector TRV2 se describe en la literatura previa 22,23. Brevemente, la biblioteca VIGS utilizado en este estudio se construyó a partir del ARN extraído de tejidos de las hojas expuestas a diferentes elicitores bióticos y abióticos.
    1. Tome cabo por Agrobacterium (cepa GV2260) que contiene los clones de ADNc en el vector TRV2 (una placa de 96 pocillos) del congelador. Poco a poco descongelarlos y después de los cultivos alcancen la temperatura ambiente, inocular el cultivo de Agrobacterium individuo en medio Luria-Bertani (LB) placa de agar con rifampicina (10 mg / ml) y kanamicina (50 mg / ml) utilizando un replicador de 96 pines.
    2. Incubar las placas a 28 ° C durante dos días. Por lo general, crecen cuatro colonias idénticas para cada clon para que adecuada inóculo Agrobacterium está disponible para pinchar la inoculación de dos plantas. Realice todos los pasos bajo condiciones estériles.
  3. VIGS:
    1. CrecerAgrobacterium (GV2260) llevar a TRV1 a 28 ° C en medio líquido LB con los antibióticos mencionados anteriormente. Células de la cosecha por centrifugación a partir de cultivos desarrollados durante una noche, volver a suspender en el tampón de inoculación (MES 10 mM, pH 5,5, 200 mM de acetosiringona), y se incuba durante 3 horas a temperatura ambiente en un agitador a 50 rpm.
    2. Recoger las células por centrifugación y se vuelve a suspender en tampón MES 5 mM (pH 5,5) e inocular (DO600 = 0,3) en el lado abaxial de 3-4 N. benthamiana hojas usando una jeringa sin aguja. Procedimiento de inoculación detallada se demuestra en la literatura anterior 24. Más tarde, en el sitio de inoculación TRV1, inocular respectivos TRV2 colonias mediante un pinchazo en las hojas con un palillo.
    3. Mantener las plantas con una nutrición adecuada ya que el crecimiento vigoroso es importante para VIGS eficientes 12. Alrededor de dos semanas después de la inoculación de las transcripciones de genes específicos se empiezan a reducir y las plantas están listas para patógenos inoculadosblación a las tres semanas después de la inoculación TRV.

2. Preparación de los cultivos no hospedantes de patógenos y la inoculación Plant

  1. Detalles de los agentes patógenos utilizados en este estudio:
    Pseudomonas syringae pv. Tabaci, P. syringae pv. tomato T1, P. syringae pv. glycinea y Xanthomonas campestris pv. vesicatoria se utilizan en este estudio. Crecer P. cepas syringae en King B (KB) medio líquido suplementado con rifampicina (10 mg / ml), kanamicina (50 mg / ml) a 28 º C durante 12 horas. Crecer X. campestris pv. vesicatoria en medio líquido LB durante 16 horas. Todos los patógenos albergan un plásmido que puede expresar GFPuv como se describe en la literatura anterior 19.
  2. Preparación de los cultivos para la inoculación de patógenos de plantas:
    1. Cosecha de las células bacterianas por centrifugación y confirmar la presencia de fluorescencia verde usando largo walámpara UV velength en la oscuridad. Lavar las células dos veces con agua estéril y se las vuelve a suspender a la concentración deseada con agua estéril.
    2. Se inocula el patógeno correspondiente (s) al envés de las hojas de genes diana silenciadas (5 º a 8 º) como puntos (alrededor de 1,5 cm diámetro). Varios agentes patógenos no hospedantes se pueden probar simultáneamente para su crecimiento en el gen diana plantas silenciadas. Simultáneamente inocular el patógeno host que ésta se puede utilizar como un control positivo para la visualización en el crecimiento bacteriano planta. También el control de vectores inocular (TRV :: 00) plantas.

3. La observación de in planta crecimiento de patógenos bacterianos

  1. Exponer las hojas inoculadas a una larga luz ultravioleta de longitud de onda en la oscuridad. Las colonias bacterianas se pueden ver como puntos fluorescentes verdes en el lado abaxial de la hoja en el fondo de la fluorescencia roja emitida por la superficie de la hoja.
  2. Observar el crecimiento de patógenosde 2 días después de la inoculación (dpi) a 5 dpi. La observación cotidiana durante este intervalo de tiempo es necesario.
  3. Después de la primera pantalla, la lista corta de los clones cuya silenciamiento resultados en el crecimiento de uno o más patógenos no hospedante (s).
  4. Repita VIGS para los clones seleccionados y otra vez probar la respuesta de las plantas de genes silenciados para no hospedante patógeno (s). Este segundo nivel de detección se lleva a cabo para eliminar los falsos positivos obtenidos en la primera pantalla.

4. Confirmación de Plantas preseleccionados para la Resistencia no hospedantes Comprometida

  1. Silenciar los clones de ADNc seleccionados de la pantalla como se describe anteriormente. Inocular toda la planta con el patógeno no hospedante (s) por inmersión de las plantas con los respectivos cultivos de patógenos con 0,01% (v / v) Silwet L-77 y sometiendo las plantas sumergidas a vacío durante 3 - 5 min. Cuantificar el crecimiento bacteriano mediante ensayo de crecimiento convencional 6,18,19 como se describe a continuación.
  2. A 0 h después de la inoculación (hpi),3 ppp y 5 dpi, recogen dos muestras de hojas de cinco repeticiones biológica para cada patógeno no hospedante (s) hojas inoculadas con un punzón de hoja (0,5 cm 2). Moler las muestras de hojas, serie diluido y placa de la savia en el KB medio de agar suplementado con antibióticos y se incuba correspondientes a 28 ° C durante 2 días. Contar las colonias bacterianas utilizando un contador de colonias y calcular el crecimiento de bacterias en las hojas como se describe en la literatura anterior 6.
  3. Las plantas no hospedantes susceptibles a patógenos (s) deben mostrar un mayor número de crecimiento de patógenos en comparación con el control de vectores.

5. La secuenciación del inserto e identificación de gen diana

  1. Realizar la PCR de colonias para el clon seleccionado utilizando att B1 y attB2 cebadores o utilizando los cebadores que flanquean el sitio de clonación en el vector de TRV2. Ejecute el producto de PCR en el gel y se les presentarán para la amplificación de la banda única.
  2. Inserción de genes de plantas en el vector TRV2 puede ser secuenciado usando attBcebadores o cebadores que flanquean el sitio de clonación.
  3. Realizar BLAST usando la secuencia e identificar los detalles de genes.
  4. Obtener la secuencia génica de longitud completa junto con las regiones sin traducir (UTR).
  5. Seleccione 300-400 bp fragmentos de tres regiones diferentes de la secuencia y clonar ellos en TRV2 vector. Independientemente realizar VIGS utilizando los tres VIGS construcciones y confirmar el compromiso de la resistencia de no huésped en las tres plantas de genes silenciados.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Objetivo principal de este estudio es demostrar un método para la identificación fácil y precisa de genes silenciados N. benthamiana plantas que están comprometidos para la resistencia no huésped. Hay cuatro pasos principales en esta metodología. El primer paso es silenciar individualmente gran número de genes utilizando TRV-VIGS. Habíamos silenciada alrededor de 5.000 genes de 6,18 durante un período de alrededor de 1,5 años utilizando el protocolo representado en la Figura 1. Algunas de las plantas silenciadas genes mostraron diversas alteraciones fenotípicas como retraso del crecimiento, amarillamiento y foto-blanqueo fenotipos (Figura 2).

El segundo paso es la identificación de genes de plantas silenciadas que muestran la susceptibilidad a patógenos no hospedante (s). Utilizamos GFPuv bacterias que expresan y rastreamos su crecimiento en la planta (Figuras 3A-3C). Con el fin de demostrar el proceso de identificación del gen silenciado plantas susceptibles a no hospedante pathogen (s), hemos utilizado tres patógenos no hospedantes, P. syringae pv. tomato T1, P. syringae pv. glycinea y X. campestris pv. vesicatoria. Como era de esperar, no silenciada (control vectorial) N. benthamiana plantas inoculadas con estos patógenos no crecieron, ya que no pudieron superar la inmunidad de la planta. Sin embargo, P. syringae pv T1. tomate formó colonias fluorescentes verdes en NbSGT1 gen (un gen implicado en la resistencia no huésped 25) plantas silenciadas (Figura 3D). Estos datos demuestran el proceso de identificación de genes silenciados plantas comprometidos para la resistencia no huésped. Este protocolo se puede aplicar directamente para reenviar la detección genética. Por ejemplo, los resultados representativos tomados de uno de nuestros anteriores pantalla genética hacia adelante (Figura 4) muestra dos genes independientes plantas silenciadas con diferente grado de P. syringae pv. tomato crecimiento T1 (Figura 5

El tercer paso es la confirmación del crecimiento bacteriano en las plantas de genes silenciados identificados a partir de la pantalla mediante la cuantificación del crecimiento bacteriano. Un ejemplo para la estimación de crecimiento bacteriano en planta en las plantas silenciadas NbSGT1 genes se muestra en la figura 3E. Los resultados mostraron que en el crecimiento de planta de P. syringae pv. tomate T1 fue mucho mayor en las plantas silenciadas NbSGT1 en comparación con las plantas de control no silenciados (TRV :: 00) (Figura 3E). La pérdida de resistencia no huésped debido a un silenciamiento de los genes en particular podría ser parcial o completa. En función de esto, la medida de crecimiento de patógenos no hospedante en las plantas silenciadas de genes puede variar.

Cuarto paso está secuenciando el inserto en TRV2 vector. BLAST se lleva a cabo utilizando esta secuencia para identificar el gen y sus detalles.

Figura 1 Figura 1. Dibujos animados que muestra los pasos involucrados en el silenciamiento de un gran número de genes utilizando VIGS TRV-basados. Tres semanas de edad N. benthamiana plantas se trasplantaron a macetas individuales y se dejaron crecer durante unos pocos días. Agrobacterium llevando TRV1 constructo se infiltra en tres y cincuenta y siete hojas usando una jeringa innecesaria. Más tarde, 96 clones de cDNA cultivadas en placas de agar LB se toman de forma individual con un palillo y pincha en el punto inoculado TRV1 de las plantas respectivas. Aproximadamente 3 semanas después de la inoculación, el silenciamiento del gen diana se produce en las primeras hojas recién crecido no inoculadas. Estas hojas (5 º a 8 º) se utilizan para comprobar el crecimiento de patógenos no hospedante (s).

La figura 2
Figura 2. VIGS mediada por la detección genética en adelanteN. benthamiana muestra varios cambios en el fenotipo de la planta. De tres semanas de edad N. benthamiana plantas inoculadas de forma independiente con las respectivas TRV constructos que divisó en la Figura 1 como una parte de la pantalla hacia adelante genética se muestran. Las fotografías fueron tomadas a los 21 días después de la inoculación TRV.

Figura 3
Figura 3. La fluorescencia verde de GFPuv expresar patógenos bacterianos y su uso para la identificación de genes implicados en la resistencia no huésped. Pseudomonas syringae pv. Tabaci, un patógeno de host, llevando GFPuv construir rayado en la placa KB-medio muestra fluorescencia verde bajo luz ultravioleta de onda larga en la oscuridad ( A). Estas bacterias se cultivan en medio KB y se resuspendieron en agua (B) y se inocularon en a N. benthamiana 4 ufc / ml). En 3 días después de la inoculación (dpi) colonias bacterianas son vistos como manchas fluorescentes verde a simple vista desde el lado abaxial de las células epidérmicas de la hoja (C, a la izquierda). También se muestra la misma hoja fotografiado bajo luz normal (rango visible) (C, derecha). GFPuv expresar P. syringae pv. tabaci (Pstab, 1 x 10 4 ufc / ml) y tres agentes patógenos no hospedantes, P. syringae pv. tomate T1 (PstT1, 1 x 10 4 ufc / ml), P. . syringae pv glycinea (PSG, 3 x 10 5 ufc / ml) y Xanthomonas campestris pv vesicatoria (Xcv, 3 x 10 4 ufc / ml) se inocula en el lado abaxial de las hojas de control de vectores (TRV :: 00.; D, izquierda) y NbSGT1 genes plantas silenciadas (D, derecha). Colonias bacterianas de Pstab se ven en tanto las hojas como las de PstT1 sólo se ven en la Ngen bSGT1 hojas silenciada. PstT1 crecimiento en el gen NbSGT1 hojas silenciada cuantificado en 24, 24 y 72 h después de la inoculación (hpi, E) se muestra en el gráfico. Haz clic aquí para ver más grande la figura .

Figura 4
La Figura 4. Descripción general de protocolo seguido para VIGS mediada por la detección genética hacia delante para la identificación de genes implicados en la resistencia de no huésped. Una biblioteca de ADNc en TRV2 vector construido utilizando ARN de patógenos no hospedante (s) inoculado N. benthamiana hojas se pueden utilizar para el cribado. Los clones individuales de la biblioteca de cDNA se silencian en N. benthamiana por TRV-VIGS. GFPuv respectivas que expresan patógeno bacteriano no hospedante (s) se inoculan en los genes silenciados hojas de las plantas. Entre el 2 y el4 dpi los puntos inoculados se observaron utilizando una lámpara UV en la oscuridad y se identifican las plantas que muestran el crecimiento de patógenos no hospedante. Después de este examen preliminar, los clones seleccionados son silenciados de nuevo y el crecimiento de patógenos no hospedante es confirmado. Esta pantalla de segundo nivel se realiza para eliminar los falsos positivos. Más tarde, los clones confirmados son silenciados por tercera vez y el crecimiento bacteriano respectiva se estima. Insertos de los respectivos clones en el vector TRV2 se secuencian y se identifica la información genética. Simultáneamente ensayo de HR también se puede realizar en las plantas silenciadas de genes para identificar los genes que contribuyen a la HR inducida contra los agentes patógenos de tipo II no hospedantes.

La figura 5
Figura 5. El crecimiento de patógenos bacterianos no hospedantes en las plantas genes silenciados que se identificaron como parte de una pantalla de la genética hacia adelante. Imágenes de una forward de detección genética que los genes identificados implicados en la resistencia no hospedantes de N. benthamiana plantas contra PstT1, Psg y Xcv. Las fotografías tomadas por dos genes silenciados plantas representativas a 3 dpi después de la inoculación se muestran aquí. Concentraciones bacterianas utilizadas para la inoculación se describen en la Figura 3. 43D4 o 94C1 indica el número de la placa de 96 pocillos seguido por el número así.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Planta de inmunidad limita el crecimiento de patógenos no hospedantes y por lo tanto, poco o nada de fluorescencia verde se emite desde la planta de control de vectores de hojas inoculadas con patógenos no hospedante bajo luz UV de longitud de onda larga (Figura 3D). Sin embargo, cuando un gen implicado en la resistencia de no huésped es silenciada, las plantas de genes silenciados favorecen el crecimiento de la fluorescencia verde y no hospedante patógeno se ve (Figura 3E). Este es el principio básico implicado en el método descrito en este manuscrito. Esta metodología tiene dos ventajas importantes sobre el ensayo HR-based. Uno, la identificación de las plantas silenciadas susceptibles a patógenos no hospedante mediante el ensayo de GFPuv basado aumenta la exactitud como en el crecimiento de planta se puede ver. En segundo lugar, este método permite la identificación de genes implicados en tanto de tipo I de resistencia no hospedante 2,26 (no da lugar a la muerte celular visible) y tipo II resistencia no hospedante 2,26 (resultados en la muerte celular de la respuesta hipersensible).Por ejemplo, previamente identificado un clon llamado 6C8 y las plantas silenciadas fueron susceptibles a ambos de tipo 1 y de tipo 2 patógenos 18.

Además, es posible que dos o más clones independientes utilizados para VIGS dieron lugar a genes silenciados plantas con fenotipos similares a medida que ocurren para silenciar un gen particular. Esta redundancia es útil, ya que confirma el fenotipo silenciamiento. La aparición de tales repeticiones depende de la biblioteca utilizada para la detección y el tipo de gen (como algunos genes son altamente expresado y por lo tanto se producen repetidamente en una biblioteca). Además, la clonación de casi todos los genes codificados por N. benthamiana genoma en una biblioteca VIGS cDNA y silenciarlos es posible de manera independiente.

Para llevar a cabo eficazmente la investigación genética hacia adelante para la identificación de genes implicados en la resistencia no hospedantes usando VIGS seguido de ensayo de fluorescencia GFPuv, los siguientes consejos le serán útiles.

En ordenpara VIGS exitosas, (1) el uso de 3 - 4 hojas de plantas de la etapa para TRV inoculación, (2) una óptima TRV1 y TRV2 título es importante. Desde TRV2 título puede ser un factor limitante para la iniciación de VIGS, inocular al menos 4 colonias bacterianas completamente crecidos de Agrobacterium que alberga TRV2, y (3) mantener las condiciones ambientales óptimas 12. Temperatura ambiental desempeña un papel importante en la inducción de VIGS óptimos.

Los pasos críticos para la detección eficaz de la fluorescencia verde de patógenos incluyen: (1) utilizar siempre culturas patógenos frescos cosechados en la fase de crecimiento exponencial y no guardarlos antes de la inoculación, y (2) la muerte celular HR se debe evitar, ya que puede auto fluorescencia con luz ultravioleta luz y negativamente influir en las observaciones. Esto es especialmente importante cuando se utiliza de tipo II no hospedante patógeno (por ejemplo, P. syringae pv. Tomate T1) para el estudio. Utilice menor concentración del patógeno no huésped si se sospecha HR microscópico o evidenced.

Solución de problemas:

(1) La inconsistencia en el silenciamiento de genes y la aparición del fenotipo silenciamiento variables entre replica:

Cambie los guantes para cada clon durante la inoculación TRV. Además, asegúrese de que la Agrobacterium colonia TRV2 no contiene múltiples clones mediante PCR de colonias. Si la PCR de colonias revela más de una banda, es posible que más de un clon está presente en la colonia. Para separar los clones, raya en el plato de agar LB y la pantalla de los clones mediante PCR de colonias. Tras la identificación de clones individuales, realice VIGS forma independiente para cada uno de ellos e identificar el gen silenciado planta comprometer la resistencia de no huésped.

(2) los defectos graves de crecimiento en las plantas silenciadas:

Si el objetivo de genes silenciados (s) está involucrado en el metabolismo basal de las plantas, se espera que los defectos de crecimiento. Sin embargo, algunos de los genes silenciados plan dets puede mostrar mayor multiplicación de TRV en comparación con las plantas de control de vectores y esto puede causar efecto aditivo sobre la gravedad del fenotipo. Ensayo de lesión local 12 en las plantas amaranticolor Chenopodium se puede realizar para determinar si las plantas silenciadas tienen mayor TRV título de comparación con las plantas de control de vectores. Bajo estas circunstancias, las plantas de aproximadamente 4 semanas de edad se pueden utilizar para VIGS para reducir la severidad del fenotipo.

(2) fuera de objetivo silenciamiento génico:

Silenciamiento génico no específica, a menudo referido como el silenciamiento de fuera de objetivo puede ocurrir durante VIGS. Esto ocurre cuando una secuencia parcial de homología permite siRNA generados por genes objetivo previsto para degradar ARNm para genes que no son los objetivos de silenciamiento previstos 27. Usar secuencias UTR como inserto en el vector TRV2. Estudiar la regulación a la baja del gen endógeno de los genes fuera de objetivo esperado y asegurarse silencia la construcción de un único gen de interés. To Facilitar la identificación de fragmentos de genes con mínima o nula fuera del objetivo, las herramientas de la bioinformática se pueden utilizar (por ejemplo, http://plantgrn.noble.org/pssRNAit/ ).

(3) No fluorescencia verde de las colonias bacterianas en planta:

Esto ocurre muy probablemente por el uso de más de cultivos crecidos. Otra causa podría ser inóculo bacteriano menor. Aunque las concentraciones de bacterias se pueden medir indirectamente mediante la medición de la densidad óptica OD 600, las células bacterianas muertas pueden hacer más arriba OD. Es aconsejable para calcular la concentración bacteriana óptima sobre la base de unidades formadoras de colonias (ufc) por el recuento de células vivas en la placa de agar de medio KB. Valores de DO se pueden ajustar sobre la base de la ufc. Además, veta el patógeno tan a menudo como sea posible de la madre de glicerol, crecer en la placa de agar KB e inocular sola colonia fresca para preparar cultivos de inoculación.

Una de las causas que ocurren comúnmente para las dificultades con la secuenciación del inserto en el vector de TRV2 (mediante PCR de colonias) es la presencia de múltiples colonias. Con el fin de superar esto, los clones que albergaban constructo individuo TRV2 deben ser aislados como se ha mencionado más arriba (# 1).

Limitaciones del método GFPuv y maneras de superar:

Los patógenos pueden perder la GFPuv plásmido portador durante la multiplicación y, por tanto, influir negativamente en las observaciones. Además, algunas de las plantas de genes silenciados muestra amarillamiento y foto-blanqueo hojas y estas hojas emiten fluorescencia diferente (de color rojo). Esto dificulta la fluorescencia verde para ver. Una de las maneras de reducir el efecto de la autofluorescencia a partir de las hojas de color amarillo o blanco es para capturar imágenes de las bacterias fluorescentes verdes utilizando una cámara equipada con filtros que pueden eliminar o reducir el fondo efect. Las imágenes pueden ser utilizadas para inferir si las bacterias han crecido o no. Cierto software (por ejemplo, Adobe Photoshop) se puede utilizar para reducir el efecto de fondo durante el análisis de tales imágenes.

Precauciones de seguridad de la biotecnología como la eliminación apropiada de los patógenos bacterianos transgénicos se deben seguir durante la experimentación. Además, la piel adecuado y protección de los ojos se deben utilizar para la manipulación de la lámpara UV.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

No tenemos nada que revelar.

Acknowledgments

Este proyecto fue financiado por la Fundación Samuel Roberts Noble. Los autores agradecen a Mss. Janie Gallaway y Colleen Elles para un excelente cuidado de las plantas, y la Sra. Katie Brown para las ilustraciones. También nos gustaría dar las gracias a Mss. Trina Cottrell, Pooja Uppalapati, Moumita Saha, Swetha Vinukonda y el Sr. Isaac Greenhut ayuda técnica durante la creación de este protocolo.

Materials

Name Company Catalog Number Comments
96-well U-bottom plates Becton Dickinson Labware (Franklin Lakes, NJ, USA) 35-3077
96-pin replicator stainless steel Nalge Nunc International (Naperville, IL, USA) 250520
High Intensity UV Inspection Lamps, Model B-100ap Thomas scientific (Swedesboro, NJ, USA) 6283K50 Manufacturer ID 95-0127-01
Stuart SC6 colony counter Bibby Scientific Limited, Staffordshire, UK SC6PLUS
Soil-less potting mixture, Metro-Mix 350 SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)
Primers:
attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT)
attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)
Integrated DNA Technologies, Inc (Coralville, IA, USA) Custom synthesized
MES, Monohydrate VWR international (Radnor, PA, USA) CAS No. 145224-94-8
Acetosyringone (Dimethoxy-4’-hydroxyacetophenone) Sigma Aldrich (St. Louis, MO, USA) D134406
Vac-In-Stuff (Silwet L-77) Lehle Seeds (Round Rock, TX, USA) VIS-30

DOWNLOAD MATERIALS LIST

References

  1. Heath, M. C. Nonhost resistance and nonspecific plant defenses. Currrent Opinion in Plant Biology. 3, 315-319 (2000).
  2. Mysore, K. S., Ryu, C. -M. Nonhost resistance: how much do we know. Trends in Plant Science. 9, 97-104 (2004).
  3. Ellis, J. Insights into nonhost disease resistance: can they assist disease control in agriculture. The Plant Cell. 18, 523-528 (2006).
  4. Senthil-Kumar, M., Mysore, K. S. Nonhost resistance against bacterial pathogens: retrospects and prospects. Annual Review of Phytopathology. 51, (2013).
  5. Lu, M., Tang, X., Zhou, J. -M. Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria. The Plant Cell. 13, 437-447 (2001).
  6. Rojas, C. M., et al. Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways. The Plant Cell. 24, 336-352 (2012).
  7. Daurelio, L. D., et al. Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco. Journal of Plant Physiology. 168, 382-391 (2011).
  8. Moreau, M., et al. EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora. Molecular Plant-Microbe Interactions. 25, 421-430 (2012).
  9. Senthil-Kumar, M., Mysore, K. S. Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response. Plant, Cell & Environment. 35, 1329-1343 (2012).
  10. Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal. 39, 734-746 (2004).
  11. Senthil-Kumar, M., Mysore, K. S. New dimensions for VIGS in plant functional genomics. Trends in Plant Science. 16, 656-665 (2011).
  12. Senthil-Kumar, M., Mysore, K. S. Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnology Journal. 9, 797-806 (2011).
  13. Bombarely, A., et al. A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research. Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).
  14. Sharma, P. C., et al. Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana. Mol Gen Genomics. 269, 583-591 (2003).
  15. Baulcombe, D. C. Fast forward genetics based on virus-induced gene silencing. Current Opinion in Plant Biology. 2, 109-113 (1999).
  16. Lu, R., et al. High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO Journal. 22, 5690-5699 (2003).
  17. Pozo, O., Pedley, K. F., Martin, G. B. MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease. EMBO Journal. 23, 3072-3082 (2004).
  18. Wang, K., Senthil-Kumar, M., Ryu, C. -M., Kang, L., Mysore, K. S. Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast. Plant Physiology. 158, 1789-1802 (2012).
  19. Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv. New Phytologist. 174, 212-223 (2007).
  20. Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal. 25, 237-245 (2001).
  21. MacFarlane, S. A. Molecular biology of the tobraviruses. Journal of General Virology. 80, 2799-2807 (1999).
  22. Anand, A., et al. Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Molecular Plant-Microbe Interactions. 20, 41-52 (2007).
  23. Liu, E., Page, J. Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods. 4, 5 (2008).
  24. Velásquez, A. C., Chakravarthy, S., Martin, G. B. Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. J. Vis. Exp. (28), e1292 (2009).
  25. Peart, J. R., et al. Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants. Proceedings of the National Academy of Sciences. 99. 99-10869 (2002).
  26. Oh, S. -K., et al. Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco. Planta. 223, 1101-1107 (2006).
  27. Senthil-Kumar, M., Mysore, K. RNAi and Plant Gene Function Analysis. Methods in Molecular Biology. Kodama, H., Komamine, A. 744, Humana Press. 13-25 (2011).
VIGS mediada por delante de detección genética para la identificación de genes implicados en la resistencia no huésped
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).More

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter