Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Isolamento à base de Afinidade de Tagged Núcleos de doi: 10.3791/51418 Published: March 25, 2014

Summary

Tecidos de Drosophila contêm muitas vezes uma mistura heterogénea de tipos celulares. Para examinar a expressão de genes em tipos específicos de células a partir de um tecido em particular, os núcleos podem ser geneticamente marcado e, subsequentemente, isolado usando uma abordagem baseada em afinidade. Isolado núcleos pode ser utilizado para aplicações a jusante, tais como a análise de expressão génica e imunoprecipitação da cromatina.

Abstract

Tecidos embrionários e de larvas de Drosophila melanogaster, muitas vezes contêm uma mistura altamente heterogénea de tipos de células, o que pode complicar a análise da expressão dos genes nestes tecidos. Assim, para analisar os perfis de expressão de genes específicos de células a partir de tecidos de Drosophila, pode ser necessário isolar os tipos de células específicas, com elevada pureza e em rendimentos suficientes para aplicações a jusante, tais como o perfil de transcrição e imunoprecipitação da cromatina. No entanto, a morfologia celular irregular em tecidos, tais como o sistema nervoso central, juntamente com a população rara de tipos específicos de células nestes tecidos, pode apresentar desafios para os métodos tradicionais de isolamento de células, tais como por microdissecção laser e células activadas por fluorescência (FACS) . Aqui, uma abordagem alternativa para caracterizar os perfis de expressão de genes específicos de células usando o isolamento com base em afinidade de núcleos marcados, em vez de células intactas, está descrito. Núcleos do c específicoell tipo de interesse são geneticamente marcado com um marcador EGFP localizada envelope nuclear utilizando o sistema de expressão binário Gal4/UAS. Estes núcleos marcaram-EGFP pode ser isolado utilizando anticorpos contra GFP que são acoplados a esferas magnéticas. A abordagem descrita neste protocolo permite o isolamento de núcleos coerente de tipos de células específicas no sistema central nervoso larvas de Drosophila em elevado grau de pureza e em quantidades suficientes para análise de expressão, mesmo quando estes tipos de células compreendem menos de 2% da população total de células na tecido. Esta abordagem pode ser usada para isolar os núcleos a partir de uma ampla variedade de Drosophila embrionárias e tipos de células de larvas usando condutores Gal4 específicas, e podem ser úteis para o isolamento de núcleos a partir dos tipos de células que não são adequados para FACS ou microdissecção a laser.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tecidos de Drosophila, tais como o sistema nervoso central contém uma mistura complexa de tipos de células. Assim, para analisar os perfis de expressão de genes específicos de células a partir de tecidos de Drosophila, que é necessário em primeiro lugar isolar uma população homogénea de células específicas em quantidades suficientes para permitir aplicações a jusante. Os métodos para isolar as células de tecidos intactos incluem microdissecção a laser, e de células activadas por fluorescência (FACS) de células inteiras. Enquanto FACS tem sido usado para isolar as células e os núcleos a partir de embriões de Drosophila e de Caenorhabditis elegans para a expressão do gene e cromatina de perfis 1-3, FACS e microdissecção laser pode ser difícil de realizar com sucesso em tecidos que contêm tipos de células altamente misturados entre si ou que contêm células com morfologia irregular, tais como os neurónios. Para ultrapassar esta dificuldade, os núcleos, em vez de células podem ser isoladas a partir de tipos de células específicos e utilizado para subsequente gene perfil de expressão. Importante, com base em análise de expressão de mRNA microarray utilizando amostras de RNA nucleares apresenta resultados geralmente comparável à realizada utilizando RNA total 4, 5. Além disso, a análise da expressão de genes usando o RNA nuclear tem sido usado com êxito para estudar a expressão de genes em vários organismos, incluindo C. elegans, Arabidopsis thaliana, de Drosophila, e seres humanos 4, 5 2, 3.

Várias abordagens têm sido recentemente descrita para o isolamento de populações específicas de núcleos marcados a partir de tecidos de Drosophila que são adequados para análise da expressão do gene e / ou da cromatina imunoprecipitação. O isolamento lote de cromatina tecido-específicas para o método de imunoprecipitação (bits-chip) utiliza FACS para isolar núcleos fixos com base na expressão de tipo específico de célula de energia nuclear localizada GFP 2. Esta abordagem tem sido successfully utilizado para analisar a distribuição de modificações de histonas e factores de transcrição, utilizando a imunoprecipitação da cromatina de núcleos isolados a partir da mesoderme de embriões de Drosophila 2. No entanto, as abordagens baseadas em FACS pode ser menos adequado para o isolamento de núcleos marcados que constituem apenas uma pequena proporção de uma população mista, devido ao aumento do tempo de classificação necessária para obter números adequados para aplicações a jusante. Para superar estas limitações, vários grupos têm utilizado técnicas de isolamento à base de afinidade para purificar os núcleos, que são marcadas com um epitopo específico de um tipo de célula particular. O isolamento dos núcleos marcados em tipos específicos de células de método (intacto) desenvolvidos para uso em Arabidopsis thaliana, 6, 7, foi recentemente adaptado para uso em Drosophila 8. Neste método, uma proteína de fusão de envelope nuclear que é um substrato para in vivo biotinilação é coexpressed com a Escherichia coli biotina ligase BirA em tipos específicos de células. Núcleos marcados com biotina podem ser, posteriormente, purificado a partir de populações mistas, utilizando a afinidade de isolamento à base de estreptavidina. Utilizando esta abordagem, os núcleos foram rotulados com sucesso e isolado a partir da mesoderme de embriões de Drosophila, em que uma proteína de fusão de envelope nuclear foi expresso sob o controlo de um potenciador específico para mesoderme 8. Os autores também geradas proteínas de fusão de envelope nucleares que podem ser expressas em qualquer tipo de células sob o controlo da sequência reguladora GAL4 UAS 9. Esta abordagem é capaz de isolar rapidamente subconjuntos de núcleos marcados a partir de populações mistas, mas requer três construções transgénicas separadas e podem, portanto, ser inadequada para aplicações genéticas particulares. Recentemente, uma aproximação tem sido descrita na qual SOL (S AD1 e C-84 da ONU) proteínas contendo o domínio que se localizam na membrana interior do envelope nuclear foram etiquetados comas proteínas fluorescentes e expresso sob o controlo do sistema Gal4/UAS 10. Os núcleos foram isolados na presença de detergente não iónico para remover a membrana externa do envelope nuclear, e de afinidade-purificada utilizando esferas magnéticas acopladas a anticorpos anti-GFP. Esta abordagem foi usada com sucesso para isolar pequenas populações de núcleos marcados de subtipos neuronais específicas no cérebro adulto de Drosophila 10.

Aqui, um protocolo para o isolamento de núcleos marcados a partir de uma população mista de células a partir de tecido de larvas de Drosophila é descrito. Este método foi desenvolvido de forma independente, mas é semelhante ao método descrito por Henry et al. 10 Em primeiro lugar, os núcleos foram marcadas com um marcador fluorescente que é expresso apenas em tipos de células específicos em Drosophila melanogaster para facilitar o subsequente isolamento de núcleos marcados a partir de populações mistas usando uma abordagem baseada em afinidade. Para identificar os núcleos,foi utilizado o domínio KASH (K larsicht / D nc-1 / S ino h omology). O domínio KASH é um domínio de transmembrana que se localiza na membrana externa do envelope nuclear, em parte através de interacções com proteínas contendo o domínio SUN dentro do espaço perinuclear 11. O domínio KASH C-terminal de proteínas, tais como as de Drosophila MSP-300 e Klarsicht ancora estas proteínas para a membrana nuclear externa, ao passo que os seus domínios N-terminais interagir com proteínas do citoesqueleto tais como actina ou microtúbulos no citoplasma 12-14. As construções foram geradas em que o domínio de Drosophila KASH MSP-300 foi fundido com o terminal C de EGFP, sob o controlo da sequência reguladora GAL4 UAS no vector pUAST attB-15, 16. Usando a integração específica de sítio phiC31, moscas transgénicas foram geradas em que os UAS-EGFP :: MSP-300 KASH transgene foi inserido no locus no cromossoma attP23L 17. A UAS-EGFP :: MSP-300 KASH moscas podem ser cruzadas com moscas que expressam Gal4 o condutor em um tipo particular de células, o que resulta na expressão do alvo de EGFP na membrana nuclear externa no tipo celular de interesse. Núcleos marcados podem então ser purificados a partir de populações de células misturadas, utilizando anticorpos contra GFP acoplados a esferas magnéticas. Nesta abordagem, não é necessária a utilização de detergente não iónico, porque a etiqueta de EGFP está localizada ao lado citoplasmático da membrana nuclear externa, e é, portanto, acessível aos anticorpos.

O protocolo abaixo descrito pode ser utilizado para isolar / enriquecer núcleos marcados com EGFP de tipos específicos de células de Drosophila em tecidos larvais, para quantificar a pureza e o rendimento de núcleos isolados, e para extrair o RNA nuclear apropriado para a transcrição reversa-reacção da polimerase em cadeia quantitativa (qRT -PCR), a análise da expressão do gene. O isolamento e purificação de afinidade-núcleos (excluindo tissue dissecção) pode ser realizada em menos de uma hora. Os resultados são apresentados mostrando que os núcleos da glia podem ser isolados com sucesso a partir do lóbulo óptica das larvas e do olho do disco imaginal, e usado para posterior análise da expressão do gene. Prevê-se que esta abordagem seja útil para o isolamento / enriquecimento de núcleos marcados a partir de tecidos embrionários e de larvas, em que as células alvo constituem menos de 5% da população geral. Todas as ações de Drosophila e plasmídeos gerados por este estudo estão disponíveis a partir dos autores, mediante solicitação.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Geração e Caracterização de EGFP :: KASH Drosophila

  1. Cruz Gal4 motorista voa para UAS-EGFP :: MSP-300 KASH voa. Alternativamente, moscas recombinantes que transportam tanto o condutor de Gal4 e do transgene UAS-EGFP :: MSP-300 KASH pode ser gerada utilizando técnicas genéticas convencionais. Esta segunda abordagem é vantajoso se forem necessárias grandes quantidades de progenitura.
  2. Caracterizar a expressão do marcador EGFP :: KASH usando técnicas de microscopia padrão. Nota: expressão EGFP pode ser observada por técnicas de microscopia de padrão em dissecadas, fixas tecidos de Drosophila, ou em conjunto larvas, e não requer a utilização de um anticorpo.
    1. Determinar o padrão de expressão de EGFP :: KASH marcador em todo o organismo sob um microscópio de fluorescência de dissecação (ver Materiais PDF). Nota: Muitos controladores de Gal4, incluindo o controlador de repo-GAL4 mostrado na Figura 1, n exibemonspecific padrões de expressão em outros tecidos, tais como larvas da glândula salivar (ver Resultados).
    2. Analisar o padrão de expressão de EGFP :: KASH no tecido dissecado de interesse através de microscopia confocal.
      1. Fixar o tecido de interesse, utilizando formaldeído numa concentração final de 4%, e ADN de mancha utilizando DAPI, a uma concentração final de 0,1 ug / ml para visualizar a localização da EGFP :: KASH marcação em relação ao ADN.
      2. Aquisição de imagens utilizando uma objectiva de 40x / 1,30 óleo de imersão ou uma objectiva 20X / 0,75 imersão de óleo, dependendo do tamanho do tecido de interesse. As seguintes condições de excitação / emissão podem ser utilizados para a aquisição de imagens: 408 nm/425-475 nm (DAPI), 488 nm / 525-550 nm (GFP).

2. Isolar Núcleos de Drosophila larval Tecidos

  1. Preparar equipamentos para a dissecção dos tecidos larval e posterior isolamento núcleos. Note-se quedechorionated embriões inteiros também pode ser utilizado como material de partida, se desejado. Recomenda-se utilizar tecidos de larvas parcialmente dissecados em vez de larvas inteira, se o tipo de células de interesse está presente em um tecido específico, tal como o disco imaginal. Isto reduz a ligação não específica, e também elimina os problemas que podem ser causados ​​pela expressão de alguns condutores Gal4 em células não alvo.
    1. Preparar dois pares de pinças cortantes (ver Materiais PDF), um 9-siliconizada bem placa de vidro (ver Materiais PDF) e PBT (1x PBS, pH 7,4, 0,1% de Tween-20).
    2. Prebind o anticorpo GFP às pérolas magnéticas. Esta etapa deve ser iniciada antes do início da dissecção. Adicionar 10 uL de pérolas magnéticas (Invitrogen, ver Materiais PDF) e 2 ug de anticorpo GFP (Roche, ver Materiais PDF) para 400 ul de tampão de lavagem (1x PBS, pH 7,4, 2,5 mM de MgCl 2) em um tubo de 1,5 ml . A quantidade de pérolas e o anticorpo utilizado pode ser optimizada se necessário, com base na quantidade de alvo na samplo e a afinidade de ligação do anticorpo às pérolas.
    3. Incubar as pérolas e o anticorpo com rotação durante pelo menos 30 min à temperatura ambiente,.
    4. Colocar o tubo de 1,5 ml contendo as contas e do anticorpo no suporte magnético (ver Materiais PDF) e permitem que as esferas se liguem ao magnética para aproximadamente 1-2 min. Retirar o sobrenadante contendo o anticorpo não ligado e tampão de lavagem, utilizando uma pipeta de 1 ml. Os grânulos permanecerá ligada à parede do tubo de 1,5 ml, no lado adjacente ao íman.
    5. Lave as contas duas vezes com 1 ml de tampão de lavagem de cada vez, conforme descrito no ponto 2.1.4. Remover o tubo de 1,5 ml a partir da cremalheira magnética e inverter momentaneamente para misturar os grânulos e tampão de lavagem, durante cada etapa de lavagem.
    6. Guarde as contas ligadas a anticorpos em tampão de lavagem até que esteja pronto para continuar com o passo 2.7. As contas não devem ser autorizados a secar em qualquer fase do protocolo.
  2. Dissecar tecidos larvais em PBT e transferir tecidos dissecados paraum poço da 9-bem prato. Normalmente, a dissecção do lobo óptico e olho disco imaginal de 100 larvas de terceiro instar fornece material suficiente para a análise de expressão gênica a jusante após isolamento núcleos.
  3. Lavar o tecido isolado em tampão de extracção nuclear (10 mM HEPES-KOH, pH 7,5, 2,5 mM de MgCl 2, 10 mM de KCl) em um tubo de 1,5 ml. Transferir tecidos larvais isoladas para um homogeneizador Dounce de 1 ml (ver Materiais PDF) em gelo que contém 1 ml de tampão de extracção nuclear fresco. Incubar no gelo por 5 min. Não é necessário adicionar os inibidores de protease, se o RNA é para ser extraída a seguir ao isolamento de núcleos.
  4. Perturbar o tecido por 20 ciclos com o pilão solta e depois incubar a amostra em gelo durante 10 minutos para permitir que as células inchar. Extrair os núcleos das células, utilizando 15 pancadas com o pil apertado. O número de golpes com os pilões soltos e apertados precisa ser otimizado para diferentes tecidos e tipos de células; excesso de homogeneização pode resultar emnúcleos cortados, enquanto homogeneização insuficiente não irá extrair todos os núcleos do tecido.
  5. Filtrar o homogeneizado, que contém os restos nucleares e celulares, por meio de um 40 um tamanho de poros de filtro (ver Materiais PDF) que foi prerinsed com tampão de homogeneização nuclear. Recolhe-se o homogeneizado filtrado num tubo fresco.
  6. Coletar amostras de pré-isolamento para posterior análise para determinação do rendimento de núcleos, a integridade núcleos, e para determinar os níveis de transcrição de genes-alvo antes de núcleos isolados.
    1. Transferência de 50 ul do homogenato filtrado para um tubo de 1,5 ml fresco utilizando uma pipeta. Esta é a amostra de pré-isolamento. Adicionar 500 mL de reagente Trizol (ver Materiais PDF, CUIDADO), invertido para misturar e armazenar a -20 ° C para posterior isolamento do RNA (passo 3.1).
    2. Transferir 20 uL de homogeneizado do filtrado para um novo tubo de 1,5 ml.
      1. Adicionar DAPI para uma concentração final de 0,1 ug / ml, e incUbate amostra em gelo durante 10 min.
      2. Transferir núcleos DAPI-manchadas de uma lamela revestido poli-lisina, e coloque sobre uma lâmina de microscópio. Selar a lamela usando claro unha polonês.
      3. Verifique a integridade núcleos, e presença de núcleos GFP de interesse que usam o microscópio fluorescente. Nota: Não é necessário fixar os núcleos, ou para manchar para GFP se esses slides são analisadas razoavelmente rápido após a preparação (dentro de 24 horas).
    3. Transferência de 10 ul do homogenato filtrado para um novo tubo de 1,5 mL e adicionar 90 ul de tampão de lavagem (1x PBS, pH 7,4, 2,5 mM de MgCl2). Adicionar DAPI para uma concentração final de 0,1 ug / ml, e incubar em gelo durante 10 min. Determine o rendimento núcleos na amostra pré-isolamento usando um hemocitômetro para contar os núcleos DAPI-positivos usando epifluorescência sob um objetivo ar 10X.
  7. Colocar o tubo de 1,5 ml contendo as contas de anticorpo ligado (preparado na secção 2.1.6) num rack magnético,e permitir que as pérolas magnéticas de se ligar ao íman, pelo menos, 2 minutos, conforme descrito na secção 2.1.4. Remover o tampão de lavagem das pérolas com o anticorpo ligado, usando uma pipeta de 1 ml, e adiciona-se o homogeneizado filtrado do passo 2.5 para o tubo de 1,5 ml usando uma pipeta de 1 ml.
  8. Inverter o tubo várias vezes para misturar e incubar a 4 ° C durante 30 min com extremidade-sobre-extremidade agitação. Evitar bolhas no tubo, se possível, uma vez que estas podem resultar na aglomeração dos núcleos.
  9. Colocar o tubo de 1,5 ml contendo as contas e homogeneizado ligados a anticorpos em uma cremalheira magnética, e permitem que as esferas magnéticas para se ligar ao íman, pelo menos, 2 minutos, conforme descrito na secção 2.1.4. Remover o homogenato contendo a fracção de núcleos não ligada, utilizando uma pipeta de 1 ml.
  10. Lava-se a amostra 3x com 1 ml de tampão de lavagem de cada vez. Remover o tubo de 1,5 ml contendo as contas de vidro, núcleos ligados e tampão de lavagem a partir da prateleira e inverter a mistura várias vezes, em seguida, colocar o tubo na cremalheira magnético como descritono passo 2.9 e remover o sobrenadante utilizando uma pipeta de 1 ml.
  11. Adicionar 150 ul de tampão de lavagem para os grânulos, os quais devem ser ligados aos núcleos de alvo. Esta é a amostra de pós-isolamento. Preparar amostras para análise de microscopia e extração de RNA subseqüente.
    1. Transferir 20 uL da amostra de pós-isolamento de um novo tubo de 1,5 ml e mancha com DAPI e analisar tal como descrito na secção 2.6.2. Contar o GFP + / + e DAPI GFP-/DAPI + núcleos capturados por esferas magnéticas para determinar a pureza da GFP enriquecido + núcleos na amostra de pós-isolamento.
    2. Adicionar 1 ml de reagente Trizol para o restante da amostra de pós-isolamento, inverter para misturar e armazenar a -20 ° C para subsequente isolamento de ARN (passo 3.1). Nota: As amostras em Trizol pode ser armazenada durante várias semanas, caso seja necessário a -20 ° C. Não é necessário para eluir os núcleos dos grânulos magnéticos antes da extracção de ARN usando o reagente Trizol, because os grânulos não interferir com o subsequente isolamento do RNA.

3. Determinar níveis de transcrição em núcleos isolados de tecidos larval

  1. Isolar RNA a partir das pré-isolamento e de pós-isolamento amostras preparadas nas seções 2.6.1 e 2.11.2 usando o protocolo padrão descrito para a extração de RNA baseado em Trizol (ver Materiais PDF) com as seguintes modificações:
    1. A seguir à precipitação do sedimento de ARN, adicionar 19,2 mL de água sem RNase e 0,8 ul de reagente RNASecure (ver Materiais PDF) para o sedimento e incubar a 60 ° C durante 20 min para inactivar ARNases.
  2. Determinar a concentração de RNA com um corante fluorescente de ligação-ARN, tais como o kit de ensaio de RNA Qubit (ver Materiais PDF) utilizando o 2,0 Fluorometer QubitR seguindo o protocolo do fabricante.
  3. Sintetizar ADNc, utilizando uma ampliação de transcriptase reversa, tais como a EpiScript kit da transcriptase reversa e iniciadores oligodT seguindo as instruções do fabricante. Nota: normalmente, de 50 a 100 ng de RNA gera ADNc suficiente para realizar a expressão de genes múltiplos análises. Quantidades equivalentes de pré-isolamento e RNA pós-isolamento deve ser utilizada para gerar ADNc.
  4. Adicionar 180 mL de água isenta de nuclease para o cDNA de amostra de 20 ul para diluir este antes da análise em tempo real de 10 vezes por PCR quantitativa (qPCR). Esta diluição é um passo importante, porque as amostras não diluídas de cDNA pode inibir a qPCR.
  5. Prepara-se uma mistura principal qPCR com polimerase e dNTPs, 4 pmoles de cada um de iniciador directo e inverso, fez-se com água esterilizada, para o volume de reacção final de 20 ul.
    1. Projete primers qPCR para atingir genes que são esperados para ser expressa no tipo celular de interesse, e no estágio de desenvolvimento em que o tecido é coletada. Conceber iniciadores para abrangem um intrão, se possível, de modo que genómico eprodutos de PCR de cDNA podem ser distinguidos. Nota: Se o perfil do tipo de célula alvo a expressão do gene não é conhecida, os iniciadores contra eGFP, que deve ser expresso especificamente na população de núcleos com etiquetas, pode ser utilizado para optimizar o protocolo para um tipo particular de células e tecidos (Tabela 1).
  6. Determinar os níveis relativos de transcritos de cada gene de interesse em amostras pré-e pós-isolamento de isolamento por comparação com uma série de diluição de cDNA preparado a partir de todo o tecido. Níveis de transcrição de genes-alvo deve ser normalizada a um gene de referência, tais como Rpl32 (ou, de preferência vários genes de referência).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O controlador de repo-GAL4 (Bloomington número de stock 7415) é expresso especificamente nas células da glia do sistema nervoso Drosophila em vários estágios de desenvolvimento 18. As moscas foram geradas que estavelmente expressam UEA-EGFP :: MSP-300 KASH sob o controlo do controlador de repo-GAL4 utilizando técnicas genéticas convencionais. Para caracterizar o padrão de expressão da EGFP :: KASH transgene nestes moscas, o padrão de expressão da GFP no lóbulo óptica dissecados e olho disco imaginal a partir de larvas de terceira instar foram examinadas utilizando microscopia confocal. Tecidos dissecados foram contrastadas com DAPI para marcar o DNA e com α-chaoptin 19 para etiquetar axónios dos fotorreceptores (mAb24B10, ver Materiais PDF). Figura 1A mostra que a EGFP dirigida repo-GAL4 :: KASH transgene é expresso em células gliais nos lobos ópticos e olho disco imaginal no padrão de expressão esperado. De acordo com uma ampliação maior,Expressão EGFP é observada em um padrão circular em torno do ADN DAPI-positiva, consistente com a localização nuclear de envelope do EGFP :: KASH Tag (Figura 1B). Expressão EGFP pode ser detectado tanto em fixo e nos tecidos não fixados, sem a necessidade de amplificação do sinal, utilizando um anticorpo contra GFP; anticorpos contra GFP não foram usados ​​para visualizar a expressão EGFP :: KASH nas imagens mostradas nas Figuras 1 e 2. Para determinar se o transgene EGFP :: KASH é expresso de forma não específica em quaisquer outros tecidos em larvas de Drosophila, a expressão da GFP foi analisada em larvas de terceiro instar inteiro usando um microscópio de fluorescência de dissecação. Notavelmente, a expressão não específica do EGFP :: KASH transgene foi observada em níveis elevados nas glândulas salivares de larvas de terceiro instar. Isto indica que o controlador de repo-GAL4 tem actividade em alguns outros do que as células gliais na fase larval do desenvolvimento tipos de células. Assim, para isolar especificamente glinúcleos al, o lóbulo óptica e olho disco imaginal a partir de larvas de terceira instar foram isolados utilizando uma dissecção antes da homogeneização e afinidade-isolamento.

Para confirmar que este protocolo é adequado para a extracção de núcleos a partir de tecidos de Drosophila, e a estimativa da percentagem de núcleos marcados presentes num dado tecido, a amostra de pré-isolamento (secção 2.6.2) a partir de homogeneizados obtidos a partir do lóbulo óptica e olho disco imaginal de repo-GAL4 UAS-EGFP :: MSP-300 KASH larvas de terceiro instar foi examinada. Figura 2A mostra uma imagem representativa da amostra de pré-isolamento obtido utilizando microscopia confocal. Nesta imagem, a presença de núcleos é indicado por eventos DAPI-positivo. Também são observados Um pequeno número de GFP positivas, núcleos gliais DAPI positivas pouco dispersos. Estimamos que os núcleos GFP positivas representam menos do que 2% do total da população de núcleos nesteamostra (Figura 2A). O rendimento total de núcleos de lóbulo óptica e olho discos imaginais que foram dissecados a partir de 100 larvas foi determinada para a amostra de pré-isolamento, tal como descrito na secção 2.6.3 (Tabela 2). Um exemplo típico de pré-isolamento de 100 lóbulo óptica e olho discos imaginais dissecados continham entre 0,8 e 1,2 x 10 7 núcleos, dos quais cerca de 2% eram GFP-positiva. Figura 2B mostra uma imagem representativa de núcleos DAPI-positivas na região definida do hemocitómetro. Note-se que os núcleos estão intactas, e manter uma forma circular coerente sob as condições de extracção utilizadas no protocolo (Figuras 2A e 2B).

Para determinar se este protocolo pode ser utilizado para isolar e / ou altamente enriquecer populações específicas de núcleos marcados a partir de tecidos que contêm populações de células misturadas, α-GFP revestidas com anticorpo contas magnéticas eram usod para isolar núcleos marcados a partir de homogeneizados obtidos a partir do lóbulo óptico e olho disco imaginal de 100 repo-GAL4, UAS-EGFP :: MSP-300 KASH larvas de terceiro instar. Nas Figuras 2C e 2D, pode ser visto que a EGFP :: KASH marcado glial ligam núcleos para as esferas magnéticas revestidas α-GFP e são observadas na amostra de pós-isolamento (secção 2.11.1) após a separação magnética. Embora as esferas magnéticas exibem alguns autofluorescência no canal de GFP, estes podem ser facilmente diferenciados dos núcleos de talão ligado a pelo seu tamanho pequeno (2,8 mm para as esferas magnéticas contra cerca de 5 mm para os núcleos) e falta de coloração com DAPI. Os GFP + / DAPI + núcleos são responsáveis ​​por mais de 95% dos eventos positivos DAPI na amostra de pós-isolamento. Assim, o alvo marcado população núcleos são altamente enriquecido na amostra de pós-isolamento em relação ao pré-isolamentoamostra. A maioria dos núcleos da amostra indicam pós-isolamento forte nuclear envelope localizada fluorescência da GFP, e são geralmente rodeado por pérolas. No entanto, é possível que um pequeno número de núcleos não marcados podem também estar presentes na amostra. Assim, embora os resultados na Figura 2C e na análise da expressão do gene na Figura 3 (ver abaixo) indica que o alvo marcado população núcleos gliais é altamente enriquecida, a possibilidade de alguns núcleos a partir de outros tipos de células não-específicos também estão presentes na amostra não pode ser excluída. Recomenda-se que os utilizadores optimizar este protocolo para o seu tipo particular de célula e de tecido de interesse para maximizar o enriquecimento da população de núcleos de alvo, e para eliminar os núcleos não específicos de ligação. Em particular, a proporção de material de partida em relação ao anticorpo e pérolas é provável que seja importante para o enriquecimento óptimo de núcleos de alvo. Por este motivo, as gamas do totalnúmeros de núcleos presentes nas amostras de pré-isolamento típicos são apresentados na Tabela 2. Com base nos números totais de núcleos presentes na amostra pré-isolamento, e a percentagem estimada de células gliais na população mista do lóbulo da óptica do olho e do disco imaginal, o teor máximo de núcleos na amostra de pós-isolamento foi prevista para estar entre 1,6 5 x 10 e 2,4 x 10 5 núcleos. No entanto, utilizando o hemocitómetro para determinar o rendimento de núcleos, conforme descrito no passo 2.6.3, o rendimento de núcleos real obtido na amostra de pós-isolamento era entre 1,3 x 10 4 a 2,7 x 10 4 núcleos. Estes rendimentos núcleos representam estimativas muito ásperas porque as contas presentes na amostra pós-isolamento parece afetar o carregamento preciso do hemocitômetro. Alguns núcleos GFP positivas são observadas no homogeneizado não ligado, indicando que nem todos os núcleos GFP positivas nos sampla ligam para as contas de forma eficiente, nas condições utilizadas neste protocolo. O aumento do tempo de ligação ou de efectuar os passos de isolamento sequenciais poderia potencialmente aumentar este rendimento, mas este pode vir à custa de tanto a pureza e integridade do RNA. Usando as condições descritas no presente protocolo, quantidades suficientes de ARN pode ser obtida na amostra de pós-isolamento para jusante a análise da expressão do gene por qRT-PCR (Tabela 2). Assim, este protocolo é capaz de rapidamente e com rigor isolar núcleos-alvo a partir de tecidos que contêm populações mistas de células. Além disso, é capaz de isolar especificamente núcleos alvo que constituem apenas uma pequena proporção, menor do que 5%, do que as células de uma dada população.

Para confirmar ainda que a amostra de pós-isolamento foi altamente enriquecido para a população de núcleos glial alvo, os níveis de transcritos de quatro genes diferentes no pré-isolamento pós-isolamento amostras foram comparadas por RT-qPCR. Os níveis de transcrição de elav, nrv2 e eGFP foram determinados em duas amostras, e normalizada para o gene de referência, Rpl32, que é expresso em níveis equivalentes de células gliais e no sistema nervoso central circundante (Figura 3). A diferença vezes na amostra de pós-isolamento é mostrado em relação à amostra pré-isolamento, o qual é definido como um. Na Figura 3, a amostra de pós-isolamento mostra níveis de transcrição significativamente inferiores do específico do gene elav neuronal em relação à amostra pré-isolamento. Isso indica que os núcleos de células neuronais estão sub-representadas na amostra pós-isolamento. Em contraste, os níveis de transcrição elevados de ambos o gene nrv2 enriquecido glial-10 e eGFP estão presentes no pós-isolamentoção da amostra em relação à amostra pré-isolamento. Este resultado indica que a amostra de pós-isolamento é altamente enriquecida para a população de núcleos glial alvo. É importante notar que os níveis de transcritos medidos neste protocolo representam transcritos nucleares, e, por conseguinte, é provável que indicam os níveis de transcrição activa em vez de mRNA de estado estacionário. Expressão reprodutível de repo não foi detectado em ambos os exemplos de pré-ou pós-isolamento de isolamento, o que sugere que a proteína Gal4 expresso pelo condutor repo-GAL4 pode persistir após transcrição activa do gene endógeno repo cessou. Isto é consistente com os resultados de outros estudos em que núcleos marcados usando o promotor twi não mostram os níveis de enriquecimento de transcritos twi, talvez devido a diferenças no tempo de desenvolvimento de transcrição contra a estabilidade da proteína 8. Taken conjunto, estes resultados demonstram que o protocolo descrito pode ser usado com sucesso para enriquecer altamente núcleos alvo a partir de tecidos que contêm populações misturadas de células, e que os núcleos isolados são adequados para análise da expressão do gene.

Figura 1
Figura 1. Padrão de expressão de repo-GAL4, UAS-EGFP :: MSP-300 KASH linha voar. (A) Em larvas de terceiro instar, repo-GAL4 dirige a expressão do transgene UAS-EGFP :: MSP-300 KASH em células gliais na óptica lobo, perseguir óptica (os) e olho disco imaginal (ed). O envelope nuclear em células gliais é rotulado com EGFP :: KASH (verde). R1 - R8 axónios de células fotorreceptoras são rotulados com α-chaoptin (mAB24B10, vermelho) para comparação, e DNA é stainada com DAPI (roxo). Núcleos gliais GFP-rotulados são visíveis ao longo da lâmina (la) no lobo óptico (marcado por setas). Barra de escala, 50 mm. (B) imagem ampliação Superior dos gânglios da lâmina do lóbulo óptico que contém EGFP :: KASH rotulado núcleos de células gliais. Barra de escala, 50 mm. Imagens confocal foram adquiridos usando um   40X / 1,30 óleo ou uma   20X / 0,75 objetivo óleo de imersão, e usando comprimentos de onda de excitação / emissão de 408 nm nm/425-475 (DAPI); 488 nm/525-550 nm (GFP); 561 nm/595-620 nm (Alexa 5,6,8 ). Clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2. Caracterização dos núcleosem "pré-isolamento" e "pós-isolamento" amostras. (A) Imagem representativa de um repo-GAL4, UAS-EGFP :: MSP-300 KASH amostra pré-isolamento analisados ​​usando um X 20 / 0,75 objetiva de imersão em óleo e padrão microscópio confocal. DNA é corado com DAPI (azul), e EGFP :: KASH marcado núcleos gliais são mostrados em verde (marcado por setas). Barra de escala, 50 mm. (B) imagem representativas dos núcleos DAPI-corados de uma amostra pré-isolamento em um hemocitómetro utilizando uma objectiva de 10 X de ar e de um microscópio de epifluorescência padrão. Grids hemocitômetro são mostrados em cinza claro. Só núcleos DAPI-positivos são mostrados nesta imagem, como GFP fluorescência não era visível no âmbito deste objectivo no microscópio de epifluorescência. (C) Imagem representativa de um repo-GAL4, UAS-EGFP :: MSP-300 KASH amostra pós-isolamentoanalisados ​​como descrito para o painel A. EGFP O isolado :: KASH marcado núcleos gliais (marcadas por setas) mancha positivamente para DAPI, e estão rodeados por as contas, que autofluoresce em baixos níveis no canal de GFP. Barra de escala, 50 mm. (D) imagem ampliação Superior de EGFP isolado típico :: KASH marcado núcleos gliais (marcado pela seta) cercado por esferas. Barra de escala, 5 mm. Clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3. Dados qRT-PCR representativos de "pré-isolamento" e amostras de "pós-isolamento". Níveis de transcrição de genes alvo foram determinadas por qRT-PCR de pré-ISOLation e pós-isolamento amostras obtidas a partir de repo-GAL4, UAS-EGFP :: lobos ópticos MSP-300 KASH e olho discos imaginais. Todos os níveis de transcrição são normalizados para níveis de transcrição Rpl32, e a amostra de pré-isolamento para cada gene alvo é definido como um. Os resultados representativos de um experimento biológico são mostrados para os seguintes genes: elav, nrv2 e eGFP.

Gene Sequência iniciadora (5 '-3') Tamanho do produto da PCR (bp)
eGFP GAGGGATACGTGCAGGAGAG 102
GATCCTGTTGACGAGGGTGT
nrv2 GGCTGGTTGTAGTCGCAGTT 125
GGCACCCAACACGAGAACTA
elav GCACCATTCGGAGCAATAAT 153
TGTGCAGCTGGATGGTGTAG
Rpl32 GCTAAGCTGTCGCACAAATG 160
CGTTGTGCACCAGGAACTT

Tabela 1. Iniciadores utilizados para a análise de qRT-PCR.

Número total de núcleos na amostra pré-isolamento Estimativa do número total de núcleos na amostra pós-isolamento Rendimento de RNA a partir de amostra de pós-isolamento (GN)
0,8-1,2 x 10 7 1,3-2,7 x 10 4 160-220 ng

Tabela 2. Núcleos representativos e os rendimentos obtidos de ARN.Gamas típicas de núcleos e os rendimentos obtidos a partir de amostras de RNA pré-isolamento e de pós-isolamento de 100 lobo óptica dissecados e olho discos imaginais da repo-GAL4, UAS-EGFP :: genótipo MSP-300 KASH, em que as células da glia são rotulados com EGFP :: KASH. Os núcleos foram quantificados como descrito em 2.6.3 e o ARN foi quantificado tal como descrito em 3.1.2.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Este protocolo pode ser utilizado para isolar ou enriquecer especificamente altamente núcleos marcados a partir de populações de células mistas na Drosophila embrionárias ou tecidos larvais. Usando este protocolo, os núcleos podem ser isoladas a partir de tecidos dissecados em aproximadamente 1 hora. A pureza e o rendimento dos núcleos isolados devem ser determinadas experimentalmente para cada tipo de célula. Pode ser difícil de quantificar os núcleos de talão ligado a na fase de pós-isolamento do protocolo usando um hemocitómetro causa dos grânulos presentes na amostra. Assim, se o número exacto de núcleos são necessários para uma aplicação a jusante, será necessário estimar rendimento núcleos com base em um método alternativo, como o conteúdo de DNA. Cálculos exactos das rendimento núcleos não são necessários para a análise da expressão do gene se o ARN pode ser isolado e quantificado com sucesso. Recomenda-se a utilização de um método com base em fluorescência para a quantificação de rendimento de ARN, como foi encontrado que a determinação espectrofotométrica da concentração de RNAnestas amostras de baixa concentração é altamente variável.

Há dois aspectos importantes do protocolo que irão influenciar o seu sucesso: a escolha do esferas magnéticas e de anticorpos. Esferas magnéticas que são acopladas para GFP ou proteína G estão disponíveis comercialmente a partir de várias fontes diferentes. No entanto, é altamente recomendado o uso de proteína G esferas magnéticas disponíveis da Invitrogen para o procedimento descrito no presente protocolo, por duas razões principais. Em primeiro lugar, o tamanho dos grânulos de Invitrogen em 2,8 um é ligeiramente menor do que o tamanho médio dos núcleos nos tipos de células que foram examinados, o que é cerca de 5 um (Figura 2D). Esferas magnéticas que são menores (por exemplo, 50 nm, μMACS α-GFP, Miltenyi Biotech) não se ligam rapidamente a estilo de lote-imans de lavagem, e as colunas fornecidas para esses grânulos podem entupir com extractos de tecidos das larvas. Maiores esferas magnéticas (por exemplo, 10 mM, a proteína G PureProteome magnético Beads, Millipore) não se ligam bem aos núcleos em nossos testes preliminares, e estes também apresentam forte autofluorescência nos mesmos canais que tanto DAPI e GFP, tornando difícil a identificação de núcleos na amostra ligado a talão por meio de técnicas de microscopia de padrão. Para além da escolha de contas magnéticas, é importante o uso de um anticorpo GFP que funciona bem para a imunoprecipitação, mas que não tem fundo inespecífico elevado. Para ajudar na reprodutibilidade deste protocolo, temos utilizado um anticorpo monoclonal contra GFP. Anticorpos policlonal de coelho contra GFP também foram testadas com sucesso em nossos estudos preliminares, mas estes tendem a ter maior fundo inespecífica. Outros anticorpos monoclonais também foram testados (por exemplo, do Desenvolvimento Estudos Hybridoma Bank), com variados níveis de sucesso. Assim, a escolha do anticorpo é um factor importante para o isolamento de núcleos marcados.

Embora neste protocolo, descrevemos métodos para detarminho níveis de transcrição de genes em núcleos isolados, prevê-se que o método descrito nos passos 2,1-2,11 também será adequado para o isolamento de núcleos, que podem ser utilizados para a subsequente análise de imunoprecipitação de cromatina. Se o tecido é fixado em 1% de formaldeído antes da homogeneização (passo 2.3), em seguida, os tecidos dissecados pode ser recolhida ao longo de vários dias e o material isolado suficiente para realizar uma análise de imunoprecipitação da cromatina. Com base em contagens obtidas usando o hemocitômetro, que fornecem apenas estimativas aproximadas, como discutido acima, que normalmente obtido 1,3 x 10 4 e 2,7 x 10 4 núcleos gliais do disco imaginal olho e lobo óptica de 100 larvas (Tabela 2). Assim, utilizando a abordagem, deve ser exequível para obter material suficiente para realizar uma análise de imunoprecipitação da cromatina, dependendo da abundância do tipo de célula alvo, e o epitopo de interesse.

Uma aplicação genética útil deste técQue é que ele pode ser usado para marcar positivamente núcleos em tipos específicos de células em embriões ou larvas que são homozigóticos para um alelo mutante recessivo letal. Para conseguir isto, duas unidades separadas mosca deve ser gerada, em que o alelo mutante de interesse é recombinado com um condutor de Gal4 específica, ou com o transgene UAS-EGFP :: MSP-300 KASH no terceiro cromossoma. Se moscas portadores do alelo mutante e condutor de Gal4 são cruzadas com moscas que transportam os alelos mutantes e o transgene UAS-EGFP :: MSP-300 KASH, apenas progenitura que têm ambas as cópias do alelo mutante vai ser marcado com GFP no tecido em que o condutor de Gal4 é expresso. Assim, os efeitos específicos de células de alelos recessivos letais podem ser examinados nos estágios embrionários ou de larvas, antes da fase de letalidade. Esta técnica genética tem sido usado para rotular positivamente células no músculo embrionário que eram homozigotos para mutações na subunidade SAGA, sgf11 1 </ Sup>.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

Agradecemos Janice Fischer para fornecer o plasmídeo UAS-EGFP :: MSP-300 KASH. O anticorpo mAB24B10 foi obtido a partir do Desenvolvimento Estudos Hybridoma Banco desenvolvido sob os auspícios do NICHD e mantido pela Universidade de Iowa, Departamento de Biologia. O estoque de repo-GAL4 (BL7415) foi obtido a partir do Bloomington Stock Center na Universidade de Indiana. O apoio da American Cancer Society Institutional Research Grant (IRG # 58-006-53) para a Universidade Purdue Centro para Pesquisa do Câncer é reconhecida com gratidão. Jingqun Ma é apoiado por uma Pesquisa Agrícola em Purdue Estágios em Alimentação e Agricultura da Universidade de Purdue.

Materials

Name Company Catalog Number Comments
Anti-chaoptin antibody (mouse, monoclonal) Developmental Studies Hybridoma Bank mAB24B10
Anti-GFP antibody (mouse, monoclonal) Roche 11814460001 This specific antibody is recommended for this protocol. However, alternative antibodies could also be used.
2x Bullseye EvaGreen qPCR Mastermix with ROX MidSci BEQPCR-R
DAPI (4',6-diamidino-2-phenylindole, dihydrochloride salt) Biotium 40011
Dounce Homogenizer (1 ml) VWR 62400-595
Dumont #5 Tweezers, 11 cm World Precision Instruments 14095
Dynabeads Protein G for Immunoprecipitation Invitrogen 10003D This specific brand of magnetic beads is recommended for this protocol.
EpiScript Reverse Transcriptase Epicentre ERT12910K http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf
Falcon cell strainers, 40 μm pore size VWR 21008-949 Alternative pore sizes could be used, depending on the size of the target cell nuclei.
Magnetic stand (8 x 1.5 ml tubes) Millipore LSKMAGS08 
Mini tube rotator Genemate H-6700
Qubit starter kit Life Technologies Q32871 Similar fluorescence-based methods for quantifying RNA yield could be used. http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdfZ
RNAsecure (Ambion) Life Technologies AM7010 The use of this reagent to inactivate RNAses is optional.
RT-PCR machine Thermal Cycler BioRad CFX Connect Thermal Cycler
Siliconized 9-well glass plate Hampton Research HR3-134
Stereomicroscope Fluorescence Adapter (Royal Blue (440-460 nm) excitation + yellow barrier Nightsea This adaptor enables GFP fluorescence to be examined using a typical dissecting microscope (eg Nikon)
StereoZoom Microscope 83604 Set with 10X Wide Field Eyepieces and Universal Boom Stand Nikon SMZ 745
Thermal Cycler BioRad T100
Trizol reagent Life Technologies 15596018 CAUTION; Alternative RNA extraction methods can be used. http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf
Tween 20 Amresco 0777-1L

DOWNLOAD MATERIALS LIST

References

  1. Weake, V. M., et al. Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation. Genes Dev. 25, 1499-1509 (2011).
  2. Bonn, S., et al. Cell type-specific chromatin immunoprecipitation from multicellular complex samples using BiTS-ChIP. Nat. Protoc. 7, 978-994 (2012).
  3. Haenni, S., et al. Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq. Nucleic Acids Res. 40, 6304-6318 (2012).
  4. Barthelson, R. A., Lambert, G. M., Vanier, C., Lynch, R. M., Galbraith, D. W. Comparison of the contributions of the nuclear and cytoplasmic compartments to global gene expression in human cells. BMC Genom. 8, 340 (2007).
  5. Zhang, C., Barthelson, R. A., Lambert, G. M., Galbraith, D. W. Global characterization of cell-specific gene expression through fluorescence-activated sorting of nuclei. Plant Physiol. 147, 30-40 (2008).
  6. Deal, R. B., Henikoff, S. The INTACT method for cell type-specific gene expression and chromatin profiling in Arabidopsis thaliana. Nat. Protoc. 6, 56-68 (2011).
  7. Deal, R. B., Henikoff, S. A simple method for gene expression and chromatin profiling of individual cell types within a tissue. Dev Cell. 18, 1030-1040 (2010).
  8. Steiner, F. A., Talbert, P. B., Kasinathan, S., Deal, R. B., Henikoff, S. Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Genom. Res. 22, 766-777 (2012).
  9. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, 401-415 (1993).
  10. Henry, G. L., Davis, F. P., Picard, S., Eddy, S. R. Cell type-specific genomics of Drosophila neurons. Nucleic Acids res. 40, 9691-9704 (2012).
  11. Starr, D. A. KASH and SUN proteins. Curr Biol. 21, 414-415 (2011).
  12. Fischer, J. A., et al. Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics. 168, 1385-1393 (2004).
  13. Patterson, K., et al. The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol. Biol. Cell. 15, 600-610 (2004).
  14. Yu, J., et al. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev. Biol. 289, 336-345 (2006).
  15. Bischof, J., Maeda, R. K., Hediger, M., Karch, F., Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007).
  16. Kracklauer, M. P., Banks, S. M., Xie, X., Wu, Y., Fischer, J. A. Drosophila klaroid encodes a SUN domain protein required for Klarsicht localization to the nuclear envelope and nuclear migration in the eye. Fly. 1, 75-85 (2007).
  17. Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40, 476-483 (2008).
  18. Sepp, K. J., Schulte, J., Auld, V. J. Peripheral glia direct axon guidance across the CNS/PNS transition zone. Dev. Biol. 238, 47-63 (2001).
  19. Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A., Shotwell, S. L. Monoclonal antibodies against the Drosophila nervous system. Proc. Natl. Acad. Sci. U.S.A. 79, 7929-7933 (1982).
Isolamento à base de Afinidade de Tagged Núcleos de<em&gt; Drosophila</em&gt; Tecidos para Análise de Expressão Gênica
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).More

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter