Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Affinity основе Выделение Tagged ядер от Published: March 25, 2014 doi: 10.3791/51418

Summary

Drosophila ткани часто содержат гетерогенную смесь типов клеток. Для изучения экспрессии генов в специфические типы клеток из определенной ткани, ядра могут быть генетически помечены и затем выделяют с использованием подхода сродства основе. Изолированных ядер может быть использован для последующих приложений, таких как анализа экспрессии генов и иммунопреципитации хроматина.

Abstract

Дрозофилы эмбриональные и личиночные ткани часто содержат весьма гетерогенную смесь типов клеток, которые могут усложнить анализ экспрессии генов в этих тканях. Таким образом, анализ клеточно-специфический профили экспрессии генов из Drosophila тканей, может быть необходимо изолировать специфические типы клеток с высокой чистотой и выходом на достаточном для последующих приложений, таких как транскрипционный профилирования и иммунопреципитации хроматина. Однако неравномерное клеточной морфологии в тканях, таких как центральной нервной системы, в сочетании с редкой популяции специфических типов клеток в этих тканях, может создавать проблемы для традиционных методов выделения клеток, таких как лазерный микродиссекции и флуоресцентно-активированном сортировки клеток (FACS) . Здесь, альтернативный подход к характеризующие профили экспрессии генов клеток конкретных используя изоляцию сродства основе меченых ядер, а не целые клетки, описывается. Ядра в конкретной слокоть тип интереса генетически метили ядерной оболочки локализованные EGFP тега с использованием системы двоичного выражения Gal4/UAS. Эти EGFP-меченый ядра могут быть выделены с использованием антител против GFP, которые соединены с магнитными гранулами. Подход, описанный в данном протоколе обеспечивает последовательное выделение ядер от конкретных типов клеток в Drosophila личинок центральной нервной системы при высокой чистотой и при достаточном уровне для анализа экспрессии, даже если эти типы клеток составляют менее 2% от общего количества клеток в ткани. Этот подход может быть использован для выделения ядра из широкого спектра Drosophila эмбриональных и личиночных типах клеток с использованием специфических драйверов GAL4, и может быть полезна для выделения ядра из типов клеток, которые не подходят для FACS или лазерного микродиссекции.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Drosophila тканей, таких как центральной нервной системы содержат сложную смесь типов клеток. Таким образом, анализ клеточно-специфический профили экспрессии генов из Drosophila тканей, в первую очередь необходимо изолировать гомогенной популяции специфических клеток в количествах, достаточных для последующих применений. Методы, позволяющие изолировать клетки от здоровых тканей включают лазерный микродиссекции и флуоресценции Активированный сортировки клеток (FACS) целых клеток. В то время как FACS была использована для выделения клеток и ядер из эмбрионов Drosophila и Caenorhabditis Элеганс от для экспрессии генов и хроматина профилирования 1-3, FACS и лазерной микродиссекции может быть трудно успешно выполнить в тканях, которые содержат сильно перемешаны типы клеток или содержащие клетки с нерегулярные морфологии, такие как нейроны. Чтобы преодолеть эту трудность, ядра, а не клетки могут быть выделены из специфических типов клеток и использовали для последующего поколенияе выражение профилирования. Важно отметить, что микрочипов на основе анализа экспрессии мРНК с использованием образцов ядерной РНК показывает, как правило, сравнимые результаты с что выполняется с использованием полной РНК 4, 5. Более того, анализ экспрессии генов с использованием ядерной РНК успешно используется для изучения экспрессии генов в различных организмов, включая С. Элеганс, арабидопсис, дрозофилы, и люди 4, 5 2, 3.

Некоторые подходы были недавно описаны для выделения отдельных групп населения меченых ядер из Drosophila тканей, которые подходят для анализа экспрессии генов и / или иммунопреципитации хроматина. Пакетный изоляция тканеспецифической хроматина для метода иммунопреципитации (BITS-Chip) использует FACS изолировать фиксированных ядер на основе камерного типа специфической экспрессии ядерного локализованные GFP 2. Этот подход был суccessfully используется для анализа распределения модификаций гистонов и транскрипционных факторов с использованием хроматина иммунопреципитацию изолированных ядер из мезодермы эмбрионов Drosophila 2. Тем не менее, подходы СУИМ основе может быть менее пригодны для выделения меченых ядер, которые составляют лишь небольшую долю смешанной популяции в связи с увеличением времени Упорядочить необходимой для получения подходящих номеров для последующих применений. Чтобы преодолеть эти ограничения, несколько групп использовали методы изоляции сродством на основе очистить ядра, которые помечены с конкретным эпитопом в конкретном типе клеток. Выделение ядер отмеченных в специфические типы клеток методом (неповрежденного судна), разработанных для использования в арабидопсис 6, 7 недавно был адаптирован для использования в дрозофилы 8. В этом методе, слияние ядерная оболочка белок, который является субстратом для в естественных условиях биотинилирования является coexpresСЭД с кишечной палочкой биотин-лигазы Бира в специфические типы клеток. Биотин-меченные ядра может быть очищен от смешанных популяций с использованием стрептавидина на основе сродства изоляцию. Используя этот подход, ядер были успешно промаркированы и изолированы от мезодермы дрозофилы эмбрионов, в которых была выражена слитый белок ядерная оболочка под контролем мезодермы конкретных усилитель 8. Авторы также генерируется ядерных белков конверт слияния, которые могут быть выражены на любом типе клеток под контролем регуляторной последовательности Gal4, БАС 9. Этот подход способен быстро выделения подмножества меченых ядер из смешанных популяций, но требует трех отдельных трансгенных конструкции и, следовательно, могут не подходить для определенных генетических приложений. В последнее время подход был описан в котором ВС (S ad1 и ООН С-84) домена, содержащих белки, которые локализуются в внутренней мембране ядерной оболочки были помеченыфлуоресцентные белки и экспрессируется под контролем системы Gal4/UAS 10. Ядра выдел ют в присутствии неионогенного моющего средства для удаления внешней мембраны ядерной оболочки, и аффинно очищают, использу магнитные шарики, соединенные с анти-GFP антител. Этот подход был успешно использован для выделения небольших популяций меченых ядер от конкретных нейронных подтипов внутри взрослом мозге дрозофилы 10.

Здесь, протокол для изоляции меченых ядер из смешанной популяции клеток из ткани Drosophila личинок описан. Этот метод был разработан самостоятельно, но похож на подход, описанный Генри и др.. 10 Во-первых, ядра были помечены флуоресцентным тега, который экспрессируется только в определенных типах клеток в дрозофилы, чтобы облегчить последующую изоляцию отмеченных ядер от смешанным населением используя подход сродства основе. Чтобы пометить ядра,домен KASH larsicht / пс-1 / S ин ч omology) был использован. Домен KASH является трансмембранный домен, что локализуется в наружной мембране ядерной оболочки, частично через взаимодействие с ВС домен-содержащих белков внутри перинуклеарном пространстве 11. С-концевой домен KASH из белков, таких как Drosophila MSP-300 и Klarsicht анкеры эти белки с наружной ядерной мембраны, тогда как их N-концевые домены взаимодействуют с цитоскелета белков, таких как актин или микротрубочек в цитоплазме 12-14. Конструкции были получены в котором область KASH из Drosophila MSP-300 был присоединен к С-концу EGFP, под контролем регуляторной последовательности UAS Gal4, в векторе pUAST-attB 15, 16. Использование phiC31 сайт-специфической интеграции, были получены трансгенные мухи, в котором UAS-EGFP :: MSP-300 KASH трансген был вставлен в attP2 локусов на хромосоме3L 17. UAS-EGFP :: MSP-300 KASH летит могут быть скрещены с мухами, которые экспрессируют драйвер Gal4 в конкретном типе клеток, в результате чего целевой экспрессии EGFP на внешней ядерной мембраны в типе клеток, представляющих интерес. Меченых ядер затем может быть очищен из клеточных популяций смешанных с использованием антитела против GFP, соединенных с магнитными гранулами. В этом подходе, использование неионогенного моющего средства не требуется, поскольку тег EGFP локализуется на цитоплазматической стороне внешней ядерной мембраны и, следовательно, для антител.

Протокол, описанный ниже, могут быть использованы для выделения / обогащения EGFP-меченого ядра из специфических типов клеток у дрозофилы личинок тканей, для количественной оценки чистоты и выхода изолированных ядер и извлечь ядерную РНК подходит для количественного обратной транскрипции-полимеразной цепной реакции (Qrt -PCR) анализ экспрессии генов. Выделение и сродство-очистка ядер (исключая Тканье рассечение) может быть выполнена менее чем за один час. Результаты представлены показывающий, что глиальные ядра могут быть успешно выделены из личиночной оптической доли и глаз имагинального диска, и используется для последующего анализа экспрессии генов. Предполагается, что такой подход будет полезен для выделения / обогащения меченых ядер от эмбриональных и личиночных тканей, в которых клетки-мишени составляют менее 5% от общей численности населения. Все запасы Drosophila и плазмиды, полученные в этом исследовании, можно получить у авторов по запросу.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Генерация и характеристика EGFP :: KASH дрозофилы

  1. Водитель Крест Gal4 летит к UAS-EGFP :: MSP-300 KASH летит. Кроме того, рекомбинантные мух, которые осуществляют как драйвер Gal4 и трансген UAS-EGFP :: MSP-300 Кэш могут быть получены с использованием стандартных методов генной. Этот второй подход выгоден, если требуется большое количество потомства.
  2. Охарактеризуйте экспрессию маркера EGFP :: KASH с использованием стандартных методов микроскопии. Примечание: выражение EGFP можно наблюдать с помощью стандартных методов микроскопии в расчлененных, фиксированных Drosophila тканей, или в целом личинок, и не требует применение антитела.
    1. Определить схему экспрессии EGFP :: KASH маркер во всем организме под флуоресцентным микроскопом рассечения (см. материалы PDF). Примечание: многие водители Gal4, включая водителя репо-GAL4, показанной на рисунке 1, выставочная пonspecific паттерны экспрессии в других личинок тканей, таких как слюнной железы (см. результаты).
    2. Анализ паттерн экспрессии EGFP :: Kash в расчлененного интересующей ткани с помощью конфокальной микроскопии.
      1. Закрепить интересующей ткани с использованием формальдегида в конечной концентрации 4%, и пятна ДНК с использованием DAPI в конечной концентрации 0,1 мкг / мл визуализировать локализацию EGFP :: KASH тег по отношению к ДНК.
      2. Получение изображений с использованием либо 40X / 1,30 иммерсионным объективом или 20X / 0,75 масло иммерсионный объектив, в зависимости от размера интересующей ткани. Следующие условия возбуждения / испускания может быть использован для получения изображения: 408 нм nm/425-475 (DAPI); 488 нм / 525-550 нм (GFP).

2. Изолировать ядер от дрозофилы тканей личинки

  1. Подготовка оборудования для личинок вскрытия ткани и последующего ядер изоляции. Обратите внимание, чтоdechorionated целые эмбрионы также могут быть использованы в качестве исходного материала при желании. Рекомендуется использовать частично рассеченные ткани личинок, а не всей личинок, если тип клеток интерес присутствует в конкретной ткани, такой как имагинального диска. Это уменьшает неспецифическое связывание, а также устраняет проблемы, которые могут быть вызваны экспрессии некоторых драйверов Gal4 в нецелевых клеток.
    1. Подготовьте две пары острых щипцов (см. материалы PDF), один силиконизированный стеклянная пластина 9-а (см. материалы PDF) и PBT (1x PBS, рН 7,4, 0,1% Твин-20).
    2. Prebind на GFP антитела к магнитных шариков. Этот шаг должен быть запущен перед началом рассечение. Добавить 10 мкл магнитных шариков (Invitrogen, см. материалы PDF) и 2 мкг GFP антитела (Roche, см. материалы PDF) до 400 мкл промывочного буфера (1x PBS, рН 7,4, 2,5 мМ MgCl 2) в 1,5 мл трубки . Количество шариков и антитело, используемое может быть оптимизирована, если это необходимо в зависимости от количества мишени в СэмаPLE и аффинность связывания антитела с гранулами.
    3. Инкубируйте бусы и антитела при вращении в течение по крайней мере 30 мин при комнатной температуре.
    4. Поместите 1.5 мл пробирку, содержащую бусы и антитела в магнитной стойке (см. материалы в формате PDF) и позволяют шарики для привязки к магнитная примерно 1-2 мин. Удалить супернатант, содержащий несвязанного антитела и мыть с использованием буфера 1 мл пипетки. Шарики останется связан с стенки 1,5 мл трубки на стороне, прилегающей к магниту.
    5. Промыть бусы в два раза 1 мл буфера для промывок каждый раз, как описано в разделе 2.1.4. Снимите 1,5 мл трубку от магнитной стойке и кратко инвертировать смешать шарики и мыть буфер во время каждого шага стирки.
    6. Храните шарики антиген-антитело в промывочного буфера до готовности продолжить с шага 2.7. Шарики не должны высыхать на любой стадии протокола.
  2. Проанализируйте тканей личинки в PBT и передать расчлененные тканей дляодна скважина из тарелки 9-а. Как правило, рассечение зрительного доли и глаз имагинального диска от 100 личинок третьей возрастной стадии дает достаточно материала для последующей анализа экспрессии генов следующие ядер изоляции.
  3. Промыть выделенную ткань в буфере ядерного экстракции (10 мМ HEPES-KOH, рН 7,5; 2,5 мМ MgCl 2, 10 мМ КСl) в 1,5 мл трубки. Трансфер изолированных тканей личинки к 1 мл Dounce гомогенизатора (см. материалы PDF) на льду, который содержит 1 мл свежего буфера ядерной экстракции. Инкубируют на льду в течение 5 мин. Нет необходимости добавлять ингибиторы протеазы, если РНК должны быть извлечены следующие ядер изоляции.
  4. Нарушить ткани на 20 ударов с рыхлой пестиком и затем инкубировать образец на льду в течение 10 мин, чтобы позволить клеткам расти. Выписка ядра из клеток с использованием 15 ударов с близким пестиком. Количество ударов с свободную и плотно пестики должен быть оптимизирован для различных тканей и типов клеток; избыток гомогенизации может привести кстриженая ядра, в то время как недостаточно гомогенизации не будет извлекать все ядра из ткани.
  5. Фильтр гомогената, который содержит ядра и продукты распада клеток, через размером пор сито 40 мкм (см. материалы PDF), который был prerinsed с ядерной буфере для гомогенизации. Сбор отфильтрованной гомогената в свежую пробирку.
  6. Соберите образцы предварительно изоляции для последующего анализа для определения ядер выход, целостность ядра, и для определения уровня Стенограмма генов-мишеней ранее к ядрам изоляцию.
    1. Передача 50 мкл отфильтрованной гомогената в свежую 1,5 мл пробирку с помощью пипетки. Это образец предварительно изоляции. Добавить 500 мкл Trizol реагента (см. материалы PDF, ВНИМАНИЕ), инвертировать смешивать, и хранить при температуре -20 ° C для последующего выделения РНК (шаг 3.1).
    2. Передача 20 мкл отфильтрованной гомогената в свежую 1,5 мл пробирку.
      1. Добавить DAPI в конечной концентрации 0,1 мкг / мл, и вклUbate образец на льду в течение 10 мин.
      2. Трансфер DAPI-окрашенные ядра к покровным покрытием поли-лизин, и поместить на предметное стекло микроскопа. Уплотнение покровное использованием четких лак для ногтей.
      3. Проверьте целостность ядра и наличие GFP с метками ядер, представляющих интерес с помощью флуоресцентного микроскопа. Примечание: Это не обязательно, чтобы исправить ядра, или окрасить для GFP если эти слайды анализируются достаточно быстро следующих подготовки (в пределах 24 ч).
    3. Передача 10 мкл отфильтрованной гомогената в свежую 1,5 мл пробирку и добавить 90 мкл промывочного буфера (1x PBS, рН 7,4, 2,5 мМ MgCl 2). Добавить DAPI в конечной концентрации 0,1 мкг / мл, и инкубируют на льду в течение 10 мин. Определить доходность ядер в образце предварительно изоляции с помощью гемоцитометра сосчитать DAPI-позитивных ядер с помощью эпифлуоресцентной под воздуха цели 10X.
  7. Поместите 1.5 мл пробирку, содержащую бусы антиген-антитело (подготовленные в разделе 2.1.6) в магнитном стойке,и позволяют магнитные шарики для привязки к магниту, по крайней мере 2 мин, как описано в разделе 2.1.4. Извлеките промывочный буфер из шариков антиген-антитело с использованием 1 мл пипетки, а также добавить отфильтрованный гомогената с шагом 2,5 до 1,5 мл пробирку с использованием 1 мл пипетки.
  8. Аккуратно инвертировать трубки несколько раз, чтобы смешать и инкубировать при температуре 4 ° С в течение 30 мин с конца в конец по перемешивании. Избежать пузырьков в трубе, если возможно, так как это может привести к слипания ядер.
  9. Поместите 1.5 мл пробирку, содержащую шарики антиген-антитело и гомогената в магнитном стойке, и позволяют магнитные шарики для привязки к магниту, по крайней мере 2 мин, как описано в разделе 2.1.4. Удалить гомогената, содержащего фракцию несвязанного ядер с использованием 1 мл пипетки.
  10. Промыть образец 3x с 1 мл промывочного буфера каждый раз. Извлеките 1,5 мл пробирку, содержащую бусы, связанных ядер и промывочный буфер из стойки и инвертировать смешивать несколько раз, а затем поместить трубку в магнитном стойки, как описанона шаге 2.9 и удалить супернатант, используя 1 мл пипетки.
  11. Добавить 150 мкл промывочного буфера на шарики, которые должны быть связаны с ядрами мишени. Это образец после изоляции. Подготовка образцов для анализа микроскопии и последующего выделения РНК.
    1. Передача 20 мкл образца после изоляции в чистую пробирку 1,5 мл и пятно с DAPI и анализировать, как описано в разделе 2.6.2. Подсчитайте GFP + / DAPI + и GFP-/DAPI + ядра захваченных магнитных шариков, чтобы определить чистоту обогащенного GFP + ядер в образце после изоляции.
    2. Добавить 1 мл реагента Trizol к остальной части образца после изоляции, инвертировать, чтобы смешивать и хранить при -20 ° С для последующего выделения РНК (шаг 3,1). Примечание: Образцы в триазол могут быть сохранены в течение нескольких недель, при необходимости при -20 ° С Нет необходимости, чтобы элюировать ядра из магнитных шариков до экстракции РНК с использованием тризола реагента, Becausе шарики не мешать последующим выделением РНК.

3. Определить уровни транскриптов в ядрах, выделенных из тканей личинки

  1. Изолировать РНК из предварительно изоляции и после изоляции образцов, полученных в разделах 2.6.1 и 2.11.2, используя стандартный протокол, описанный для экстракции РНК Trizol основе (см. материалы PDF) со следующими изменениями:
    1. После осаждения осадок РНК, добавьте 19,2 мкл РНКазы свободной воды и 0,8 мкл реагента RNASecure (см. материалы PDF) к осадку и инкубировать при 60 ° С в течение 20 мин для инактивации РНКазы.
  2. Определить концентрацию РНК со связывающим красителя люминесцентная-РНК, такие как комплект Кубит РНК анализа (см. материалы PDF) с помощью QubitR 2,0 флуорометр следуя протоколу производителя.
  3. Синтезируют кДНК с использованием усиливающей обратной транскриптазы, такие как EpiScrIPT обратной транскриптазы комплект и oligodT праймеров в соответствии с инструкциями изготовителя. Примечание: Как правило, от 50 до 100 нг РНК генерирует достаточное кДНК выполнить выражение множественный ген анализов. Эквивалентные количества предварительного выделения и после выделения РНК должна использоваться для генерации кДНК.
  4. Добавить 180 мкл нуклеазы без воды в 20 мкл образца кДНК разбавить этот 10-кратное перед реальном времени анализ количественной ПЦР (КПЦР). Это разбавление является важным шагом, так как неразбавленный образцы кДНК может ингибировать КПЦР.
  5. Подготовка КПЦР основной смеси с полимеразы и дНТФ, 4 пмоль каждого из прямого и обратного праймера, состоящий стерильной водой до конечного объема реакции 20 мкл.
    1. Дизайн КПЦР праймеров для генов-мишеней, что, как ожидается, быть выражены в типе клеток, представляющих интерес, так и на стадии развития, на которой ткань собирается. Дизайн праймеров для охватывают интрон, если это возможно, так что геномных иПродукты ПЦР кДНК можно выделить. Примечание: Если профиль экспрессии генов типа клетки-мишени не известно, праймеры против EGFP, который должен быть выражен в частности, в помеченной популяции ядер, могут быть использованы для оптимизации протокола для конкретного типа клеток и тканей (табл. 1).
  6. Определите относительные уровни транскриптов каждого гена интереса к предварительно изоляции и после изоляции образцов в сравнении с серии разведений кДНК, полученной из всей ткани. Уровни Стенограмма генов-мишеней должны быть нормализованы с опорным гена, таких как Rpl32 (или предпочтительно несколько опорных генов).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Водитель репо-GAL4 (Блумингтон инвентарный номер 7415) специфически экспрессируется в глиальных клеток в Drosophila нервной системы на нескольких этапах развития 18. Мухи были получены, которые стабильно экспрессируют UAS-EGFP :: MSP-300 Кэш под контролем водителя репо-GAL4 с использованием стандартных методов генной. Для характеристики схему экспрессии EGFP :: KASH трансгенов в этих мух, паттерн экспрессии GFP в расчлененного зрительного доли и глаз имагинального диска от третьего личинок возрастной стадии исследовали с помощью конфокальной микроскопии. Препарированные ткани контрастно с DAPI, чтобы отметить ДНК и с α-chaoptin 19 маркировать фоторецепторов аксоны (mAb24B10, см. материалы PDF). рис. 1А показывает, что репо-GAL4 приводом EGFP :: KASH трансген выражается в глии в зрительных долях и глаз имагинального диска в предполагаемой схемы экспрессии. Под большим увеличением,Выражение EGFP наблюдается по круговой схеме, окружающей DAPI-позитивных ДНК, в соответствии с ядерным огибающей локализации EGFP :: KASH Tag (фиг.1В). Выражение EGFP могут быть обнаружены как в стационарных и в нефиксированных тканей без необходимости усиления сигнала с использованием антитела против GFP; антитела против GFP не используется для визуализации EGFP :: экспрессии KASH в изображениях, показанных на рисунках 1 и 2. Чтобы определить, трансген EGFP :: KASH выражается неспецифически в любых других тканей в личинок дрозофилы, выражение GFP был рассмотрен в целом личинок третьего возраста с использованием флуоресценции вскрытии микроскопом. Следует отметить, что неспецифический выражение EGFP :: KASH трансген наблюдалось при высоких уровнях в слюнных железах личинок третьей возрастной стадии. Это указывает на то, что водитель репо-GAL4 обладает активностью в некоторых типах клеток, отличных от глии в личиночной стадии развития. Таким образом, чтобы специально выделить GLIЯдра др., зрительный доли и глаз имагинальная диск с третьего личинок возрастной стадии были выделены с использованием рассечение перед гомогенизации и сродства-изоляции.

Чтобы подтвердить, что этот протокол подходит для извлечения ядер от дрозофилы тканей, и оценить процент меченых ядер, присутствующих в данной ткани, образца до изоляции (раздел 2.6.2) из гомогенатах, полученных из зрительного доли и глаз имагинальная диск репо-GAL4, UAS-EGFP :: MSP-300 KASH третьей стадии личинок исследовали. фиг.2А показан репрезентативный изображение образца предварительно изоляции получены с использованием конфокальной микроскопии. На этом изображении, присутствие ядер обозначено DAPI-позитивных событий. Наблюдаются также небольшое количество редко разбросанных GFP-положительных, DAPI-позитивных глиальных ядер. По нашим оценкам, GFP-положительных ядер составляют менее 2% от общей численности населения ядер в этомОбразец (рис. 2а). Общий выход ядра от зрительного доли и глаз имагинальных дисков, которые были расчлененных от 100 личинок определяли для образца до изоляции, как описано в разделе 2.6.3 (табл. 2). Типичный образец предварительно изоляция от 100 расчлененных оптических лепестков и глаз имагинальных дисках, содержащихся между 0,8 и 1,2 х 10 7 ядер, из которых около 2% были GFP-положительных. показывает, представитель образ DAPI-позитивных ядер в определенной области из гемоцитометре. Обратите внимание, что ядра не повреждены, и поддерживать последовательную круглую форму в условиях экстракции, используемых в протоколе (фиг.2А и 2В).

Чтобы определить, является ли этот протокол может быть использован для изоляции и / или высоко обогащать конкретных группах меченых ядер из тканей, содержащих смешанные клеточные популяции, α-GFP антителами магнитные шарики были использованиег изолировать отмеченных ядер от гомогенатах, полученных из зрительного доли и глаз имагинального диска 100 репо-GAL4, UAS-EGFP :: MSP-300 KASH третьего возраста личинок. На рисунках 2C и 2D, можно видеть, что EGFP :: KASH отмеченных глиальных ядер связываются с α-GFP с покрытием магнитных шариков и наблюдаются в образце после изоляции (раздел 2.11.1) после магнитной сепарации. Несмотря на то, магнитные шарики демонстрируют некоторую аутофлюоресценция в GFP канала, они могут быть легко дифференцированы от борта с привязкой ядер их меньшего размера (2,8 мкм для магнитных шариков по сравнению с приблизительно 5 мкм для ядер) и отсутствие окрашивания DAPI. В GFP + / DAPI + ядер приходится более 95% DAPI позитивных событий в образце после изоляции. Таким образом, целевая отмеченных ядер население сильно обогащены в пост-изоляции образца по отношению к предварительной изоляцииобразец. Большинство ядер в пост-изоляция образец шоу сильного ядерного конверта локализованной GFP флуоресценции и, как правило, в окружении бус. Тем не менее, вполне возможно, что небольшое количество непомеченных ядер также могут присутствовать в данном образце. Таким образом, хотя результаты на фиг.2С и в анализе экспрессии генов на фиг.3 (см. ниже) показывает, что целевой меткой глиальных население ядра сильно обогащенный возможность того, что некоторые ядра от некоторых других типов клеток неспецифических также присутствуют в образце не может быть исключена. Рекомендуется пользователям оптимизировать этот протокол для их конкретного типа клеток и тканей, представляющих интерес для максимального обогащения населения ядрами мишени, и, чтобы исключить неспецифические ядра обязательными. В частности, отношение исходного материала по отношению к антителу и бисером, вероятно, будет важным для оптимального обогащения ядер мишени. По этой причине, диапазоны общего числаколичество ядер, присутствующих в наших типичных образцов предварительно изоляции приведены в таблице 2. На основе общих ядер чисел, присутствующих в образце предварительно изоляции, а расчетная доля глиальных клеток в смешанной популяции из зрительного доли и глаз имагинального диска, максимальный выход ядра в образце после изоляции как ожидается, будет между 1,6 х 10 5 и 2,4 х 10 5 ядер. Однако, используя гемоцитометра для определения выхода ядер, как описано в шаге 2.6.3, фактический урожай ядра получены в образце после изоляции был между 1,3 х 10 4 и 2,7 х 10 4 ядра. Эти ядра дает представляют собой очень грубые оценки, потому что шарики, присутствующие в образце после изоляции, кажется, влияет точную загрузку гемоцитометре. Некоторые GFP-положительных ядер наблюдаются в несвязанной гомогената, указывая, что не все GFP-положительных ядер в сдостаточно связывают с гранулами эффективно в условиях, используемых в данном протоколе. Увеличение времени связывания или при выполнении последовательных шагов изоляции потенциально может увеличить этот выход, но это может происходить за счет обоих чистоты и целостности РНК. В условиях, описанных в данном протоколе, достаточное количество РНК могут быть получены в образце после изоляции для нисходящего анализа экспрессии генов путем Qrt-PCR (табл. 2). Таким образом, этот протокол способен быстро и жестко изолировать ядрами мишени из тканей, содержащих смешанные популяции клеток. Кроме того, он способен специально изолировать ядрами мишени, которые составляют лишь небольшую часть, менее 5%, клеток в данной популяции.

Для дальнейшего подтверждения, что образец пост-изоляция была высоко обогащенные для нашей целевой глиальных населения ядер, уровни транскриптов для 4 различных генов в предварительной изоляции после изоляции образцы по сравнению с RT-КПЦР. Уровни Стенограмма Elav, nrv2 и EGFP были определены в двух образцов, и нормированы на опорной гена, Rpl32, которая выражается в эквивалентных уровней в глиальных клетках и в окружающем центральной нервной системы (рис. 3). Разница раза в образце после изоляции показана относительно образца предварительно изоляции, который установлен в единицу. На рисунке 3, образец после изоляции показывает значительно более низкие уровни Стенограмма нейронов-специфический ген Elav относительно образца до изоляции. Это указывает на то, что ядра из нервных клеток недостаточно представлены в образце после изоляции. В отличие от этого, более высокие уровни транскриптов обоих глиальных обогащенный геном nrv2 10 и EGFP присутствуют в пост-IsolaТион образец относительно образца до изоляции. Этот результат показывает, что образец пост-изоляция высоко обогащенного для глиальных населения ядер мишени. Важно отметить, что измеренные уровни транскриптов в данном протоколе представляют ядерных транскриптов, и, следовательно, скорее всего, указывают на уровень активной транскрипции, а не стационарные мРНК. Воспроизводимые выражение репо не был обнаружен либо в наших предварительно выделения или после изоляции образцов, предполагая, что белок Gal4 выразил драйвером репо-GAL4 может сохраняться после активного транскрипции гена эндогенного репо перестал. Это согласуется с результатами других исследований, в которых ядра меченые помощью TWI промотор не показывают обогащенные уровни TWI транскриптов, возможно, связано с различиями в сроках развития транскрипции против стабильности белка 8. Такан вместе, эти результаты показывают, что описано протокол может быть успешно использован для обогащения высоко ядер мишени из тканей, содержащих смешанные популяции клеток, и что изолированные ядра являются подходящими для анализа экспрессии генов.

Рисунок 1
Рисунок 1. Выражение картина репо-GAL4, UAS-EGFP :: MSP-300 KASH летать линии. (А) В третьем личинок возрастной стадии, репо-GAL4 диски экспрессию трансгена UAS-EGFP :: MSP-300 KASH в глиальных клеток в зрительном доля, оптический стебель (ОС) и глаз имагинальная диск (редактор). Ядерная оболочка в глиальных клетках помечен EGFP :: Kash (зеленый). R1 - R8 фоторецепторов клеток аксоны помечены α-chaoptin (mAB24B10, красный) для сравнения, и ДНК станцииINED с DAPI (фиолетовый). GFP-меченых глиальные ядра могут видеть вдоль пластинки (LA) в течение зрительного лепестка (отмечены стрелками). Шкала бар, 50 мкм. (В) Высшее увеличенное изображение пластинки ганглиев зрительного доли, которая содержит EGFP :: Kash помечены глиальных ядер клеток. Шкала бар, 50 мкм. Конфокальные изображения были получены с использованием либо   40X / 1.30 масло или   20X / 0,75 иммерсионным цель, и используя длины волн возбуждения / эмиссии 408 nm/425-475 нм (DAPI); 488 nm/525-550 нм (GFP); 561 nm/595-620 нм (Alexa 5,6,8 ). Пожалуйста, нажмите здесь, чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 2
Рисунок 2. Характеристика ядерв "предварительно изоляции» и «пост-изоляции" образцов. (А) представитель изображения из репо-GAL4, UAS-EGFP :: MSP-300 KASH образец предварительно изоляции анализировали, используя X 20 / 0,75 иммерсионным цель и стандарт конфокальной микроскопии. ДНК окрашивали DAPI (синий), и EGFP :: KASH отмеченных глиальные ядра показаны зеленым цветом (отмечены стрелками). Шкала бар, 50 мкм. (В) представитель образ DAPI-окрашенных ядер от образца до изоляции на гемоцитометре с помощью X 10 воздуха цели и стандартное эпифлюорисцентной микроскопа. Гемоцитометра сетки приведены в светло-серый. Только DAPI-позитивных ядер показаны на этом изображении, как флуоресценции GFP не было видно под этой цели на эпифлуоресцентной микроскопом. (C) Представитель изображение с репо-GAL4, UAS-EGFP :: MSP-300 KASH образца после изоляциианализировали, как описано для панели А. Выделенный EGFP :: KASH отмеченных глиальные ядра (отмечены стрелками) пятно положительно для DAPI, и окружены бисера, которые autofluoresce на низких уровнях в GFP канала. Шкала бар, 50 мкм. (D) Высшее увеличенное изображение типичного изолированного EGFP :: KASH отмеченных глиальные ядра (отмечены стрелкой), окруженные бисером. Шкала бар, 5 мкм. Пожалуйста, нажмите здесь, чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 3
Рисунок 3. Представительства данных Qrt-ПЦР из "предварительной изоляции» и «пост-изоляции" образцов. Уровни Стенограмма генов-мишеней были определены Qrt-ПЦР предварительно изолAtion и после изоляции образцы, полученные от репо-GAL4, UAS-EGFP :: MSP-300 Kash оптические долей и глаз имагинальных дисках. Все уровни транскриптов нормированы на уровни транскриптов Rpl32 и образец предварительно изоляция для каждого гена-мишени установлен в единицу. Представитель результаты от одного биологического эксперимента показаны для следующих генов: Elav, nrv2 и EGFP.

Ген Праймер последовательности (5 '-3') Размер ПЦР-продукт (п.н.)
EGFP GAGGGATACGTGCAGGAGAG 102
GATCCTGTTGACGAGGGTGT
nrv2 GGCTGGTTGTAGTCGCAGTT 125
GGCACCCAACACGAGAACTA
Elav GCACCATTCGGAGCAATAAT 153
TGTGCAGCTGGATGGTGTAG
Rpl32 GCTAAGCTGTCGCACAAATG 160
CGTTGTGCACCAGGAACTT

Таблица 1. Праймеры, используемые для анализа Qrt-PCR.

Общее количество ядер в образце предварительно изоляции Расчетное общее число ядер в образце после изоляции РНК выход от образца после изоляции (нг)
0,8 - 1,2 х 10 7 1.3 - 2.7 х 10 4 160-220 нг

Таблица 2. Представительства ядер и дает РНК, полученные.Типичные области ядер и дает РНК, полученных из предварительно изоляции и после изоляции образцов от 100 расчлененного зрительного доли и глаз имагинальных дисках с репо-GAL4, UAS-EGFP :: MSP-300 KASH генотипа, в которой глиальные клетки, меченные EGFP :: KASH. Ядра количественно, как описано в 2.6.3 и РНК подвергали количественному анализу, как описано в 3.1.2.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Этот протокол может быть использован для выделения или сильно обогатить специальные коды ядра от населения смешанных клеток в Drosophila эмбриональных или тканей личинки. Используя этот протокол, ядра могут быть выделены из рассеченных тканей в приблизительно 1 часа. Чистота и выход из изолированных ядер должно быть определено экспериментально для каждого типа клеток. Это может быть трудно дать количественную оценку шарик с привязкой ядра на этапе пост-изоляции протокола с использованием гемоцитометра из-за шариков, находящихся в образце. Таким образом, если точные цифры ядер требуются для применения ниже по потоку, то это будет необходимо оценить ядер выход на основе альтернативного метода, такого как содержание ДНК. Точные расчеты ядер доходности не являются необходимыми для анализа экспрессии генов, если РНК может быть успешно выделены и количественно. Рекомендуется использовать метод флуоресценции на основе количественного выхода РНК, как мы обнаружили, что спектрофотометрического определения концентрации РНКв этих образцах низких концентраций сильно варьирует.

Есть два важных аспекта протокола, которые будут влиять его успех: выбор магнитных шариков и антитела. Магнитные шарики, которые соединены с GFP или белка G являются коммерчески доступными из нескольких различных источников. Тем не менее, настоятельно рекомендуется использовать белковые G магнитных шариков доступные из Invitrogen для процедурой, описанной в данном протоколе по двум основным причинам. Во-первых, размер гранул Invitrogen на 2,8 мкм немного меньше, чем средний размер ядер в клеточных типов рассмотренных нами, что примерно 5 мкм (рис. 2D). Магнитные шарики, которые меньше (например, 50 нм, μMACS α-GFP, Miltenyi Biotech) не быстро связываются с магнитами периодического мытья стиля, а столбцы, предусмотренные для этих шариков может засорить с экстрактами личинок ткани. Большие магнитные шарики (например, 10 мкм, PureProteome белок G магнитного бEADS, Millipore) не связывается также к ядрам в наших предварительных испытаний, и они также обладают сильной аутофлюоресценция в одних и тех же каналов в качестве как DAPI и GFP, что делает его трудно идентифицировать ядра в бисерной связанного образца стандартными методами микроскопии. В дополнение к выбору магнитных шариков, важно использовать GFP антитела, который хорошо работает для иммунопреципитации но который не имеет высокую неспецифическую фон. Для помощи в воспроизводимости этом протоколе, мы использовали моноклональное антитело мыши против GFP. Поликлональные кроличьи антитела против GFP были также успешно опробована в наших предварительных исследований, но они, как правило, имеют более высокие неспецифическую фон. Другие моноклональные антитела были также проверены (например Развивающие Исследования гибридом банк), с различной степенью успеха. Таким образом, выбор антитело является важным фактором в успешной изоляции меченых ядер.

Хотя в этом протоколе описываются методы Detгорностай уровни гена транскриптов в изолированных ядрах, ожидается, что подход, описанный в шагах 2.1-2.11 также будут пригодны для выделения ядра, которые можно использовать для последующего анализа иммунопреципитации хроматина. Если ткань фиксируется в 1% формальдегида до гомогенизации (шаг 2.3), то рассеченные ткани могут быть собраны в течение нескольких дней, а также достаточный материал изоляции выполнять хроматина анализ иммунопреципитации. На основе отсчетов, полученных с использованием гемоцитометра, которые обеспечивают только грубые оценки, как описано выше, обычно получают 1,3 × 10 4 и 2,7 × 10 4 глиальные ядра из глаза имагинального диска и оптической доли 100 личинок (табл. 2). Таким образом, используя наш подход, это должно быть возможным, чтобы получить достаточное количество материала, чтобы выполнить анализ иммунопреципитации хроматина, в зависимости от избытка целевого типа клеток, а также интерес эпитопа.

Одним из полезных генетическая применение этого технидие, что он может быть использован для обозначения положительно ядра в конкретных типах клеток у эмбрионов или личинок, которые являются гомозиготными по рецессивным летальным мутантного аллеля. Чтобы достичь этого, две отдельные запасы мухи должны быть сгенерированы в которой мутантный аллель интерес объединяется с конкретным водителем Gal4 или с UAS-EGFP :: MSP-300 KASH трансгена на третьем хромосоме. Если мухи, несущие мутантный аллель и водителя Gal4 скрещены на мух, несущих мутантные аллели и трансген UAS-EGFP :: MSP-300 Kash, только потомство, которое имеет обе копии мутантного аллеля будут помечены GFP в ткани, в которой водитель Gal4 выражается. Таким образом, сотовые конкретных эффекты рецессивных летальных аллелей может быть рассмотрен в эмбриональных или личиночной стадии, до стадии летальности. Этот генетический метод был ранее использован для положительно маркировать клетки в эмбриональное мышцы, которые были гомозиготными по мутации в SAGA субъединицы, sgf11 1 </ SUP>.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего раскрывать.

Acknowledgments

Мы благодарим Дженис Фишер за предоставление плазмиды UAS-EGFP :: MSP-300 Kash. MAB24B10 антитела были получены от развивающего исследований гибридом банка, разработанных под эгидой NICHD и поддерживается в Университете штата Айова, биологический факультет. Репо-GAL4 складе (BL7415) был получен из фондовой Центра Блумингтон при Университете Индианы. Поддержка со стороны Американского онкологического общества Institutional Research Грант (IRG # 58-006-53) в Университетском центре Пердью по исследованию рака является благодарностью. Jingqun Ма поддерживается в сельскохозяйственных исследований Пердью ассистента в продовольствия и сельского хозяйства в Университете Пердью.

Materials

Name Company Catalog Number Comments
Anti-chaoptin antibody (mouse, monoclonal) Developmental Studies Hybridoma Bank mAB24B10
Anti-GFP antibody (mouse, monoclonal) Roche 11814460001 This specific antibody is recommended for this protocol. However, alternative antibodies could also be used.
2x Bullseye EvaGreen qPCR Mastermix with ROX MidSci BEQPCR-R
DAPI (4',6-diamidino-2-phenylindole, dihydrochloride salt) Biotium 40011
Dounce Homogenizer (1 ml) VWR 62400-595
Dumont #5 Tweezers, 11 cm World Precision Instruments 14095
Dynabeads Protein G for Immunoprecipitation Invitrogen 10003D This specific brand of magnetic beads is recommended for this protocol.
EpiScript Reverse Transcriptase Epicentre ERT12910K http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf
Falcon cell strainers, 40 μm pore size VWR 21008-949 Alternative pore sizes could be used, depending on the size of the target cell nuclei.
Magnetic stand (8 x 1.5 ml tubes) Millipore LSKMAGS08 
Mini tube rotator Genemate H-6700
Qubit starter kit Life Technologies Q32871 Similar fluorescence-based methods for quantifying RNA yield could be used. http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdfZ
RNAsecure (Ambion) Life Technologies AM7010 The use of this reagent to inactivate RNAses is optional.
RT-PCR machine Thermal Cycler BioRad CFX Connect Thermal Cycler
Siliconized 9-well glass plate Hampton Research HR3-134
Stereomicroscope Fluorescence Adapter (Royal Blue (440-460 nm) excitation + yellow barrier Nightsea This adaptor enables GFP fluorescence to be examined using a typical dissecting microscope (eg Nikon)
StereoZoom Microscope 83604 Set with 10X Wide Field Eyepieces and Universal Boom Stand Nikon SMZ 745
Thermal Cycler BioRad T100
Trizol reagent Life Technologies 15596018 CAUTION; Alternative RNA extraction methods can be used. http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf
Tween 20 Amresco 0777-1L

DOWNLOAD MATERIALS LIST

References

  1. Weake, V. M., et al. Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation. Genes Dev. 25, 1499-1509 (2011).
  2. Bonn, S., et al. Cell type-specific chromatin immunoprecipitation from multicellular complex samples using BiTS-ChIP. Nat. Protoc. 7, 978-994 (2012).
  3. Haenni, S., et al. Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq. Nucleic Acids Res. 40, 6304-6318 (2012).
  4. Barthelson, R. A., Lambert, G. M., Vanier, C., Lynch, R. M., Galbraith, D. W. Comparison of the contributions of the nuclear and cytoplasmic compartments to global gene expression in human cells. BMC Genom. 8, 340 (2007).
  5. Zhang, C., Barthelson, R. A., Lambert, G. M., Galbraith, D. W. Global characterization of cell-specific gene expression through fluorescence-activated sorting of nuclei. Plant Physiol. 147, 30-40 (2008).
  6. Deal, R. B., Henikoff, S. The INTACT method for cell type-specific gene expression and chromatin profiling in Arabidopsis thaliana. Nat. Protoc. 6, 56-68 (2011).
  7. Deal, R. B., Henikoff, S. A simple method for gene expression and chromatin profiling of individual cell types within a tissue. Dev Cell. 18, 1030-1040 (2010).
  8. Steiner, F. A., Talbert, P. B., Kasinathan, S., Deal, R. B., Henikoff, S. Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Genom. Res. 22, 766-777 (2012).
  9. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, 401-415 (1993).
  10. Henry, G. L., Davis, F. P., Picard, S., Eddy, S. R. Cell type-specific genomics of Drosophila neurons. Nucleic Acids res. 40, 9691-9704 (2012).
  11. Starr, D. A. KASH and SUN proteins. Curr Biol. 21, 414-415 (2011).
  12. Fischer, J. A., et al. Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics. 168, 1385-1393 (2004).
  13. Patterson, K., et al. The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol. Biol. Cell. 15, 600-610 (2004).
  14. Yu, J., et al. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev. Biol. 289, 336-345 (2006).
  15. Bischof, J., Maeda, R. K., Hediger, M., Karch, F., Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007).
  16. Kracklauer, M. P., Banks, S. M., Xie, X., Wu, Y., Fischer, J. A. Drosophila klaroid encodes a SUN domain protein required for Klarsicht localization to the nuclear envelope and nuclear migration in the eye. Fly. 1, 75-85 (2007).
  17. Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40, 476-483 (2008).
  18. Sepp, K. J., Schulte, J., Auld, V. J. Peripheral glia direct axon guidance across the CNS/PNS transition zone. Dev. Biol. 238, 47-63 (2001).
  19. Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A., Shotwell, S. L. Monoclonal antibodies against the Drosophila nervous system. Proc. Natl. Acad. Sci. U.S.A. 79, 7929-7933 (1982).
Affinity основе Выделение Tagged ядер от<em&gt; Дрозофилы</em&gt; Ткани для анализа экспрессии генов
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).More

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter