Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

عزل القائم على تقارب من معلم النواة من doi: 10.3791/51418 Published: March 25, 2014

Summary

غالبا ما تحتوي على الأنسجة ذبابة الفاكهة خليط غير متجانس من أنواع الخلايا. لدراسة التعبير الجيني في أنواع معينة من الخلايا من الأنسجة وجه الخصوص، يمكن الموسومة نوى وراثيا وعزل في وقت لاحق باستخدام النهج القائم على النسب. نواة معزولة يمكن استخدامها لتطبيقات المصب مثل تحليل التعبير الجيني والكروماتين مناعي.

Abstract

غالبا ما تحتوي على الأنسجة الجنينية واليرقات ذبابة الفاكهة السوداء البطن خليط غير متجانس للغاية من أنواع الخلايا، والتي يمكن تعقيد تحليل التعبير الجيني في هذه الأنسجة. وبالتالي، لتحليل خلية محددة ملامح التعبير الجيني من الأنسجة ذبابة الفاكهة، فإنه قد يكون من الضروري عزل أنواع معينة من الخلايا مع نقاء عالية وعلى عوائد كافية للتطبيقات المصب مثل النسخي والكروماتين مناعي. ومع ذلك، فإن التشكل الخلوية في أنسجة غير النظامية مثل الجهاز العصبي المركزي، إلى جانب السكان نادرة من أنواع معينة من الخلايا في هذه الأنسجة، يمكن أن تشكل تحديات للطرق التقليدية من العزلة الخلية مثل تسليخ مجهري الليزر والخلية مضان تنشيط الفرز (FACS) . هنا، وهو نهج بديل للتميز ملامح التعبير الجيني خلية محددة باستخدام العزلة القائم على تقارب من نوى الموسومة، بدلا من خلايا كله، يوصف. نوى في ج محددةنوع الذراع من الفائدة وصفت وراثيا مع المغلف النووية المترجمة علامة EGFP باستخدام نظام ثنائي التعبير GAL4/UAS. هذه النوى الموسومة EGFP يمكن أن تكون معزولة باستخدام الأجسام المضادة ضد GFP التي تقترن لحبات المغناطيسي. النهج الموصوفة في هذا البروتوكول يتيح العزلة ثابت من نوى من أنواع معينة من الخلايا في النظام المركزي اليرقات ذبابة الفاكهة العصبي في نقاء عالية وعلى مستويات كافية لتحليل التعبير، حتى عندما تشكل هذه أنواع الخلايا أقل من 2٪ من مجموع السكان في الخلية الأنسجة. ويمكن استخدام هذا النهج لعزل نواة من طائفة واسعة من ذبابة الفاكهة وأنواع الخلايا الجنينية اليرقات باستخدام برامج تشغيل GAL4 محددة، وربما يكون مفيدا في عزل نواة من أنواع الخلايا التي ليست مناسبة لنظام مراقبة الأصول الميدانية أو تسليخ مجهري الليزر.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

الأنسجة ذبابة الفاكهة مثل الجهاز العصبي المركزي تحتوي على خليط معقد من أنواع الخلايا. وبالتالي، لتحليل خلية محددة ملامح التعبير الجيني من الأنسجة ذبابة الفاكهة، فمن الضروري أولا لعزل السكان متجانسة من خلايا معينة بكميات كافية لتمكين التطبيقات المصب. وتشمل وسائل لعزل الخلايا من أنسجة سليمة تسليخ مجهري ليزر، والخلية مضان تنشيط الفرز (FACS) من الخلايا بأكملها. بينما نظام مراقبة الأصول الميدانية قد استخدمت لعزل الخلايا ونوى من أجنة ذبابة الفاكهة وانواع معينة ايليجانس من لونين والتعبير الجيني التنميط 1-3، ونظام مراقبة الأصول الميدانية تسليخ مجهري ليزر يمكن أن يكون صعبا لتنفيذ بنجاح في الأنسجة التي تحتوي على أنواع الخلايا تتشابك غاية أو أن الخلايا تحتوي على مع مورفولوجيا غير النظامية، مثل الخلايا العصبية. للتغلب على هذه الصعوبة، بدلا من نوى الخلايا يمكن أن تكون معزولة عن أنواع معينة من الخلايا واستخدامها لاحقا الجنراله التنميط التعبير. الأهم من ذلك، مرنا تحليل التعبير المستندة ميكروأري باستخدام عينات الحمض النووي الريبي النووي تظهر نتائج مماثلة عموما مع أن تنفيذها باستخدام الحمض النووي الريبي مجموع 4 و 5. وعلاوة على ذلك، وتحليل التعبير الجيني باستخدام الحمض النووي الريبي النووي وقد استخدم بنجاح لدراسة التعبير الجيني في الكائنات متعددة بما في ذلك C. ايليجانس، نبات الأرابيدوبسيس thaliana، ذبابة الفاكهة، والبشر 4، 5 2، 3.

وقد تم مؤخرا وصفت عدة طرق لعزل السكان محددة من النوى وصفت من الأنسجة ذبابة الفاكهة التي هي مناسبة لتحليل التعبير الجيني و / أو لونين مناعي. العزلة دفعة من لونين الأنسجة محددة لطريقة مناعي (بت رقاقة) يستخدم نظام مراقبة الأصول الميدانية لعزل نواة ثابتة على أساس خلية من نوع معين من التعبير GFP المترجمة النووية 2. وكان هذا النهج سوتستخدم ccessfully لتحليل توزيع التعديلات هيستون وعوامل النسخ باستخدام لونين مناعي معزولة من نوى من الأديم المتوسط ​​من أجنة ذبابة الفاكهة 2. ومع ذلك، قد يكون النهج القائمة على نظام مراقبة الأصول الميدانية أقل مناسبة لعزل نواة المسمى التي تشكل إلا نسبة صغيرة من السكان مختلطة بسبب زيادة وقت الفرز اللازمة للحصول على أرقام مناسبة للتطبيقات المصب. للتغلب على هذه القيود، وقد استخدمت عدة جماعات تقنيات العزل القائم على تقارب لتنقية نوى التي وصفت مع حاتمة محددة في نوع خلية معينة. وقد تم مؤخرا تكييفها عزل نواة الموسومة في أنواع معينة الخلية (سليمة) طريقة تم تطويرها للاستخدام في نبات الأرابيدوبسيس thaliana 6، 7 لاستخدامها في ذبابة الفاكهة 8. في هذا الأسلوب، وهو بروتين مغلف الاندماج النووي الذي هو الركيزة لفي الجسم الحي هو biotinylation coexpresااا مع كولاي البيوتين يغاز البيرة في أنواع معينة من الخلايا. نوى المسمى البيوتين يمكن تنقيته في وقت لاحق من السكان مختلطة باستخدام القائمة على streptavidin تقارب العزلة. باستخدام هذا النهج، وصفت بنجاح نوى ومعزولة عن الأديم المتوسط ​​من أجنة ذبابة الفاكهة التي أعرب عن البروتين المغلف الانصهار النووي في ظل رقابة من الأديم المتوسط ​​محسن محددة 8. إنشاء الكتاب أيضا البروتينات المغلف النووية الانصهار التي يمكن التعبير عنها في أي نوع من الخلايا تحت سيطرة تسلسل GAL4 التنظيمية، UAS 9. هذا النهج قادر على عزل مجموعات فرعية من النوى بسرعة وصفت من السكان مختلطة، ولكن يتطلب ثلاثة بنيات منفصلة المعدلة وراثيا، وبالتالي قد تكون غير مناسبة لتطبيقات خاصة الوراثية. في الآونة الأخيرة، وقد وصفت هذا النهج الذي تم الموسومة SUN (S AD1 و C-84 للامم المتحدة) والبروتينات التي تحتوي على المجال الذي توطين إلى الغشاء الداخلي من المغلف النووية معوأعرب عن البروتينات الفلورية تحت سيطرة النظام GAL4/UAS 10. تم عزل نواة في وجود المنظفات غير أيوني لإزالة الغشاء الخارجي المغلف النووية، وتنقية تقارب باستخدام الخرز المغناطيسي لجانب الأجسام المضادة للGFP. وقد استخدم هذا النهج بنجاح لعزل المجموعات الصغيرة من النوى وصفت من أنواع فرعية محددة الخلايا العصبية في الدماغ الكبار ذبابة الفاكهة 10.

هنا، يوصف بروتوكول لعزل نواة صفت من السكان خليط من الخلايا من الأنسجة ذبابة الفاكهة اليرقات. وقد تم تطوير هذه الطريقة بشكل مستقل، ولكن هو مماثل لنهج وصفها هنري وآخرون 10 الأولى، وصفت نوى مع علامة الفلورسنت التي يتم التعبير فقط في أنواع معينة من الخلايا في ذبابة الفاكهة السوداء البطن لتسهيل العزلة لاحقة من نوى الموسومة من السكان مختلطة استخدام النهج القائم على النسب. لتسمية نوى،وقد استخدمت KASH (K larsicht / A-NC 1 / S yne ح omology) المجال. المجال هو مجال KASH عبر الغشاء الذي يموضع إلى الغشاء الخارجي المغلف النووية، في جزء منه من خلال التفاعل مع SUN البروتينات التي تحتوي على النطاق داخل الفضاء محيط بالنواة 11. المجال KASH C-محطة من البروتينات مثل ذبابة الفاكهة MSP-300 وKlarsicht المراسي هذه البروتينات إلى الغشاء النووي الخارجي، في حين أن التفاعل المجالات-N محطة مع بروتينات الهيكل الخلوي الأكتين مثل الأنابيب الدقيقة أو في السيتوبلازم 12-14. تم إنشاؤها في بنيات الذي تنصهر المجال KASH من ذبابة الفاكهة MSP-300 إلى C-محطة من EGFP، تحت سيطرة تسلسل تنظيمي GAL4، UAS في pUAST-attB ناقلات 15 و 16. باستخدام التكامل في مواقع محددة phiC31، تم إنشاؤها الذباب المعدل وراثيا الذي UAS-EGFP :: تم إدراج MSP-300 KASH التحوير في مواضع attP2 على الصبغي3L 17. وUAS-EGFP :: MSP-300 KASH الذباب يمكن تجاوزه مع الذباب التي تعبر عن السائق GAL4 في نوع خلية معينة، مما أدى إلى التعبير المستهدفة من EGFP على الغشاء النووي الخارجي في نوع من الخلايا في المصالح. ويمكن بعد ذلك أن وصفت نوى تنقيته من السكان الخلية المختلطة باستخدام الأجسام المضادة ضد GFP جانب لحبات المغناطيسي. في هذا النهج، لا يلزم استخدام المنظفات غير أيوني لأن يتم ترجمة العلامة EGFP إلى الجانب حشوية من الغشاء النووي الخارجي، ويمكن الوصول إلى الأجسام المضادة وبالتالي.

البروتوكول هو موضح أدناه يمكن استخدامها لعزل / إثراء نوى المسمى EGFP من أنواع معينة من الخلايا في أنسجة اليرقات ذبابة الفاكهة، لقياس العائد من النقاء والنوى معزولة، واستخراج الحمض النووي الريبي النووي مناسبة لكمية العكسية النسخ البلمرة سلسلة من ردود الفعل (QRT -PCR) تحليل التعبير الجيني. عزل وتنقية تقارب من نوى (باستثناء TISSUه تشريح) لا يمكن أن يؤديها في أقل من ساعة واحدة. يتم عرض النتائج تبين أن نوى الدبقية يمكن أن تكون معزولة بنجاح من الفص البصري اليرقات والعين القرص تخيلي، وتستخدم لاحقة تحليل التعبير الجيني. ومن المتوقع أن هذا النهج سوف يكون من المفيد لعزل / إثراء نوى صفت من الأنسجة الجنينية واليرقات في الخلايا المستهدفة التي تشكل أقل من 5٪ من إجمالي عدد السكان. تتوفر جميع الأسهم ذبابة الفاكهة والبلازميدات ولدت في هذه الدراسة من الكتاب عند الطلب.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. جيل وتوصيف EGFP :: KASH ذبابة الفاكهة

  1. السائق عبر GAL4 تسير رحلات الى UAS-EGFP :: MSP-300 KASH الذباب. بدلا من ذلك، يمكن أن تتولد الذباب المؤتلف التي تحمل كل من السائق GAL4 والتحوير UAS-EGFP :: MSP-300 KASH باستخدام تقنيات وراثية القياسية. هذا النهج الثاني هو مفيد إذا كانت هناك حاجة أعداد كبيرة من النسل.
  2. تميز تعبير عن علامة EGFP :: KASH باستخدام تقنيات المجهر القياسية. ملاحظة: EGFP التعبير يمكن ملاحظتها بواسطة تقنيات المجهر القياسية في تشريح ثابتة الأنسجة ذبابة الفاكهة، أو في اليرقات كله، و لا يتطلب استخدام الأجسام المضادة.
    1. تحديد نمط التعبير عن EGFP :: KASH علامة في الكائن الحي بأكمله تحت المجهر مضان تشريح (انظر المواد PDF). ملاحظة: العديد من السائقين GAL4، بما في ذلك السائق الريبو-GAL4 هو مبين في الشكل 1، ن المعرضأنماط onspecific التعبير في أنسجة اليرقات الأخرى مثل الغدة اللعابية (انظر نتائج).
    2. تحليل نمط التعبير EGFP :: KASH في الأنسجة تشريح ذات الاهتمام باستخدام متحد البؤر المجهري.
      1. إصلاح الأنسجة من الاهتمام باستخدام الفورمالدهيد بتركيز نهائي من 4٪، والحمض النووي وصمة عار باستخدام دابي في تركيز النهائي من 0.1 ميكروغرام / مل لتصور توطين EGFP :: KASH العلامة نسبة إلى الحمض النووي.
      2. الحصول على الصور باستخدام إما الهدف 40X / 1.30 النفط الغمر أو الهدف 20X / 0.75 الغمر النفط، وهذا يتوقف على حجم الأنسجة من الاهتمام. الشروط الإثارة / الانبعاثات التالية يمكن استخدامها لالتقاط صور: 408 nm/425-475 نانومتر (دابي)؛ 488 نانومتر / 525-550 نانومتر (GFP).

2. عزل النواة من ذبابة الفاكهة اليرقات الأنسجة

  1. إعداد المعدات اللازمة لتشريح الأنسجة اليرقات والعزلة نوى اللاحقة. لاحظ أنويمكن أيضا أن تستخدم الأجنة dechorionated كله في بدء المواد اذا شئت. فمن المستحسن أن استخدام أنسجة اليرقات تشريح جزئيا بدلا من اليرقات بأكمله إذا كان نوع من الخلايا في المصالح موجود في الأنسجة محددة مثل القرص تخيلي. هذا يقلل غير محددة ملزمة، وكذلك يلغي المشاكل التي يمكن أن تسببها التعبير عن بعض السائقين GAL4 في الخلايا غير المستهدفة.
    1. إعداد اثنين من أزواج من ملقط حاد (انظر المواد PDF)، واحدة siliconized 9 جيدا لوحة من الزجاج (انظر المواد PDF)، وPBT (1X PBS، ودرجة الحموضة 7.4؛ 0.1٪ توين 20).
    2. Prebind الأجسام المضادة GFP إلى حبات المغناطيسي. يجب أن تبدأ هذه الخطوة قبل البدء في تشريح. إضافة 10 ميكرولتر من الخرز المغناطيسي (إينفيتروجن، انظر المواد PDF) و 2 ميكروغرام من GFP الضد (روش، انظر المواد PDF) إلى 400 ميكرولتر من غسل العازلة (1X PBS، ودرجة الحموضة 7.4؛ 2.5 ملي MgCl 2) في أنبوب 1.5 مل . كمية من الخرز والأجسام المضادة المستخدمة يمكن أن يكون الأمثل إذا لزم الأمر على أساس كمية من الهدف في سامالتنوير القائل وتقارب ملزم من الأجسام المضادة إلى الخرز.
    3. احتضان حبات والأجسام المضادة مع دوران لا يقل عن 30 دقيقة في درجة حرارة الغرفة.
    4. وضع أنبوب 1.5 مل يحتوي على الخرز والأجسام المضادة في رف المغناطيسي (انظر المواد PDF) والسماح حبات لربط المغناطيسي لحوالي 1-2 دقائق. إزالة طاف يحتوي على الأجسام المضادة غير منضم وغسل العازلة باستخدام ماصة 1 مل. ستظل منضمة إلى حبات جدار أنبوب 1.5 مل على الجانب المجاور إلى المغناطيس.
    5. شطف حبات مرتين مع 1 مل من غسل العازلة في كل مرة كما هو موضح في القسم 2.1.4. إزالة أنبوب 1.5 مل من رف وعكس المغناطيسية لفترة وجيزة لمزج الخرز وغسل العازلة خلال كل خطوة الغسيل.
    6. تخزين حبات محددة الأجسام المضادة في غسل العازلة حتى على استعداد لمواصلة الخطوة 2.7. لا ينبغي أن يسمح حبات لتجف في أي مرحلة من البروتوكول.
  2. تشريح الأنسجة اليرقات في PBT ونقل الأنسجة تشريح لكذلك واحدة من الطبق 9 جيدا. عادة، تشريح الفص البصري والعين القرص تخيلي من 100 يرقات العمر الثالث يوفر مادة كافية لتحليل التعبير الجيني المصب التالية العزلة نوى.
  3. شطف الأنسجة المعزولة في استخراج العازلة النووية (10 ملي HEPES-كوه، ودرجة الحموضة 7.5؛ 2.5 ملي MgCl 2 و 10 ملي بوكل) في أنبوب 1.5 مل. نقل أنسجة اليرقات معزولة إلى 1 مل الخالط Dounce (انظر المواد PDF) على الجليد يحتوي على 1 مل من العازلة استخراج نووية جديدة. احتضان على الجليد لمدة 5 دقائق. فإنه ليس من الضروري إضافة مثبطات الأنزيم البروتيني إذا RNA هو استخراجها التالية العزلة نوى.
  4. تعطيل الأنسجة بنسبة 20 السكتات الدماغية مع مدقة فضفاضة وثم احتضان العينة على الجليد لمدة 10 دقيقة للسماح للخلايا لتنتفخ. استخراج النواة من الخلايا باستخدام 15 السكتات الدماغية مع مدقة ضيقة. يحتاج عدد من السكتات الدماغية مع المطاحن فضفاضة وضيقة ليكون الأمثل لأنسجة مختلفة وأنواع الخلايا؛ التجانس الزائد يمكن أن يؤدي إلىالمنفصمة النوى، في حين أن عدم كفاية التجانس لا استخراج كافة النوى من الأنسجة.
  5. تحديد جناسة، الذي يحتوي على نواة والحطام الخلوية، من خلال 40 ميكرون مسام الحجم مصفاة (انظر المواد PDF) التي تم prerinsed مع العازلة التجانس النووية. جمع جناسة تصفيتها في أنبوب جديد.
  6. جمع عينات ما قبل العزلة لتحليلها لاحقا لتحديد العائد النوى، نوى النزاهة، وتحديد مستويات النص من الجينات المستهدفة قبل النوى العزلة.
    1. نقل 50 ميكرولتر من جناسة تصفيتها إلى الطازجة أنبوب 1.5 مل باستخدام ماصة. هذا هو نموذج ما قبل العزلة. إضافة 500 ميكرولتر من كاشف Trizol (انظر المواد PDF، تنبيه)، قلب لخلط، وتخزينها في -20 درجة مئوية لعزل الحمض النووي الريبي لاحقة (الخطوة 3.1).
    2. نقل 20 ميكرولتر من جناسة تصفيتها إلى الطازجة 1.5 مل أنبوب.
      1. إضافة دابي لتركيز النهائي من 0.1 ميكروغرام / مل، والمؤتمر الوطني العراقيعينة أوباتي على الجليد لمدة 10 دقيقة.
      2. نقل نوى دابي الملون إلى ساترة المغلفة بولي يسين، ووضع على شريحة المجهر. ختم ساترة باستخدام طلاء الأظافر واضحة.
      3. التحقق من سلامة نوى، وجود نواة GFP الموسومة ذات الاهتمام باستخدام المجهر الفلورسنت. ملاحظة: ليس من الضروري لإصلاح نوى، أو وصمة عار لGFP إذا تم تحليل هذه الشرائح بسرعة معقولة التالية إعداد (في غضون 24 ساعة).
    3. نقل 10 ميكرولتر من جناسة تصفيتها إلى الطازجة 1.5 مل أنبوب وإضافة 90 ميكرولتر من غسل العازلة (1X PBS، ودرجة الحموضة 7.4؛ 2.5 ملي MgCl 2). إضافة دابي لتركيز النهائي من 0.1 ميكروغرام / مل، واحتضان على الجليد لمدة 10 دقيقة. تحديد العائد نوى في العينة قبل العزل باستخدام عدادة الكريات لحساب نوى-دابي إيجابية باستخدام epifluorescence تحت هدف الهواء 10X.
  7. وضع أنبوب 1.5 مل تحتوي على حبات محددة الأجسام المضادة (المعد في القسم 2.1.6) في رفوف المغناطيسي،وتسمح حبات مغناطيسية لربط المغناطيس لمدة 2 دقيقة على الأقل كما هو موضح في القسم 2.1.4. إزالة غسل العازلة من الخرز محددة الأجسام المضادة باستخدام ماصة 1 مل، وإضافة جناسة تصفيتها من الخطوة 2.5 إلى أنبوب 1.5 مل باستخدام ماصة 1 مل.
  8. عكس بلطف الأنبوب عدة مرات لخلط، واحتضان عند 4 درجة مئوية لمدة 30 دقيقة مع نهاية الإفراط في نهاية الانفعالات. تجنب فقاعات في أنبوب إذا كان ذلك ممكنا لأن هذه يمكن أن يؤدي إلى تراكمها من نوى.
  9. وضع أنبوب 1.5 مل تحتوي على حبات محددة الأجسام المضادة وجناسة في رفوف المغناطيسي، والسماح حبات مغناطيسية لربط المغناطيس لمدة 2 دقيقة على الأقل كما هو موضح في القسم 2.1.4. إزالة جناسة تحتوي على جزء نوى غير منضم باستخدام ماصة 1 مل.
  10. غسل العينة 3X مع 1 مل من غسل العازلة في كل مرة. إزالة أنبوب 1.5 مل تحتوي على الخرز، ونوى ملزمة وغسل العازلة من رف وعكس لخلط عدة مرات، ثم وضع أنبوب في رف المغناطيسي كما هو موضحفي الخطوة 2.9 وإزالة طاف باستخدام ماصة 1 مل.
  11. إضافة 150 ميكرولتر من غسل العازلة إلى الخرز، والتي ينبغي أن تكون ملزمة لنواة الهدف. هذا هو نموذج آخر العزلة. تحضير عينات للتحليل المجهري واستخراج الحمض النووي الريبي لاحقة.
    1. نقل 20 ميكرولتر من العينة آخر العزلة إلى أنبوب 1.5 مل الطازجة وصمة عار مع دابي وتحليل كما هو موضح في القسم 2.6.2. عد GFP + / + دابي وGFP-/DAPI + نوى استولت عليها حبات مغناطيسية لتحديد نقاء GFP + نوى التخصيب في عينة آخر العزلة.
    2. إضافة 1 مل من كاشف Trizol إلى ما تبقى من العينة آخر العزلة، عكس لخلط، وتخزينها في -20 درجة مئوية لعزل الحمض النووي الريبي لاحقة (الخطوة 3.1). ملاحظة: يمكن تخزين العينات في Trizol لعدة أسابيع إذا لزم الأمر في -20 درجة مئوية. فإنه ليس من الضروري أزل النوى من حبات مغناطيسية قبل استخراج الحمض النووي الريبي باستخدام Trizol كاشف، becausه حبات لا تتداخل مع عزل الحمض النووي الريبي لاحقة.

3. تحديد مستويات النص في النواة المعزولة من اليرقات الأنسجة

  1. عزل الحمض النووي الريبي من قبل العزلة والعزلة آخر عينات أعدت في الأقسام 2.6.1 و2.11.2 باستخدام بروتوكول قياسي لاستخراج الحمض النووي الريبي وصفت مقرها Trizol (انظر المواد PDF) مع إجراء التعديلات التالية:
    1. بعد هطول الأمطار من بيليه الحمض النووي الريبي، إضافة 19.2 ميكرولتر من ريبونوكلياز خالية من المياه و 0.8 ميكرولتر من كاشف RNASecure (انظر المواد PDF) لبيليه واحتضان عند 60 درجة مئوية لمدة 20 دقيقة إلى تعطيل RNAses.
  2. تحديد تركيز الحمض النووي الريبي مع صبغة الفلورسنت الحمض النووي الريبي ملزمة مثل مجموعة RNA و qubit فحص (انظر المواد PDF) باستخدام QubitR 2.0 التألق التالية بروتوكول الشركة المصنعة.
  3. توليف [كدنا] باستخدام الناسخ العكسي تضخيم مثل EpiScrIPT عكسي عدة الناسخ والاشعال oligodT باتباع إرشادات الشركة المصنعة. ملاحظة: عادة، و 50 إلى 100 نانوغرام من الحمض النووي الريبي [كدنا] يولد كافية لإجراء تحليلات متعددة التعبير الجيني. المبالغ المعادلة من قبل العزلة والعزلة RNA آخر ينبغي أن تستخدم لتوليد [كدنا].
  4. إضافة 180 ميكرولتر من nuclease خالية من المياه لعينة [كدنا] 20 ميكرولتر لتمييع هذا 10 أضعاف قبل الوقت الحقيقي PCR الكمي (QPCR) التحليل. هذا التخفيف هو خطوة مهمة، وذلك لأن عينات [كدنا] مخفف يمكن أن تمنع QPCR.
  5. إعداد مزيج الرئيسي QPCR مع البلمرة وdNTPs، 4 pmoles كل من الأمام وعكس التمهيدي، تتكون مع الماء المعقم لحجم رد الفعل النهائي من 20 ميكرولتر.
    1. تصميم الاشعال QPCR لاستهداف الجينات التي من المتوقع أن يتم التعبير عنها في نوع من الخلايا في المصالح، وفي المرحلة التنموية التي يتم جمعها الأنسجة. الاشعال تصميم لتمتد على إنترون إذا أمكن، بحيث الجيني وويمكن التمييز بين المنتجات [كدنا] PCR. ملاحظة: إذا كان الوضع التعبير الجيني من نوع الخلية المستهدفة غير معروف، الاشعال ضد EGFP، والتي ينبغي أن تتجلى على وجه التحديد في عدد السكان نوى الموسومة، ويمكن استخدامها لتحسين بروتوكول لنوع خلية معينة والأنسجة (الجدول 1).
  6. تحديد مستويات النص النسبية لكل الجينات في المصالح في عينات ما قبل وبعد العزلة العزلة من خلال المقارنة إلى سلسلة التخفيف من [كدنا] أعدت من النسيج كله. وينبغي تطبيع مستويات النص من الجينات المستهدفة لجين مرجعية مثل Rpl32 (أو يفضل العديد من الجينات المرجعية).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

وأعرب السائق الريبو-GAL4 (بلومنجتون الأسهم رقم 7415) وتحديدا في الخلايا الدبقية في الجهاز العصبي ذبابة الفاكهة في مراحل متعددة من التنمية 18. تم إنشاؤها الذباب التي تعبر عن ثابت UAS-EGFP :: MSP-300 KASH تحت سيطرة السائق الريبو-GAL4 باستخدام تقنيات وراثية القياسية. لتوصيف نمط التعبير عن EGFP :: KASH التحوير في هذه الذباب، تم فحص نمط GFP التعبير في الفص البصري وتشريح العين قرص تخيلي من يرقات العمر الثالث باستخدام متحد البؤر المجهري. تم تشريح الأنسجة counterstained مع دابي بمناسبة الحمض النووي ومع α-chaoptin 19 لتسمية المحاور مبصرة (mAb24B10، انظر المواد PDF). ويبين الشكل 1A أن EGFP مدفوعة الريبو-GAL4 :: يعبر عن KASH التحوير في الدبقية في الفص البصري والعين القرص تخيلي في نمط التعبير المتوقع. تحت أعلى التكبير،ويلاحظ EGFP التعبير في نمط دائري المحيطة الحمض النووي دابي إيجابية، بما يتفق مع المغلف النووية توطين EGFP :: KASH علامة (الشكل 1B). ويمكن الكشف عن EGFP التعبير سواء في الثابتة وغير الثابتة في الأنسجة دون الحاجة لتضخيم إشارة باستخدام الأجسام المضادة ضد GFP؛ لم تستخدم الأجسام المضادة ضد GFP لتصور EGFP :: KASH التعبير في الصور المبينة في أرقام 1 و 2. لتحديد ما إذا كان يتم التعبير عن التحوير EGFP :: KASH nonspecifically في أي الأنسجة الأخرى في يرقات ذبابة الفاكهة، تم فحص GFP التعبير كليا يرقات العمر الثالث باستخدام مضان تشريح المجهر. والجدير بالذكر أن التعبير غير محدد من EGFP :: وحظ KASH التحوير عند مستويات مرتفعة في الغدد اللعابية لليرقات العمر الثالث. هذا يشير إلى أن السائق الريبو-GAL4 له نشاط في بعض أنواع الخلايا الأخرى من الدبقية في مرحلة اليرقات التنمية. وهكذا، لعزل تحديدا GLIنواة القاعدة وتم عزل الفص البصري والعين القرص تخيلي من يرقات العمر الثالث باستخدام تشريح قبل التجانس والتقارب والعزل.

للتأكد من أن هذا البروتوكول هو مناسبة لاستخراج النوى من الأنسجة ذبابة الفاكهة، وتقدير النسبة المئوية للنوى الموسومة موجودة في نسيج معين، العينة قبل العزلة (القسم 2.6.2) من الخليط تم الحصول عليها من الفص البصري والعين قرص تخيلي من الريبو-GAL4، UAS-EGFP :: تم فحص MSP-300 KASH الطور الثالث اليرقات. الشكل 2A يظهر صورة ممثل العينة قبل العزلة الحصول عليها باستخدام متحد البؤر المجهري. في هذه الصورة، وأشارت إلى وجود نواة من قبل الأحداث دابي إيجابية. ويلاحظ أيضا عدد صغير من منتشرة GFP إيجابية،-دابي إيجابية نوى الدبقية. نحن نقدر أن نوى GFP إيجابية تشكل أقل من 2٪ من مجموع السكان في هذه النوىالعينة (الشكل 2A). تم تحديد مجموع العائد من نوى الفص البصري والعين أقراص تخيلي أن تم تشريح من 100 اليرقات للعينة قبل والعزل كما هو موضح في القسم 2.6.3 (الجدول 2). عينة ما قبل العزل نموذجية من 100 تشريح الفص البصري والعين أقراص تخيلي الواردة بين 0.8 و 1.2 × 10 7 نوى، منها ما يقرب من 2٪ كانت GFP إيجابية. يبين الشكل 2B صورة ممثل نوى دابي إيجابية في منطقة محددة من عدادة الكريات. علما بأن نواة سليمة، والحفاظ على شكل دائري متسقة وفقا للشروط استخراج المستخدمة في بروتوكول (أرقام 2A و 2B).

لتحديد ما إذا كان هذا البروتوكول يمكن استخدامها لعزل و / أو غاية إثراء فئات معينة من السكان من النوى وصفت من الأنسجة التي تحتوي على السكان الخلية مختلطة، كانت α-GFP المغلفة الأضداد حبات مغناطيسية استخدامد لعزل نواة الموسومة من الخليط تم الحصول عليها من الفص البصري والعين القرص تخيلي من 100 الريبو-GAL4، UAS-EGFP :: MSP-300 KASH الطور الثالث اليرقات. في أرقام 2C و 2D، فإنه يمكن أن نرى أن EGFP :: KASH الموسومة نوى الدبقية ربط إلى حبات مغناطيسية α-GFP المغلفة والتي لوحظت في نموذج آخر العزلة (قسم 2.11.1) بعد الفصل المغناطيسي. على الرغم من أن حبات مغناطيسية تظهر بعض تألق ذاتي في القناة GFP، وهذه يمكن أن تكون متباينة بسهولة من نوى محددة بواسطة حبة حجمها أصغر (2.8 ميكرومتر لحبات المغناطيسي مقابل حوالي 5 ميكرون لنوى) وعدم تلطيخ دابي. حساب GFP + / + نوى دابي لأكثر من 95٪ من الأحداث الإيجابية دابي في العينة آخر العزلة. وبالتالي، الموسومة الهدف السكان نوى يتم التخصيب في آخر العزلة عينة نسبة إلى ما قبل العزلةالعينة. وعادة ما تكون محاطة غالبية نوى في آخر العزلة عينة قوامها عرض المغلف النووية المترجمة مضان GFP، والخرز. ومع ذلك، فمن الممكن أن عددا صغيرا من نوى معلم يمكن أن يكون حاضرا أيضا في هذه العينة. وبالتالي، على الرغم من أن النتائج في الشكل 2C وفي تحليل التعبير الجيني في الشكل 3 (انظر أدناه) تشير إلى أن الهدف الموسومة يتم التخصيب السكان نوى الدبقية، واحتمال أن بعض النوى من بعض أنواع الخلايا الأخرى غير محددة موجودة أيضا في العينة لا يمكن استبعادها. فمن المستحسن أن المستخدمين تحسين هذا البروتوكول لنوع من الخلايا الخاصة والأنسجة من الاهتمام لتعظيم تخصيب من السكان نوى الهدف، والقضاء على نواة غير محددة ملزمة. على وجه الخصوص، فإن نسبة من المواد ابتداء بالنسبة إلى الأجسام المضادة وحبات من المرجح أن تكون مهمة للتخصيب الأمثل للنواة الهدف. لهذا السبب، فإن نطاقات من الكلوتظهر أرقام النوى الموجودة في عينات ما قبل العزلة نموذجية لدينا في الجدول 2. استنادا إلى مجموع أعداد النوى الموجودة في عينة ما قبل العزلة، والنسبة المقدرة من الخلايا الدبقية في السكان مختلطة من الفص البصري والعين القرص تخيلي، كان من المتوقع أن يكون بين 1.6 أقصى قدر من المحصول نوى في العينة آخر العزلة 5 × 10 و 2.4 × 10 5 النوى. ومع ذلك، باستخدام عدادة الكريات لتحديد العائد نوى كما هو موضح في الخطوة 2.6.3، كان العائد نوى الفعلية التي تم الحصول عليها في العينة آخر العزلة بين 1.3 × 10 4 و 2.7 × 10 4 نوى. تمثل هذه العوائد نوى تقديرات تقريبية جدا لأن الخرز موجودة في العينة آخر العزلة تظهر أن يؤثر التحميل دقيقة من عدادة الكريات. ويلاحظ بعض نوى GFP إيجابية في جناسة غير منضم، مشيرا إلى أن ليس كل النوى GFP إيجابية في لياليربط وافرة لحبات بكفاءة في ظل الظروف المستخدمة في هذا البروتوكول. زيادة وقت ملزمة أو تنفيذ الخطوات العزلة متتابعة يحتمل زيادة هذا العائد، ولكن هذا قد يأتي على حساب كل من نقاء وسلامة الحمض النووي الريبي. باستخدام الظروف الموصوفة في هذا البروتوكول، وكميات كافية من الحمض النووي الريبي يمكن الحصول عليها في العينة آخر العزلة عن المصب تحليل التعبير الجيني عن طريق QRT-PCR (الجدول 2). وبالتالي، فإن هذا البروتوكول هو قادر على بسرعة وبشكل صارم عزل نواة الهدف من الأنسجة التي تحتوي على عشائر مختلطة من الخلايا. علاوة على ذلك، وأنها قادرة على عزل النوى تحديدا الهدف الذي تشكل سوى نسبة صغيرة، أقل من 5٪ من الخلايا في مجموعة سكانية معينة.

لمزيد من تأكيد أن العينة آخر العزلة والتخصيب لدينا هدف الدبقية السكان نوى، ومستويات النصوص لمدة 4 جينات مختلفة في مرحلة ما قبل العزلة وبعد العزلة العينات بواسطة RT-QPCR. تم تحديد مستويات النص من elav، nrv2 وEGFP في العينتين، وتطبيع الجين المرجعية، Rpl32، وهو ما يعبر عنه عند مستويات تعادل في الخلايا الدبقية والجهاز العصبي المركزي المحيطة (الشكل 3). ويظهر الفرق أضعاف في العينة آخر العزلة النسبية للعينة قبل والعزلة، والتي من المقرر أن واحد. في الشكل 3، يبين نموذج آخر العزلة أقل بكثير مستويات النص من الخلايا العصبية محددة elav الجينات بالنسبة لعينة ما قبل العزلة. هذا يدل على أن نواة من خلايا العصبية ممثلة تمثيلا ناقصا في العينة آخر العزلة. في المقابل، مستويات النص أعلى من كل من التخصيب الدبقية nrv2 الجين 10 و EGFP موجودة في آخر عزلة-نشوئها العينة بالنسبة إلى عينة قبل العزلة. هذه النتيجة تشير إلى أن العينة آخر العزلة والتخصيب لهدف الدبقية السكان نوى. من المهم أن نلاحظ أن قياس مستويات النص في هذا البروتوكول تمثل النصوص النووية، وبالتالي من المرجح أن تشير إلى مستويات النسخ النشطة بدلا من مرنا حالة مستقرة. لم يتم الكشف عن التعبير استنساخه من الريبو في أي لدينا ما قبل أو ما بعد العزلة العزلة العينات، مما يشير إلى أن البروتين GAL4 أعرب من قبل برنامج تشغيل الريبو-GAL4 قد تستمر بعد النسخ من الجينات النشطة الريبو المحلية قد توقفت. وهذا يتفق مع النتائج المستمدة من الدراسات الأخرى التي وصفت نوى باستخدام المروج التوي لا تظهر مستويات المخصب من النصوص التوي، وربما يرجع ذلك إلى الاختلافات في توقيت التنموية النسخ مقابل استقرار البروتين 8. تاكأون معا، تثبت هذه النتائج أن البروتوكول وصف يمكن أن تستخدم بنجاح لتخصيب عالية نوى الهدف من الأنسجة التي تحتوي على عشائر مختلطة من الخلايا، وأن نواة معزولة هي مناسبة لتحليل التعبير الجيني.

الشكل 1
الشكل 1. نمط التعبير عن الريبو-GAL4، UAS-EGFP :: MSP-300 KASH خط الطيران. (A) في يرقات العمر الثالث، الريبو-GAL4 يدفع التعبير عن التحوير UAS-EGFP :: MSP-300 KASH في الخلايا الدبقية في الضوئية الفص، ساق البصرية (OS) والعين القرص تخيلي (ED). هو المسمى المغلف النووي في الخلايا الدبقية مع EGFP :: KASH (الخضراء). وصفت R8 محاور عصبية خلية مستقبلة للضوء مع α-chaoptin (mAB24B10 والأحمر) للمقارنة، والحمض النووي هو ستا - R1INED مع دابي (البنفسجية). GFP المسمى نوى الدبقية مرئية على طول الصفيحة (لا) في الفص البصري (تميزت السهام). شريط النطاق، 50 ميكرومتر. (ب) صورة التكبير العالي من العقد الصفيحة من الفص البصري الذي يحتوي EGFP :: KASH نوى الخلايا الدبقية المسمى. شريط النطاق، 50 ميكرومتر. تم الحصول على صور متحد البؤر باستخدام إما   40X / 1.30 النفط أو   20X / 0.75 هدف النفط الغمر، وباستخدام موجات الإثارة / الانبعاثات من 408 نانومتر nm/425-475 (دابي)؛ 488 nm/525-550 نانومتر (GFP)؛ 561 nm/595-620 نانومتر (5،6،8 اليكسا ). الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الرقم 2
الشكل 2. توصيف نوىفي "ما قبل العزلة" وعينات "آخر العزلة". (A) صورة الممثل من الريبو-GAL4، UAS-EGFP :: تحليل MSP-300 KASH عينة ما قبل العزل باستخدام X 20 / 0.75 هدف الغمر النفط القياسية و المجهر متحد البؤر. اتسخت الحمض النووي مع دابي (الأزرق)، والموسومة EGFP :: KASH ترد نوى الدبقية باللون الأخضر (تميزت السهام). شريط النطاق، 50 ميكرومتر. (ب) صورة الممثل من نوى دابي الملون من عينة ما قبل العزلة على عدادة الكريات باستخدام الهدف الهواء X 10 والمجهر epifluorescence القياسية. وتظهر شبكات عدادة الكريات باللون الرمادي الفاتح. وتظهر نواة فقط-دابي إيجابية في هذه الصورة، كما كان GFP مضان غير مرئية في إطار هذا الهدف على المجهر epifluorescence. (C) صورة الممثل من الريبو-GAL4، UAS-EGFP :: MSP-300 عينة KASH آخر العزلةتحليل كما هو موضح لوحة A. وEGFP معزولة :: KASH الموسومة نوى الدبقية (تميزت السهام) وصمة عار إيجابيا للدابي، وتحيط بها الخرز، والتي autofluoresce عند مستويات منخفضة في القناة GFP. شريط النطاق، 50 ميكرومتر. (D) صورة التكبير العالي من EGFP معزولة النموذجية :: KASH الموسومة نوى الدبقية (تميزت السهم) محاطة الخرز. شريط النطاق، 5 ميكرون. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الرقم 3
الرقم 3. البيانات QRT-PCR ممثل عن "ما قبل العزلة" وعينات "آخر العزلة". تم تحديد مستويات النص من الجينات المستهدفة من قبل QRT-PCR من قبل ISOLعينات أوجه وآخر العزلة الحصول عليها من الريبو-GAL4، UAS-EGFP :: MSP-300 KASH الفصوص البصرية وأقراص تخيلي العين. يتم تطبيع جميع مستويات النص إلى مستويات النص Rpl32، ويتم تعيين عينة قبل والعزل لكل هدف الجينات إلى واحد. وتظهر نتائج ممثلة من تجربة بيولوجية واحدة للجينات التالية: elav، nrv2 وEGFP.

جينة تسلسل التمهيدي (5 '-3') حجم المنتج PCR (بي بي)
EGFP GAGGGATACGTGCAGGAGAG 102
GATCCTGTTGACGAGGGTGT
nrv2 GGCTGGTTGTAGTCGCAGTT 125
GGCACCCAACACGAGAACTA
elav GCACCATTCGGAGCAATAAT 153
TGTGCAGCTGGATGGTGTAG
Rpl32 GCTAAGCTGTCGCACAAATG 160
CGTTGTGCACCAGGAACTT

الجدول 1. الاشعال تستخدم لتحليل QRT-PCR.

مجموع عدد النوى في عينة ما قبل العزلة يقدر العدد الإجمالي للنوى في العينة آخر العزلة العائد الحمض النووي الريبي من العينة آخر العزلة (نانوغرام)
0،8-1،2 × 10 7 1،3-2،7 × 10 4 160-220 نانوغرام

الجدول 2. نوى الممثل وغلة الحمض النووي الريبي التي تم الحصول عليها.نطاقات نموذجية من النوى وغلة الحمض النووي الريبي التي تم الحصول عليها من عينات ما قبل وبعد العزلة العزلة من 100 تشريح الفص البصري والعين أقراص تخيلي من الريبو-GAL4، UAS-EGFP :: MSP-300 KASH الوراثي، الذي وصفت الخلايا الدبقية مع EGFP :: KASH. وتم قياس كمية النوى كما هو موضح في 2.6.3 وكان كميا RNA كما هو موضح في 3.1.2.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

هذا البروتوكول يمكن استخدامها لعزل أو إثراء للغاية على وجه التحديد نوى الموسومة من السكان الخلية المختلطة في ذبابة الفاكهة أو الأنسجة الجنينية اليرقات. باستخدام هذا البروتوكول، يمكن عزل نواة من أنسجة تشريح في حوالي 1 ساعة. يجب تحديد نقاء والعائد من النوى معزولة تجريبيا لكل نوع من الخلايا. يمكن أن يكون من الصعب تحديد نواة محددة حبة في مرحلة ما بعد العزلة للبروتوكول باستخدام عدادة الكريات بسبب حبات موجودة في العينة. وبالتالي، إذا كانت هناك حاجة الأعداد الدقيقة للنواة لتطبيق المصب، سيكون من الضروري لتقدير العائد النوى على أساس طريقة بديلة مثل محتوى الحمض النووي. حسابات الدقيقة من العائد النوى ليست ضرورية لتحليل التعبير الجيني RNA إذا يمكن عزل بنجاح وكميا. فمن المستحسن استخدام أسلوب قائم على مضان لقياس العائد الحمض النووي الريبي، كما وجدنا أن تقرير الطيفي من تركيز الحمض النووي الريبيفي هذه العينات تركيز منخفض متغير بدرجة كبيرة.

هناك نوعان من الجوانب الهامة للبروتوكول من شأنها أن تؤثر نجاحها: اختيار حبات مغناطيسية والأجسام المضادة. تتوفر تجاريا الخرز المغناطيسية التي تقترن لGFP أو بروتين G من عدة مصادر مختلفة. ومع ذلك، فمن المستحسن بشدة لاستخدام بروتين G حبات مغناطيسية المتاحة من إينفيتروجن للإجراءات المنصوص عليها في هذا البروتوكول لسببين رئيسيين. الأولى، وحجم حبات إينفيتروجن عند 2.8 ميكرون أصغر قليلا من متوسط ​​حجم نواة في أنواع الخلايا قمنا فحصها، وهو ما يقرب من 5 ميكرون (الشكل 2D). حبات المغناطيسي التي هي أصغر (على سبيل المثال 50 نانومتر، μMACS α-GFP، Miltenyi التكنولوجيا الحيوية) لا تلزم بسرعة إلى مغناطيس نمط دفعة غسل، والأعمدة المقدمة لهذه الخرز يمكن أن تسد مع مقتطفات الأنسجة اليرقات. حبات مغناطيسية أكبر (على سبيل المثال 10 ميكرون، والبروتين PureProteome G ب المغناطيسيلم EADS، ميليبور) لا تربط جيدا لنوى في الاختبارات الأولية لدينا، وهذه أيضا يحمل تألق ذاتي قوي في نفس القنوات على حد سواء دابي وGFP، مما يجعل من الصعب تحديد نوى في عينة محددة حبة بواسطة تقنيات المجهر القياسية. بالإضافة إلى اختيار حبات مغناطيسية، فمن المهم استخدام الأجسام المضادة GFP التي تعمل بشكل جيد للمناعي ولكن ليس لديها خلفية غير محددة عالية. للمساعدة في استنساخ هذا البروتوكول، ونحن قد استخدمت الأجسام المضادة وحيدة النسيلة ضد GFP الماوس. كما تم محاكمتهم الأجسام المضادة ضد GFP الأرنب بولكلونل بنجاح في الدراسات الأولية لدينا، ولكن هذه تميل إلى أن يكون أعلى الخلفية غير محددة. تم اختبار الأجسام المضادة وحيدة النسيلة الأخرى أيضا (على سبيل المثال البنك التنموي الدراسات ورم هجين)، وبدرجات متفاوتة من النجاح. وهكذا، واختيار الأضداد هو عامل مهم في نجاح العزلة من نوى المسمى.

على الرغم من أن في هذا البروتوكول وصفنا طرق لديتفرو القاقم مستويات النص الجينات في نواة معزولة، فمن المتوقع أن النهج هو موضح في الخطوات 2،1-2،11 ستكون أيضا مناسبة لعزل النوى التي يمكن استخدامها لاحقة تحليل مناعي لونين. إذا تم إصلاح الأنسجة في 1٪ الفورمالديهايد قبل التجانس (الخطوة 2.3)، ثم تشريح الأنسجة يمكن جمعها على مدى عدة أيام ومادية كافية معزولة لإجراء تحليل مناعي لونين. استنادا إلى التهم التي تم الحصول عليها باستخدام عدادة الكريات، والتي توفر تقديرات تقريبية فقط كما هو مبين أعلاه، ونحن عادة الحصول على 1.3 × 10 4 و 2.7 × 10 4 نوى الدبقية من القرص تخيلي العين والفص البصري من 100 اليرقات (الجدول 2). وهكذا، وذلك باستخدام نهجنا، فإنه ينبغي أن يكون من الممكن الحصول على مواد كافية لإجراء تحليل مناعي لونين، وهذا يتوقف على وفرة من نوع من الخلايا المستهدفة، وحاتمة من الفائدة.

واحد التطبيق الوراثية مفيدة من هذه TECHNIكيو هو أنه يمكن أن تستخدم لتسمية إيجابيا نوى في أنواع معينة من الخلايا في الأجنة أو اليرقات التي هي متماثلة اللواقح بالنسبة لأليل متحولة قاتلة المتنحية. لتحقيق ذلك، يجب أن يتم إنشاء اثنين من الأسهم ذبابة منفصلة حيث يتم معاد أليل متحولة من الفائدة مع سائق GAL4 محددة، أو مع التحوير UAS-EGFP :: MSP-300 KASH على الكروموسوم الثالث. وإذا عبرت الذباب تحمل أليل متحولة والسائق GAL4 لالذباب يحمل الأليلات الطافرة والتحوير UAS-EGFP :: MSP-300 KASH، ذرية فقط أن يكون على حد سواء نسخ من أليل متحولة يكون المسمى مع GFP في الأنسجة التي وأعرب السائق GAL4. وبالتالي، والآثار خلية محددة من الأليلات المتنحية المميتة يمكن فحصها في المراحل الجنينية أو اليرقات، وذلك قبل مرحلة الفتك. تم عرض هذه التقنية الجينية المستخدمة سابقا لتسمية الخلايا في العضلات بشكل إيجابي الجنينية التي كانت متماثلة اللواقح بالنسبة طفرات في الوحيدات SAGA، sgf11 1 </ سوب>.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

والكتاب ليس لديهم ما يكشف.

Acknowledgments

نشكر جانيس فيشر لتوفير البلازميد UAS-EGFP :: MSP-300 KASH. تم الحصول على الضد mAB24B10 من دراسات البنك التنموي ورم هجين وضعت تحت إشراف معاهد الصحة القومية والتي تحتفظ بها جامعة ولاية ايوا، قسم الأحياء. تم الحصول على الأوراق المالية الريبو-GAL4 (BL7415) من مركز بلومينغتون الأسهم في جامعة إنديانا. بدعم من جمعية السرطان الأمريكية المؤسسية بحوث غرانت (IRG # 58-006-53) لمركز جامعة بوردو لأبحاث السرطان هو اعترف بامتنان. ويدعم Jingqun ما قبل البحوث الزراعية في جامعة بوردو في مساعدة مالية للأغذية والزراعة من جامعة بوردو.

Materials

Name Company Catalog Number Comments
Anti-chaoptin antibody (mouse, monoclonal) Developmental Studies Hybridoma Bank mAB24B10
Anti-GFP antibody (mouse, monoclonal) Roche 11814460001 This specific antibody is recommended for this protocol. However, alternative antibodies could also be used.
2x Bullseye EvaGreen qPCR Mastermix with ROX MidSci BEQPCR-R
DAPI (4',6-diamidino-2-phenylindole, dihydrochloride salt) Biotium 40011
Dounce Homogenizer (1 ml) VWR 62400-595
Dumont #5 Tweezers, 11 cm World Precision Instruments 14095
Dynabeads Protein G for Immunoprecipitation Invitrogen 10003D This specific brand of magnetic beads is recommended for this protocol.
EpiScript Reverse Transcriptase Epicentre ERT12910K http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf
Falcon cell strainers, 40 μm pore size VWR 21008-949 Alternative pore sizes could be used, depending on the size of the target cell nuclei.
Magnetic stand (8 x 1.5 ml tubes) Millipore LSKMAGS08 
Mini tube rotator Genemate H-6700
Qubit starter kit Life Technologies Q32871 Similar fluorescence-based methods for quantifying RNA yield could be used. http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdfZ
RNAsecure (Ambion) Life Technologies AM7010 The use of this reagent to inactivate RNAses is optional.
RT-PCR machine Thermal Cycler BioRad CFX Connect Thermal Cycler
Siliconized 9-well glass plate Hampton Research HR3-134
Stereomicroscope Fluorescence Adapter (Royal Blue (440-460 nm) excitation + yellow barrier Nightsea This adaptor enables GFP fluorescence to be examined using a typical dissecting microscope (eg Nikon)
StereoZoom Microscope 83604 Set with 10X Wide Field Eyepieces and Universal Boom Stand Nikon SMZ 745
Thermal Cycler BioRad T100
Trizol reagent Life Technologies 15596018 CAUTION; Alternative RNA extraction methods can be used. http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf
Tween 20 Amresco 0777-1L

DOWNLOAD MATERIALS LIST

References

  1. Weake, V. M., et al. Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation. Genes Dev. 25, 1499-1509 (2011).
  2. Bonn, S., et al. Cell type-specific chromatin immunoprecipitation from multicellular complex samples using BiTS-ChIP. Nat. Protoc. 7, 978-994 (2012).
  3. Haenni, S., et al. Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq. Nucleic Acids Res. 40, 6304-6318 (2012).
  4. Barthelson, R. A., Lambert, G. M., Vanier, C., Lynch, R. M., Galbraith, D. W. Comparison of the contributions of the nuclear and cytoplasmic compartments to global gene expression in human cells. BMC Genom. 8, 340 (2007).
  5. Zhang, C., Barthelson, R. A., Lambert, G. M., Galbraith, D. W. Global characterization of cell-specific gene expression through fluorescence-activated sorting of nuclei. Plant Physiol. 147, 30-40 (2008).
  6. Deal, R. B., Henikoff, S. The INTACT method for cell type-specific gene expression and chromatin profiling in Arabidopsis thaliana. Nat. Protoc. 6, 56-68 (2011).
  7. Deal, R. B., Henikoff, S. A simple method for gene expression and chromatin profiling of individual cell types within a tissue. Dev Cell. 18, 1030-1040 (2010).
  8. Steiner, F. A., Talbert, P. B., Kasinathan, S., Deal, R. B., Henikoff, S. Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Genom. Res. 22, 766-777 (2012).
  9. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, 401-415 (1993).
  10. Henry, G. L., Davis, F. P., Picard, S., Eddy, S. R. Cell type-specific genomics of Drosophila neurons. Nucleic Acids res. 40, 9691-9704 (2012).
  11. Starr, D. A. KASH and SUN proteins. Curr Biol. 21, 414-415 (2011).
  12. Fischer, J. A., et al. Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics. 168, 1385-1393 (2004).
  13. Patterson, K., et al. The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol. Biol. Cell. 15, 600-610 (2004).
  14. Yu, J., et al. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev. Biol. 289, 336-345 (2006).
  15. Bischof, J., Maeda, R. K., Hediger, M., Karch, F., Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007).
  16. Kracklauer, M. P., Banks, S. M., Xie, X., Wu, Y., Fischer, J. A. Drosophila klaroid encodes a SUN domain protein required for Klarsicht localization to the nuclear envelope and nuclear migration in the eye. Fly. 1, 75-85 (2007).
  17. Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40, 476-483 (2008).
  18. Sepp, K. J., Schulte, J., Auld, V. J. Peripheral glia direct axon guidance across the CNS/PNS transition zone. Dev. Biol. 238, 47-63 (2001).
  19. Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A., Shotwell, S. L. Monoclonal antibodies against the Drosophila nervous system. Proc. Natl. Acad. Sci. U.S.A. 79, 7929-7933 (1982).
عزل القائم على تقارب من معلم النواة من<em&gt; ذبابة الفاكهة</em&gt; الأنسجة لتحليل التعبير الجيني
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).More

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter