Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Isolation basée sur l'affinité de Tagged noyaux de doi: 10.3791/51418 Published: March 25, 2014

Summary

Tissus de Drosophila contiennent souvent un mélange hétérogène de types de cellules. Afin d'examiner l'expression des gènes dans des types de cellules spécifiques d'un tissu particulier, les noyaux peuvent être génétiquement marqués et ensuite isolés en utilisant une approche basée sur l'affinité. Des noyaux isolés peuvent être utilisés pour des applications en aval tels que l'analyse de l'expression génique et immunoprécipitation de la chromatine.

Abstract

Les tissus embryonnaires et les larves de Drosophila melanogaster contiennent souvent un mélange très hétérogène de types de cellules, ce qui peut compliquer l'analyse de l'expression génique dans ces tissus. Ainsi, pour analyser les profils d'expression de gènes spécifiques des cellules provenant de tissus de Drosophila, il peut être nécessaire d'isoler des types cellulaires spécifiques avec une grande pureté et à des rendements suffisants pour des applications en aval, tels que le profilage de la transcription et immunoprécipitation de la chromatine. Cependant, la morphologie cellulaire irrégulière dans des tissus tels que le système nerveux central, couplé à la population rare de types de cellules spécifiques dans ces tissus, peut poser des problèmes pour les méthodes traditionnelles d'isolement des cellules, tels que la microdissection laser et cellulaire activé par fluorescence (FACS) . Ici, une approche alternative pour la caractérisation des profils d'expression de gènes spécifiques des cellules en utilisant l'isolement par affinité à base de noyaux marqués, plutôt que des cellules entières, est décrite. Noyaux dans le c spécifiquetype d'intérêt de coude sont génétiquement marqué avec une étiquette de EGFP enveloppe nucléaire localisée en utilisant le système d'expression binaire GAL4/UAS. Ces noyaux d'EGFP-étiqueté peuvent être isolés en utilisant des anticorps contre la GFP qui sont couplés à des billes magnétiques. L'approche décrite dans ce protocole permet l'isolement cohérente des noyaux à partir de types de cellules spécifiques dans le système larvaire nerveux central chez la drosophile à haute pureté et à des niveaux suffisants pour une analyse d'expression, même si ces types de cellules comprennent moins de 2% de la population cellulaire totale dans l' tissu. Cette approche peut être utilisée pour isoler les noyaux à partir d'une grande variété de Drosophila embryonnaire et types de cellules en utilisant des larves de Gal4 pilotes spécifiques, et peut être utile pour isoler les noyaux de types de cellules qui ne conviennent pas pour FACS ou microdissection par laser.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Drosophila tissus tels que le système nerveux central contiennent un mélange complexe de types cellulaires. Ainsi, pour analyser les profils d'expression de gènes spécifiques des cellules provenant de tissus de Drosophila, il est d'abord nécessaire d'isoler une population homogène de cellules spécifiques dans des quantités suffisantes pour permettre à des applications en aval. Des procédés pour isoler des cellules provenant de tissus intacts comprennent microdissection par laser, et la cellule activé par fluorescence (FACS) de cellules entières. Bien que FACS a été utilisé pour isoler des cellules et des noyaux d'embryons de Drosophila et de Caenorhabditis elegans pour l'expression génique et la chromatine de profilage 1-3, FACS et microdissection laser peuvent être difficiles à effectuer avec succès dans des tissus qui contiennent des types de cellules très mélangés entre eux ou que les cellules contiennent avec morphologie irrégulière, telles que les neurones. Pour surmonter cette difficulté, plutôt que les noyaux des cellules peuvent être isolées à partir de types de cellules spécifiques et utilisés pour gen suivantee profilage de l'expression. Fait important, l'analyse d'expression de l'ARNm à base de puces à ADN, en utilisant des échantillons d'ARN nucléaires montre des résultats généralement comparables à celles effectuées en utilisant l'ARN total de 4, 5. En outre, l'analyse de l'expression du gène en utilisant l'ARN nucléaire a été utilisée avec succès pour étudier l'expression des gènes dans plusieurs organismes, y compris C. elegans, Arabidopsis thaliana, la drosophile, et les êtres humains 4, 5 2, 3.

Plusieurs approches ont été récemment décrite pour l'isolement de populations spécifiques de noyaux marqués à partir de tissus de Drosophila qui sont appropriés pour l'analyse de l'expression génique et / ou immunoprécipitation de la chromatine. L'isolement de lot de la chromatine tissu-spécifique pour la méthode immuno-précipitation (BiTS-Chip) utilise FACS pour isoler les noyaux fixes sur la base d'un type de cellule spécifique expression de la GFP nucléaire localisée 2. Cette approche a été successfully utilisé pour analyser la distribution des modifications des histones et des facteurs de transcription à l'aide d'immunoprécipitation de la chromatine des noyaux isolés du mésoderme d'embryons de Drosophila 2. Cependant, les approches basées sur FACS peuvent être moins approprié pour isoler noyaux marqués qui constituent seulement une petite proportion d'une population mixte en raison du temps de tri accrue nécessaire pour obtenir un nombre adéquat pour des applications en aval. Pour surmonter ces limitations, plusieurs groupes ont utilisé des techniques d'isolement basées sur l'affinité pour purifier les noyaux qui sont marqués avec un épitope spécifique d'un type cellulaire particulier. L'isolement des noyaux marqués dans des types cellulaires spécifiques de la méthode (INTACT) développés pour une utilisation chez Arabidopsis thaliana 6, 7 a récemment été adapté pour être utilisé chez la drosophile 8. Dans ce procédé, une protéine de fusion de l'enveloppe nucléaire qui est un substrat pour la biotinylation in vivo est coexpressed avec la biotine ligase de Escherichia coli BirA dans des types cellulaires spécifiques. les noyaux marqués à la biotine peuvent être ensuite purifiés à partir de populations mixtes à l'aide de l'isolement d'affinité basée streptavidine. En utilisant cette approche, les noyaux ont été marqués avec succès et le mésoderme isolés à partir d'embryons de Drosophila, dans lequel une protéine de fusion de l'enveloppe nucléaire a été exprimée sous le contrôle d'un amplificateur spécifique-8 du mésoderme. Les auteurs ont également généré des protéines nucléaires enveloppe de fusion qui peuvent être exprimées dans n'importe quel type de cellule sous contrôle de la séquence régulatrice Gal4, UAS 9. Cette approche est capable d'isoler rapidement des sous-ensembles de noyaux marqués de populations mixtes, mais nécessite trois constructions transgéniques distinctes et n'est donc pas adapté pour des applications génétiques particulières. Récemment, une approche a été décrite dans lequel SUN (S ad1 et C-84 des Nations Unies) des protéines contenant le domaine qui localisent à la membrane interne de l'enveloppe nucléaire ont été marqués pardes protéines fluorescentes et exprimé sous le contrôle du système GAL4/UAS 10. Les noyaux ont été isolés en présence d'un détergent non ionique pour enlever la membrane externe de l'enveloppe nucléaire, et purifié par affinité en utilisant des billes magnétiques couplées à des anticorps anti-GFP. Cette approche a été utilisée avec succès pour isoler de petites populations de noyaux marqués de sous-types de neurones spécifiques dans le cerveau adulte de Drosophila 10.

Ici, un protocole d'isolement des noyaux marqués à partir d'une population mixte de cellules de Drosophila tissu larvaire est décrite. Cette méthode a été développée de façon indépendante, mais est similaire à l'approche décrite par Henry et al. 10 Tout d'abord, les noyaux ont été marqués avec un marqueur fluorescent qui est exprimé uniquement dans des types cellulaires spécifiques chez Drosophila melanogaster pour faciliter l'isolement subséquent de noyaux marqués de populations mixtes en utilisant une approche basée sur l'affinité. Pour marquer les noyaux,le domaine KASH (K larsicht / A nc-1 / S yne h omology) a été utilisé. Le domaine KASH est un domaine transmembranaire qui localise à la membrane externe de l'enveloppe nucléaire, en partie grâce à des interactions avec le soleil protéines contenant le domaine au sein de l'espace périnucléaire 11. Le domaine de KASH C-terminale de protéines telles que Drosophila Msp-300 et Klarsicht ancre ces protéines de la membrane nucléaire externe, tandis que leurs domaines N-terminal d'interagir avec des protéines du cytosquelette telles que l'actine ou les microtubules dans le cytoplasme de 12 à 14. Les constructions ont été générées, dans lequel le domaine de Drosophila KASH Msp-300 a été fusionnée à l'extrémité C-terminale de l'EGFP, sous le contrôle de la séquence régulatrice de Gal4, UAS dans le vecteur pUAST-attB 15, 16. Utilisation phiC31 intégration spécifique de site, les mouches transgéniques ont été générées, dans lequel les UAS-EGFP :: Msp-300 KASH transgène a été inséré dans le locus sur le chromosome attP23L 17. Le SAMU-EGFP :: Msp-300 KASH vole peut être croisée avec les mouches qui expriment le pilote Gal4 dans un type cellulaire particulier, résultant dans l'expression ciblée de EGFP sur la membrane nucléaire externe dans le type cellulaire d'intérêt. Noyaux marqués peuvent ensuite être purifiés à partir de populations cellulaires mixtes utilisant des anticorps contre la GFP couplés à des billes magnétiques. Dans cette approche, l'utilisation d'un détergent non-ionique n'est pas nécessaire parce que la balise EGFP est localisée sur le côté cytoplasmique de la membrane nucléaire externe, et est donc accessible à des anticorps.

Le protocole décrit ci-dessous peut être utilisé pour isoler / enrichir noyaux EGFP marqué à partir de types de cellules spécifiques dans Drosophila tissus larvaires, pour quantifier la pureté et le rendement de noyaux isolés, et l'extrait d'ARN nucléaire approprié pour la transcription inverse couplée avec polymérase quantitative de la chaîne (qRT -PCR) Analyse de l'expression des gènes. L'isolement et la purification par affinité de noyaux (hors tissue dissection) peut être effectuée en moins d'une heure. Les résultats sont présentés montrant que les noyaux gliales peuvent être isolés avec succès à partir du lobe de l'optique et des larves disque imaginai de l'oeil, et utilisées pour l'analyse ultérieure de l'expression des gènes. Il est prévu que cette approche est utile pour l'isolement / enrichissement de noyaux marqués à partir de tissus embryonnaires et larvaires dans laquelle les cellules cibles constituent moins de 5% de la population globale. Tous les stocks de drosophile et les plasmides générées par cette étude sont disponibles auprès des auteurs sur demande.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Une. Génération et caractérisation de EGFP :: KASH Drosophila

  1. Chauffeur de la Croix Gal4 vole au SAMU-EGFP :: Msp-300 KASH vole. Alternativement, les mouches recombinants qui portent à la fois le pilote Gal4 et le transgène UAS-EGFP :: Msp-300 KASH peuvent être générés en utilisant des techniques génétiques standard. Cette deuxième approche est avantageuse si un grand nombre de descendants sont nécessaires.
  2. Caractériser l'expression du marqueur EGFP :: KASH en utilisant des techniques de microscopie classiques. Note: l'expression de l'EGFP peut être observé par les techniques classiques de microscopie à dissection, les tissus fixes de Drosophila, ou chez les larves ensemble, et ne nécessite pas l'utilisation d'un anticorps.
    1. Déterminer le profil d'expression de l'EGFP :: KASH marqueur dans l'ensemble de l'organisme sous un microscope à dissection fluorescence (voir Matériaux PDF). Remarque: De nombreux pilotes Gal4, y compris le conducteur repo-GAL4 le montre la figure 1, exposition nmodèles onspecific d'expression dans d'autres tissus tels que les larves de la glande salivaire (voir résultats).
    2. Analyser le schéma d'expression EGFP :: KASH dans le tissu disséqué d'intérêt en utilisant la microscopie confocale.
      1. Fixer le tissu d'intérêt à l'aide du formaldéhyde à une concentration finale de 4%, et l'ADN de la tache en utilisant DAPI à une concentration finale de 0,1 pg / ml pour visualiser la localisation de la balise KASH :: EGFP par rapport à l'ADN.
      2. Acquérir des images à l'aide d'huile, soit un objectif 40X / 1,30 à immersion ou un objectif 20X / 0,75 à immersion dans l'huile, en fonction de la taille du tissu d'intérêt. Les conditions d'excitation / émission suivants peuvent être utilisés pour l'acquisition de l'image: 408 nm/425-475 nm (DAPI); 488 nm / 525-550 nm (GFP).

2. Isoler les noyaux de la drosophile larves tissus

  1. Préparer le matériel pour la dissection des tissus des larves et l'isolement des noyaux ultérieure. Notez quedechorionated embryons entiers peuvent également être utilisées comme produit de départ si on le désire. Il est recommandé d'utiliser des tissus larvaires partiellement disséqués plutôt que les larves ensemble si le type de cellule d'intérêt est présent dans un tissu spécifique comme le disque imaginal. Cela réduit la liaison non spécifique, et élimine les problèmes qui peuvent être causés par l'expression de certains pilotes Gal4 dans les cellules non cibles aussi.
    1. Préparez deux paires de pinces acérées (voir Matériaux PDF), une plaque de verre 9 et siliconé (voir Matériaux PDF), et PBT (1x PBS, pH 7,4; 0,1% de Tween-20).
    2. Prélier les anticorps de la GFP à des billes magnétiques. Cette étape doit être commencé avant le début de la dissection. Ajouter 10 ul de billes magnétiques (Invitrogen, voir Matériaux PDF) et 2 pg de GFP anticorps (Roche, voir Matériaux PDF) à 400 ul de tampon de lavage (1 x PBS, pH 7,4; 2,5 mM de MgCl2) dans un tube de 1,5 ml . La quantité de perles et des anticorps utilisés peuvent être optimisées si nécessaire sur la base de la quantité de cible dans l'échanple et l'affinité de liaison de l'anticorps aux billes.
    3. Incuber les billes et les anticorps avec rotation pendant au moins 30 min à température ambiante.
    4. Placez le tube de 1,5 ml contenant les billes et les anticorps dans le rack magnétique (voir Matériaux PDF) et permettent aux billes de se lier à la magnétique pendant environ 1-2 min. Retirer le surnageant contenant l'anticorps non lié et le tampon de lavage en utilisant une pipette de 1 ml. Les perles resteront liés à la paroi du tube de 1,5 ml sur le côté adjacent à l'aimant.
    5. Rincer les billes deux fois avec 1 ml de tampon de lavage à chaque fois, comme décrit à la section 2.1.4. Retirez le tube de 1,5 ml de la grille magnétique et inverser brièvement pour mélanger les perles et le tampon de lavage pendant chaque étape de lavage.
    6. Stocker les perles liées à l'anticorps dans un tampon de lavage avant d'être prêt à passer à l'étape 2.7. Les perles ne doivent pas être autorisés à sécher à n'importe quelle étape du protocole.
  2. Disséquer les tissus larvaires dans PBT et transférer les tissus disséqués àune alvéole du godet 9 puits. Typiquement, la dissection du lobe de l'optique et du disque imaginai de l'oeil à partir de 100 larves au troisième stade larvaire fournit suffisamment de matière pour une analyse en aval de l'expression génique après l'isolement des noyaux.
  3. Rincer le tissu isolé dans un tampon d'extraction nucléaire (10 mM HEPES-KOH, pH 7,5, 2,5 mM MgCl 2, KCl 10 mM) dans un tube de 1,5 ml. Transfert tissus larvaires isolées à un 1 ml Dounce Homogenizer (voir Matériaux PDF) sur la glace qui contient 1 ml de tampon d'extraction nucléaire neuf. Incuber sur de la glace pendant 5 min. Il n'est pas nécessaire d'ajouter des inhibiteurs de la protéase si l'ARN doit être extrait après l'isolement des noyaux.
  4. Perturber le tissu par 20 coups avec le pilon lâche et puis incuber l'échantillon sur de la glace pendant 10 minutes pour permettre aux cellules de la houle. Extraire les noyaux des cellules à l'aide de 15 coups avec le pilon serré. Le nombre de traits avec les pilons lâche et serrés doit être optimisée pour différents tissus et types de cellules, un excès peut entraîner une homogénéisationnoyaux cisaillé, tandis que l'homogénéisation insuffisants ne sera pas extraire tous les noyaux du tissu.
  5. Un filtrage de l'homogénat, qui contient les noyaux et les débris cellulaires, à travers un 40 um de taille de pore crépine (voir Matériels PDF) qui a été préalablement rincées avec du tampon d'homogénéisation nucléaire. Recueillir le broyat filtré dans un nouveau tube.
  6. Prélever des échantillons de pré-isolement pour une analyse ultérieure pour déterminer le rendement des noyaux, l'intégrité des noyaux, et pour déterminer les niveaux de gènes cibles avant noyaux isolement de transcription.
    1. Transférer 50 ul de l'homogénat filtré pour un tube de 1,5 ml frais à l'aide d'une pipette. Ceci est l'échantillon de pré-isolement. Ajouter 500 ul de réactif Trizol (voir Matériaux PDF, ATTENTION), inverti à mélanger, et conserver à -20 ° C pour l'isolement de l'ARN ultérieure (étape 3.1).
    2. Transférer 20 ul de l'homogénat filtré à un tube de 1,5 ml de frais.
      1. Ajouter DAPI à une concentration finale de 0,1 pg / ml, et incéchantillon Ubate sur la glace pendant 10 min.
      2. Transfert noyaux DAPI colorées à une lamelle enduit poly-lysine, et les déposer sur une lame de microscope. Sceller la lamelle à l'aide de vernis à ongles transparent.
      3. Vérifier l'intégrité de noyaux, et la présence de noyaux de GFP étiqueté d'intérêt en utilisant un microscope à fluorescence. Remarque: Il n'est pas nécessaire de fixer les noyaux, ou pour colorer pour la GFP si ces lames sont analysées assez rapidement après la préparation (dans les 24 h).
    3. Transférer 10 ul de l'homogénat filtré à un nouveau tube de 1,5 ml et ajouter 90 ul de tampon de lavage (1 x PBS, pH 7,4; 2,5 mM de MgCl2). Ajouter DAPI à une concentration finale de 0,1 pg / ml, et laisser incuber sur de la glace pendant 10 min. Déterminer le rendement de noyaux dans l'échantillon de pré-isolement en utilisant un hémocytomètre pour compter les noyaux DAPI-positive en utilisant l'épifluorescence sous un objectif 10X d'air.
  7. Placez le tube de 1,5 ml contenant les billes liées à l'anticorps (préparés dans la section 2.1.6) dans un rack magnétique,et permettent aux billes magnétiques de se lier à l'aimant pendant au moins 2 min comme décrit dans la section 2.1.4. Retirer le tampon de lavage des billes liées à l'anticorps en utilisant une pipette de 1 ml et ajouter l'homogénat filtré de l'étape 2.5 pour le tube de 1,5 ml à l'aide d'une pipette de 1 ml.
  8. Retourner doucement le tube plusieurs fois pour mélanger et incuber à 4 ° C pendant 30 min avec la fin sur la fin de l'agitation. Éviter les bulles dans le tube, si possible, étant donné que ceux-ci peuvent se traduire par l'agglutination des noyaux.
  9. Placez le tube de 1,5 ml contenant les billes et homogénat anticorps lié à un support magnétique, et permettent aux billes magnétiques de se lier à l'aimant pendant au moins 2 min comme décrit dans la section 2.1.4. Retirer le broyat contenant la fraction non liée noyaux utilisant une pipette de 1 ml.
  10. Laver l'échantillon 3x avec 1 ml de tampon de lavage à chaque fois. Retirez le tube de 1,5 ml contenant les perles, des noyaux liés et le tampon de lavage du rack et mélanger par inversion plusieurs fois, puis placer le tube dans le support magnétique comme décrità l'étape 2.9 et retirer le surnageant à l'aide d'une pipette de 1 ml.
  11. Ajouter 150 ul de tampon de lavage pour les billes, qui doivent être liés à des noyaux cibles. Ceci est l'échantillon post-isolation. Préparer les échantillons pour analyse au microscope et l'extraction de l'ARN ultérieure.
    1. Transférer 20 ml de l'échantillon post-isolation à un tube de 1,5 ml frais et tache avec DAPI et analyser comme décrit dans la section 2.6.2. Comptez le GFP + / DAPI + et + GFP-/DAPI noyaux capturés par des billes magnétiques pour déterminer la pureté de la GFP enrichi + noyaux dans l'échantillon post-isolation.
    2. Ajouter 1 ml de réactif Trizol pour le reste de l'échantillon post-isolation, mélanger par inversion, et conserver à -20 ° C pour l'isolement de l'ARN ultérieure (étape 3.1). Note: Les échantillons de Trizol peuvent être stockées pendant plusieurs semaines si nécessaire à -20 ° C. Il n'est pas nécessaire pour éluer les noyaux à partir des billes magnétiques avant l'extraction de l'ARN en utilisant le réactif Trizol, because les bourrelets ne gênent pas l'isolement d'ARN ultérieur.

3. Déterminer les niveaux de transcription dans des noyaux isolés de larves tissus

  1. Isoler l'ARN des échantillons de pré-et post-isolation isolement préparés dans les sections 2.6.1 et 2.11.2 en utilisant le protocole standard décrit pour l'extraction de l'ARN à base de Trizol (voir Matériaux PDF) avec les modifications suivantes:
    1. Après la précipitation de la pastille d'ARN, ajouter 19,2 ul d'eau exempte de RNase et 0,8 ul de réactif (voir Matériaux RNASecure PDF) au culot et incuber à 60 ° C pendant 20 min pour inactiver des ARNases.
  2. Déterminer la concentration de l'ARN avec un colorant fluorescent de liaison d'ARN-tel que le kit de dosage de l'ARN du qubit (voir Matériels PDF) en utilisant la 2,0 QubitR Fluoromètre selon le protocole du fabricant.
  3. Synthétiser l'ADNc en utilisant une transcriptase inverse amplifier comme le EpiScript kit de transcriptase inverse et des amorces oligodT en suivant les instructions du fabricant. Remarque: En général, 50 à 100 ng d'ADNc de l'ARN génère suffisante pour effectuer les analyses d'expression de gènes multiples. Des quantités équivalentes de pré-isolement et l'isolement de l'ARN post-doivent être utilisés pour générer l'ADNc.
  4. Ajouter 180 ul d'eau sans nucléase à l'échantillon d'ADNc de 20 pi de diluer ce 10 fois avant de PCR en temps réel quantitative (qPCR) analyse. Cette dilution est une étape importante, parce que les échantillons d'ADNc non dilués peuvent inhiber la qPCR.
  5. Préparer un mélange maître PCR quantitative avec la polymerase et des dNTP, 4 pmoles de chacune des amorces avant et inverse, composé avec de l'eau stérile pour le volume de réaction final de 20 pi.
    1. Concevoir des amorces qPCR pour cibler des gènes qui sont attendus pour être exprimé dans le type de cellule d'intérêt, et à l'étape de développement au cours de laquelle le tissu est collecté. Conception des amorces à s'étendre un intron si possible, de sorte que la génomique etdes produits de PCR de l'ADNc peuvent être distinguées. Remarque: Si le profil d'expression du gène de type de la cellule cible n'est pas connue, les amorces contre l'eGFP, qui doit être exprimé spécifiquement dans la population de noyaux marqués, peuvent être utilisés pour optimiser le protocole d'un type particulier de cellules et de tissus (tableau 1).
  6. Déterminer les niveaux de transcription relative de chaque gène d'intérêt dans des échantillons pré-et post-isolation isolement par rapport à une série de dilutions d'ADNc préparée à partir du tissu ensemble. niveaux de gènes cibles de transcription doivent être normalisées à un gène de référence, tel Rpl32 (ou de préférence de plusieurs gènes de référence).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Le pilote repo-GAL4 (Bloomington stock number 7415) est spécifiquement exprimée dans les cellules gliales du système nerveux chez la drosophile à plusieurs stades de développement 18. Les mouches ont été générés qui expriment de manière stable SAMU-EGFP :: Msp-300 KASH sous le contrôle du pilote repo-GAL4 en utilisant des techniques génétiques standard. Afin de caractériser le profil d'expression de l'EGFP :: KASH transgène dans ces mouches, le motif de l'expression de GFP dans le lobe de l'optique et disséqué disque imaginai de l'oeil à partir de troisième stade larvaire a été examinée en utilisant la microscopie confocale. Tissus disséqués ont été DAPI pour marquer l'ADN et α-chaoptin 19 à étiqueter photoréceptrices axones (mAb24B10, voir Matériaux PDF). Figure 1A montre que la EGFP entraîné repo-GAL4 :: KASH transgène est exprimé dans les cellules gliales dans les lobes optiques et le disque imaginal d'oeil dans le modèle d'expression prévu. Sous un grossissement supérieur,Expression EGFP est observée dans un modèle circulaire entourant l'ADN-DAPI positif, conforme à enveloppe nucléaire-localisation de la balise KASH :: EGFP (Figure 1B). Expression EGFP peut être détectée à la fois dans et fixé dans les tissus non fixés sans la nécessité d'une amplification de signal en utilisant un anticorps contre la GFP; d'anticorps contre GFP n'ont pas été utilisés pour visualiser l'expression de l'EGFP :: KASH dans les images représentées sur les figures 1 et 2. Pour déterminer si le transgène EGFP :: KASH est exprimé de manière non spécifique dans tous les autres tissus dans des larves de Drosophila, l'expression de GFP a été examinée chez les larves de troisième stade larvaire ensemble de fluorescence en utilisant un microscope à dissection. En particulier, l'expression non spécifique du transgène EGFP :: KASH a été observée à des taux élevés dans les glandes salivaires des larves au troisième stade larvaire. Ceci indique que le pilote repo-GAL4 a une activité dans certains types de cellules autres que les cellules gliales dans le stade larvaire de développement. Ainsi, pour isoler spécifiquement glinoyaux al, le lobe optique et le disque imaginal des yeux de troisième stade larvaire ont été isolés par dissection avant l'homogénéisation et l'affinité isolement.

Pour confirmer que ce protocole est adapté à l'extraction des noyaux de tissus de Drosophila, et d'estimer le pourcentage de noyaux marqués présents dans un tissu donné, l'échantillon pré-isolement (section 2.6.2) à partir des homogénats obtenus à partir du lobe de l'optique et de l'oeil disque imaginal de repo-GAL4, SAMU-EGFP :: Msp-300 KASH larves de troisième stade a été examiné. Figure 2A montre une image représentative de l'échantillon pré-isolation obtenue par microscopie confocale. Dans cette image, la présence de noyaux est indiqué par des événements de DAPI-positif. Un petit nombre de clairsemées GFP-positives, les noyaux gliales DAPI positifs sont également observées. Nous estimons que les noyaux GFP-positives représentent moins de 2% de la population totale des noyaux dans cetteéchantillon (figure 2A). Le rendement total de noyaux de lobe optique et les disques imaginaux oculaires qui ont été disséqués à partir de 100 larves a été déterminée pour l'échantillon pré-isolation tel que décrit dans la section 2.6.3 (tableau 2). Un typique échantillon de pré-isolation de 100 disséqués optique lobes oculaires et disques imaginaux comprises entre 0,8 et 1,2 x 10 7 noyaux, dont environ 2% étaient GFP-positives. Figure 2B montre une image représentative de noyaux DAPI-positifs dans une région définie de l'hémocytomètre. A noter que les noyaux sont intacts, et de maintenir une forme circulaire uniforme dans les conditions d'extraction utilisés dans le protocole (figures 2A et 2B).

Pour déterminer si ce protocole peut être utilisé pour isoler et / ou enrichir fortement populations spécifiques de noyaux marqués à partir de tissus qui contiennent des populations de cellules mélangées, α-GFP des billes magnétiques revêtues d'anticorps ont une utilisationd pour isoler les noyaux marqués de broyats obtenus à partir du lobe optique et disque imaginal œil de 100 repo-GAL4, SAMU-EGFP :: Msp-300 KASH larves de troisième stade larvaire. Dans les figures 2C et 2D, on peut voir que la EGFP :: KASH gliale noyaux marqués se lient aux billes magnétiques recouvertes α-GFP et on observe dans l'échantillon post-séparation (section 2.11.1) après la séparation magnétique. Bien que les billes magnétiques présentent une certaine auto-fluorescence dans le canal de la GFP, ceux-ci peuvent être facilement différenciés des noyaux liées aux billes par leur taille plus petite (2,8 pm pour les perles magnétiques par rapport à environ 5 um pour les noyaux) et l'absence de coloration au DAPI. Les GFP + / DAPI + noyaux représentent plus de 95% des événements positifs DAPI dans l'échantillon post-isolation. Ainsi, l'objectif marqué population de noyaux sont fortement enrichis dans l'échantillon post-isolation par rapport à la pré-isolationéchantillon. La majorité des noyaux dans la post-isolation échantillon montrent une forte localisée fluorescence de la GFP nucléaire de l'enveloppe, et sont généralement entouré de perles. Cependant, il est possible qu'un petit nombre de noyaux non marqués peut aussi être présent dans cet échantillon. Ainsi, bien que les résultats de la figure 2C et à l'analyse de l'expression des gènes dans la figure 3 (voir ci-dessous) indiquent que la cible étiqueté gliale population de noyaux est fortement enrichie, la possibilité que certains noyaux de certains autres types de cellules non spécifiques sont également présents dans l'échantillon ne peut être exclue. Il est recommandé aux utilisateurs d'optimiser ce protocole pour leur type particulier de cellules et de tissus d'intérêt à maximiser l'enrichissement de la population cible de noyaux, et d'éliminer les noyaux non spécifiques de liaison. En particulier, le rapport de la matière de départ par rapport à l'anticorps et des billes est susceptible d'être important pour l'enrichissement optimal des noyaux cibles. Pour cette raison, les paliers de totalele nombre de noyaux présents dans nos échantillons typiques de pré-isolement sont donnés dans le Tableau 2. Basé sur le total des nombres de noyaux présents dans l'échantillon de pré-isolement et la proportion estimée des cellules gliales dans la population mixte du lobe optique et disque imaginai de l'oeil, le rendement de noyaux maximale dans l'échantillon post-isolement devait être compris entre 1,6 x 10 5 et 2,4 x 10 5 noyaux. Cependant, en utilisant l'hématimètre pour déterminer le rendement de noyaux comme décrit dans l'étape 2.6.3, le rendement réel obtenu de noyaux dans l'échantillon post-isolation était de 1,3 x 10 4 et 2,7 x 10 4 noyaux. Ces rendements noyaux représentent des estimations très approximatives car les perles présentes dans l'échantillon post-isolation semblent affecter le chargement précis de l'hématimètre. Certains noyaux GFP-positives sont observées dans l'homogénat non lié, indiquant que tous les noyaux de GFP-positives dans les samplement lient aux perles efficacement dans les conditions utilisées dans ce protocole. L'augmentation du temps d'étapes séquentielles isolement de liaison ou d'effectuer pourrait augmenter ce rendement, mais cela pourrait se faire au détriment à la fois de la pureté et de l'intégrité de l'ARN. En utilisant les conditions décrites dans le présent protocole, des quantités suffisantes de l'ARN peuvent être obtenues dans l'échantillon post-isolement aval analyse de l'expression des gènes par qRT-PCR (Tableau 2). Ainsi, ce protocole est capable de rapidement et rigoureusement isoler les noyaux cibles de tissus qui contiennent des populations mixtes de cellules. De plus, il est capable d'isoler spécifiquement des noyaux cibles qui constituent seulement une petite proportion, inférieure à 5%, des cellules dans une population donnée.

Pour confirmer davantage que l'échantillon post-isolation a été fortement enrichi pour gliale notre population de noyaux cible, les niveaux de transcriptions pour quatre gènes différents dans le pré-isolement post-isolation échantillons ont été comparés par RT-qPCR. Les niveaux de elav, CAR2 et eGFP transcription ont été déterminés dans les deux échantillons, et normalisée par rapport au gène de référence, Rpl32, qui est exprimée à des niveaux équivalents dans les cellules gliales et dans le système nerveux central environnant (figure 3). La différence du pli dans l'échantillon post-isolation est représentée par rapport à l'échantillon de pré-isolement, qui est mis à un. Sur la figure 3, l'échantillon post-isolement montre les niveaux de transcription significativement plus faibles de l'spécifique neuronale elav-gène par rapport à l'échantillon de pré-isolement. Cela indique que les noyaux de cellules neuronales sont sous-représentées dans l'échantillon post-isolation. En revanche, les niveaux de transcription élevés à la fois du gène de CAR2 gliale enrichi en 10 eGFP et sont présents dans le post-isolation échantillon par rapport à l'échantillon de pré-isolement. Ce résultat indique que l'échantillon post-isolation est fortement enrichie pour la population gliale de noyaux cible. Il est important de noter que les niveaux de transcription mesurées dans ce protocole représentent transcriptions nucléaires, et sont donc susceptibles d'indiquer des niveaux de transcription active plutôt que l'ARNm de l'état d'équilibre. Expression reproductible de pension n'a pas été détecté dans nos échantillons de pré-isolation ou post-isolation, ce qui suggère que la protéine Gal4 exprimé par le conducteur repo-GAL4 peut persister après transcription active du gène endogène pension a cessé. Ceci est cohérent avec les résultats d'autres études dans lesquelles noyaux marqués en utilisant le promoteur de twi ne montrent pas de niveaux enrichis de transcriptions de twi, peut-être en raison de différences dans le calendrier de développement de la transcription par rapport à la stabilité des protéines 8. Taken leur ensemble, ces résultats démontrent que le protocole décrit peut être utilisé avec succès pour enrichir fortement noyaux cibles à partir de tissus qui contiennent des populations de cellules mélangées, et que les noyaux isolés sont appropriés pour l'analyse de l'expression génique.

Figure 1
Figure 1. motif d'expression de repo-GAL4, SAMU-EGFP :: Msp-300 KASH volez ligne. (A) En troisième stade larvaire, repo-GAL4 entraîne l'expression du transgène UAS-EGFP :: Msp-300 KASH dans les cellules gliales dans l'optique lobe, tige optique (OS) et les yeux disque imaginal (ed). L'enveloppe nucléaire dans les cellules gliales est marqué avec EGFP :: KASH (vert). R1 - R8 axones des cellules photoréceptrices sont étiquetés avec α-chaoptin (mAB24B10, rouge) pour la comparaison, et l'ADN est staminé avec DAPI (violet). Noyaux gliales GFP marqués sont visibles le long de la lame (la) dans le lobe optique (indiqués par des flèches). La barre d'échelle, 50 um. (B) l'image supérieur de grossissement des ganglions lame du lobe optique qui contient EGFP :: KASH marqué les noyaux des cellules gliales. La barre d'échelle, 50 um. Les images confocales ont été acquises en utilisant soit un   40X / ou d'une huile 1,30   20X / 0,75 objectif de l'huile d'immersion, et en utilisant des longueurs d'onde d'excitation / émission de 408 nm nm/425-475 (DAPI); 488 nm/525-550 nm (GFP); 561 nm/595-620 nm (Alexa 5,6,8 ). S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2. Caractérisation des noyauxen "pré-isolement" et "post-isolement" des échantillons. (A) de l'image représentative d'un repo-GAL4, SAMU-EGFP :: Msp-300 KASH échantillon de pré-isolation analysée en utilisant un X 20 / 0,75 objectif à immersion d'huile et le niveau microscope confocal. ADN est coloré avec du DAPI (bleu), et EGFP :: KASH marqué noyaux gliales sont indiquées en vert (indiqués par des flèches). La barre d'échelle, 50 um. (B) l'image représentative de noyaux DAPI colorées à partir d'un échantillon de pré-isolement sur ​​un hémocytomètre en utilisant un objectif X 10 d'air et d'un microscope à épifluorescence standard. grilles de hématimètre sont indiqués en gris clair. Seulement noyaux DAPI-positif sont présentés dans cette image, que la fluorescence de la GFP n'était pas visible sous cet objectif sur le microscope à épifluorescence. (C) l'image représentative d'un repo-GAL4, SAMU-EGFP :: échantillon post-isolation Msp-300 KASHanalysé comme décrit pour la partie A. L'EGFP isolé :: KASH marqué noyaux gliales (marqués par des flèches) tache positive pour DAPI, et sont entourés par les perles, qui autofluorescence à de faibles niveaux dans le canal de la GFP. La barre d'échelle, 50 um. (D) l'image supérieur d'agrandissement d'un EGFP isolé typique :: KASH marqué noyaux gliales (indiquées par une flèche) entouré de perles. La barre d'échelle, 5 um. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3. Données représentatives qRT-PCR de "pré-isolement" et échantillons "post-isolation". niveaux de gènes cibles de transcription ont été déterminés par qRT-PCR de pré-isoléchantillons ation et post-isolation obtenus à partir de repo-GAL4, SAMU-EGFP :: Msp-300 KASH lobes optiques et disques imaginaux oculaires. Tous les niveaux de transcription sont normalisées pour les niveaux de transcription Rpl32, et l'échantillon pré-isolation pour chaque gène cible est fixé à un. Les résultats représentatifs de l'une expérience biologique sont présentés pour les gènes suivants: elav, CAR2 et eGFP.

Gène Séquence d'amorce (5 '-3') produit de PCR de taille (pb)
eGFP GAGGGATACGTGCAGGAGAG 102
GATCCTGTTGACGAGGGTGT
CAR2 GGCTGGTTGTAGTCGCAGTT 125
GGCACCCAACACGAGAACTA
elav GCACCATTCGGAGCAATAAT 153
TGTGCAGCTGGATGGTGTAG
Rpl32 GCTAAGCTGTCGCACAAATG 160
CGTTGTGCACCAGGAACTT

Tableau 1. Amorces utilisées pour l'analyse qRT-PCR.

Nombre total de noyaux dans l'échantillon pré-isolation Estimation du nombre total de noyaux dans l'échantillon post-isolation rendement de l'ARN de l'échantillon post-isolation (ng)
0,8 à 1,2 x 10 7 1.3 à 2.7 x 10 4 160-220 ng

Tableau 2. Des noyaux représentatifs et les rendements d'ARN obtenus.Plages typiques des noyaux et des rendements d'ARN à partir d'échantillons de pré-isolation et post-isolation de 100 lobe optique disséqué et oculaires disques imaginaux de la repo-GAL4, SAMU-EGFP :: génotype Msp-300 KASH, dans lequel les cellules gliales sont étiquetés avec EGFP :: KASH. Noyaux ont été quantifiées comme décrit dans 2.6.3 et l'ARN a été quantifié comme décrit au paragraphe 3.1.2.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ce protocole peut être utilisé pour isoler ou enrichir très précisément noyaux marqués de populations de cellules mixtes chez la drosophile embryonnaire ou tissus larvaires. En utilisant ce protocole, les noyaux peuvent être isolés à partir de tissus disséqués en environ 1 heure. La pureté et le rendement des noyaux isolés doivent être déterminés expérimentalement pour chaque type de cellule. Il peut être difficile de quantifier les noyaux de talon lié à l'étape de post-isolement du protocole en utilisant un hémocytomètre, car des billes présentes dans l'échantillon. Ainsi, si le nombre exact de noyaux sont nécessaires pour une application en aval, il sera nécessaire d'estimer le rendement de noyaux sur la base d'une méthode alternative telle que la teneur en ADN. Des calculs exacts de rendement noyaux ne sont pas nécessaires pour l'analyse de l'expression génique si l'ARN peut être isolé et quantifié avec succès. Il est recommandé d'utiliser un procédé à base de fluorescence pour quantifier le rendement en ARN, comme nous l'avons constaté que la détermination spectrophotométrique de la concentration d'ARNdans ces échantillons de faible concentration est très variable.

Il ya deux aspects importants du protocole qui influenceront son succès: le choix des billes magnétiques et anticorps. Des billes magnétiques qui sont couplées à la GFP ou de la protéine G sont disponibles dans le commerce auprès de plusieurs sources différentes. Cependant, il est fortement recommandé d'utiliser les billes de protéine G magnétiques disponibles de Invitrogen pour la procédure décrite dans ce protocole pour deux raisons principales. Tout d'abord, la taille des billes Invitrogen à 2,8 um est légèrement plus petite que la taille moyenne des noyaux dans les types de cellules, nous avons examiné, qui est d'environ 5 um (figure 2D). Des billes magnétiques qui sont plus petites (par exemple 50 nm, μMACS α-GFP, Miltenyi Biotech) ne se lient pas rapidement à des aimants de type de lot de lavage, et les colonnes prévues pour ces perles peut boucher avec des extraits de tissus larvaires. Billes magnétiques plus grands (par exemple 10 um, la protéine G PureProteome b magnétiqueEADS, Millipore) ne se lie pas bien pour les noyaux dans nos tests préliminaires, et ceux-ci présentent également une forte autofluorescence dans les mêmes canaux que les deux DAPI et la GFP, ce qui rend difficile l'identification de noyaux dans l'échantillon lié aux billes par des techniques de microscopie classiques. En plus du choix des billes magnétiques, il est important d'utiliser un anticorps anti-GFP qui fonctionne bien pour l'immunoprécipitation, mais qui ne possède pas de fond non spécifique élevée. Pour aider à la reproductibilité de ce protocole, nous avons utilisé un anticorps monoclonal de souris contre la GFP. Anticorps polyclonaux de lapin contre la GFP ont également été mis à l'essai avec succès dans nos études préliminaires, mais ceux-ci ont tendance à avoir plus de fond non spécifique. D'autres anticorps monoclonaux ont également été testés (par exemple, développement des études Hybridoma Banque), avec différents niveaux de succès. Ainsi, le choix des anticorps est un facteur important dans le succès de l'isolement des noyaux marqués.

Bien que, dans ce protocole, nous décrivons les méthodes de DETniveaux de transcription du gène d'hermine dans les noyaux isolés, il est prévu que l'approche décrite dans les étapes 2.1 à 2.11 sera également adapté pour isoler les noyaux qui peuvent être utilisés pour une analyse ultérieure chromatine immunoprécipitation. Si le tissu est fixé à 1% de formaldéhyde avant l'homogénéisation (étape 2.3), puis les tissus disséqués peuvent être collectées sur plusieurs jours et suffisamment de matériel isolé pour effectuer des analyses d'immunoprécipitation de la chromatine. Basé sur les chiffres obtenus en utilisant le hématimètre, qui ne fournissent que des estimations approximatives comme discuté ci-dessus, nous obtenons généralement de 1,3 x 10 4 et 2,7 x 10 4 gliales noyaux de l'œil disque imaginal et lobe optique de 100 larves (tableau 2). Ainsi, en utilisant notre approche, il devrait être possible d'obtenir suffisamment de matériau pour effectuer une analyse d'immunoprécipitation de la chromatine, en fonction de l'abondance du type cellulaire ciblé, et l'épitope d'intérêt.

Une application utile génétique de cette techniqueQc est qu'il peut être utilisé pour marquer les noyaux de manière positive dans des types cellulaires spécifiques dans des embryons ou des larves qui sont homozygotes pour un allèle mutant létal récessif. Pour ce faire, deux stocks de mouches séparés doivent être générées dans laquelle l'allèle mutant d'intérêt est recombiné avec un pilote spécifique Gal4, ou avec le transgène UAS-EGFP :: Msp-300 KASH le troisième chromosome. Si des mouches portant l'allèle mutant et pilote Gal4 sont croisées à des mouches portant les allèles mutants et le transgène UAS-EGFP :: Msp-300 KASH, seule la descendance ayant les deux copies de l'allèle mutant sera marquée par la GFP dans le tissu dans lequel le pilote Gal4 est exprimée. Ainsi, les effets spécifiques des cellules d'allèles récessifs létaux peuvent être examinées dans les stades embryonnaires ou larvaires, avant le stade de la létalité. Cette technique génétique a déjà été utilisé pour marquer positivement les cellules dans le muscle embryonnaire qui étaient homozygotes pour les mutations dans la sous-unité de SAGA, sgf11 1 </ Sup>.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à révéler.

Acknowledgments

Nous remercions Janice Fischer pour fournir le plasmide SAMU-EGFP :: Msp-300 KASH. L'anticorps a été obtenu mAB24B10 du développement des études Hybridoma Banque élaboré sous les auspices de la NICHD et maintenu par l'Université de l'Iowa, Département de biologie. Le repo-GAL4 actions (BL7415) a été obtenu à partir du Stock Center Bloomington à l'Université de l'Indiana. Le soutien de l'Institutional Research Grant American Cancer Society (IRG # 58-006-53) au Centre de l'Université de Purdue for Cancer Research est appréciée. Jingqun Ma est soutenu par une recherche agricole à l'Université Purdue assistanat alimentaire et agricole de l'Université Purdue.

Materials

Name Company Catalog Number Comments
Anti-chaoptin antibody (mouse, monoclonal) Developmental Studies Hybridoma Bank mAB24B10
Anti-GFP antibody (mouse, monoclonal) Roche 11814460001 This specific antibody is recommended for this protocol. However, alternative antibodies could also be used.
2x Bullseye EvaGreen qPCR Mastermix with ROX MidSci BEQPCR-R
DAPI (4',6-diamidino-2-phenylindole, dihydrochloride salt) Biotium 40011
Dounce Homogenizer (1 ml) VWR 62400-595
Dumont #5 Tweezers, 11 cm World Precision Instruments 14095
Dynabeads Protein G for Immunoprecipitation Invitrogen 10003D This specific brand of magnetic beads is recommended for this protocol.
EpiScript Reverse Transcriptase Epicentre ERT12910K http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf
Falcon cell strainers, 40 μm pore size VWR 21008-949 Alternative pore sizes could be used, depending on the size of the target cell nuclei.
Magnetic stand (8 x 1.5 ml tubes) Millipore LSKMAGS08 
Mini tube rotator Genemate H-6700
Qubit starter kit Life Technologies Q32871 Similar fluorescence-based methods for quantifying RNA yield could be used. http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdfZ
RNAsecure (Ambion) Life Technologies AM7010 The use of this reagent to inactivate RNAses is optional.
RT-PCR machine Thermal Cycler BioRad CFX Connect Thermal Cycler
Siliconized 9-well glass plate Hampton Research HR3-134
Stereomicroscope Fluorescence Adapter (Royal Blue (440-460 nm) excitation + yellow barrier Nightsea This adaptor enables GFP fluorescence to be examined using a typical dissecting microscope (eg Nikon)
StereoZoom Microscope 83604 Set with 10X Wide Field Eyepieces and Universal Boom Stand Nikon SMZ 745
Thermal Cycler BioRad T100
Trizol reagent Life Technologies 15596018 CAUTION; Alternative RNA extraction methods can be used. http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf
Tween 20 Amresco 0777-1L

DOWNLOAD MATERIALS LIST

References

  1. Weake, V. M., et al. Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation. Genes Dev. 25, 1499-1509 (2011).
  2. Bonn, S., et al. Cell type-specific chromatin immunoprecipitation from multicellular complex samples using BiTS-ChIP. Nat. Protoc. 7, 978-994 (2012).
  3. Haenni, S., et al. Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq. Nucleic Acids Res. 40, 6304-6318 (2012).
  4. Barthelson, R. A., Lambert, G. M., Vanier, C., Lynch, R. M., Galbraith, D. W. Comparison of the contributions of the nuclear and cytoplasmic compartments to global gene expression in human cells. BMC Genom. 8, 340 (2007).
  5. Zhang, C., Barthelson, R. A., Lambert, G. M., Galbraith, D. W. Global characterization of cell-specific gene expression through fluorescence-activated sorting of nuclei. Plant Physiol. 147, 30-40 (2008).
  6. Deal, R. B., Henikoff, S. The INTACT method for cell type-specific gene expression and chromatin profiling in Arabidopsis thaliana. Nat. Protoc. 6, 56-68 (2011).
  7. Deal, R. B., Henikoff, S. A simple method for gene expression and chromatin profiling of individual cell types within a tissue. Dev Cell. 18, 1030-1040 (2010).
  8. Steiner, F. A., Talbert, P. B., Kasinathan, S., Deal, R. B., Henikoff, S. Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Genom. Res. 22, 766-777 (2012).
  9. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, 401-415 (1993).
  10. Henry, G. L., Davis, F. P., Picard, S., Eddy, S. R. Cell type-specific genomics of Drosophila neurons. Nucleic Acids res. 40, 9691-9704 (2012).
  11. Starr, D. A. KASH and SUN proteins. Curr Biol. 21, 414-415 (2011).
  12. Fischer, J. A., et al. Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics. 168, 1385-1393 (2004).
  13. Patterson, K., et al. The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol. Biol. Cell. 15, 600-610 (2004).
  14. Yu, J., et al. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev. Biol. 289, 336-345 (2006).
  15. Bischof, J., Maeda, R. K., Hediger, M., Karch, F., Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007).
  16. Kracklauer, M. P., Banks, S. M., Xie, X., Wu, Y., Fischer, J. A. Drosophila klaroid encodes a SUN domain protein required for Klarsicht localization to the nuclear envelope and nuclear migration in the eye. Fly. 1, 75-85 (2007).
  17. Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40, 476-483 (2008).
  18. Sepp, K. J., Schulte, J., Auld, V. J. Peripheral glia direct axon guidance across the CNS/PNS transition zone. Dev. Biol. 238, 47-63 (2001).
  19. Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A., Shotwell, S. L. Monoclonal antibodies against the Drosophila nervous system. Proc. Natl. Acad. Sci. U.S.A. 79, 7929-7933 (1982).
Isolation basée sur l&#39;affinité de Tagged noyaux de<em&gt; Drosophila</em&gt; tissus pour l&#39;analyse de l&#39;expression génique
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).More

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter